Pancreas targeted liposome as well as preparation method and application thereof

Abstract

The invention discloses a pancreas targeted liposome as well as a preparation method and application thereof, relates to the technical field of nano materials, and aims to solve the technical problem that the existing medicine is relatively low in pancreas targeting efficiency. The pancreas targeted liposome is prepared from hydrogenated lecithin, cholesterol, an aptamer, a fat-soluble drug and a neutral solution, the fat-soluble drug comprises at least one of coenzyme Q10 and curcumin, and the neutral solution comprises at least one of PBS, water, normal saline, a PBS solution of polypeptide, an aqueous solution of polypeptide and a normal saline solution of polypeptide; the polypeptide comprises at least one of exenatide and semeglutide.

Description

Technical Field

[0001] The present application relates to the technical field of nanomaterials, and in particular to a pancreas-targeted liposome and a preparation method and application thereof. Background Art

[0002] Diabetes is one of the four major non-communicable diseases. According to the International Diabetes Federation (IDF), it is estimated that the number of people with diabetes will reach 643 million in 2030 and 783 million in the world by 2045. Type 2 diabetes accounts for 90% of diabetes cases. The global cost of diabetes treatment is high each year, but despite this, millions of people with diabetes die each year.

[0003] Therefore, effective treatment of type 2 diabetes is of great significance not only to the vast majority of patients, but also to the development of the entire society; therefore, it is urgent to develop a highly effective and targeted pancreatic drug. Summary of the invention

[0004] The present application provides a pancreas-targeted liposome and a preparation method and application thereof, aiming to solve the technical problem of low efficiency of existing drugs in targeting the pancreas.

[0005] To solve the above technical problems, the embodiments of the present application provide: a pancreas-targeted liposome, which is composed of hydrogenated lecithin, cholesterol, an aptamer, a fat-soluble drug and a neutral solution; the neutral solution includes at least one of PBS, water, normal saline, a PBS solution of a polypeptide, an aqueous solution of a polypeptide and a normal saline solution of a polypeptide; the polypeptide includes at least one of exenatide and semaglutide; the fat-soluble drug includes at least one of coenzyme Q10 and curcumin.

[0006] As some optional embodiments of the present application, the sequence of the aptamer is (5' to 3'): CGTGCAATGTCGAATGCATGAGCAAACATGGCGAT, with Cholesteryl modified at the 5' end and FAM modified at the 3' end.

[0007] As some optional embodiments of the present application, the molar ratio of the hydrogenated lecithin to the cholesterol is (1.5-4):1, the mass ratio of the fat-soluble drug to the lipid is 1:(10-30), and the lipid refers to hydrogenated lecithin and cholesterol.

[0008] As some optional embodiments of the present application, the mass ratio of the polypeptide to the fat-soluble drug is 2:5, the mass ratio of the fat-soluble drug to the lipid is 1:10 or 1:30, and the molar ratio of the hydrogenated lecithin to the cholesterol is (1.5-2):1.

[0009] On the other hand, the present application also provides: a method for preparing the pancreas-targeted liposome as described above, comprising the following steps:

[0010] The hydrogenated lecithin, cholesterol and fat-soluble drugs are mixed, dissolved in an organic solvent, and evaporated to obtain a phospholipid film;

[0011] A neutral solution is added to the phospholipid film for hydration treatment, and an aptamer solution is added and ultrasonic treatment is performed to obtain a liposome solution.

[0012] As some optional embodiments of the present application, the hydration treatment is at 37°C to 50°C; the ultrasonic treatment refers to ultrasonic power of 100W, ultrasonication for 2s and then stopping for 3s before continuing ultrasonication, and the total ultrasonication time is 10 minutes to 20 minutes.

[0013] As some optional embodiments of the present application, the temperature of the hydration treatment is 40° C. or 50° C., and the total ultrasonic treatment time is 15 minutes.

[0014] As some optional embodiments of the present application, the evaporation to dryness treatment refers to: removing the organic solvent by rotary evaporation at 37° C. and 20 rpm / min, and the evaporation to dryness time is 20 min;

[0015] The organic solvent refers to chloroform.

[0016] As some optional embodiments of the present application, the rotation speed of the hydration treatment is 120 rpm / min, normal pressure, hydration at 40°C to 50°C for 15 minutes to 20 minutes.

[0017] On the other hand, the embodiments of the present application also provide: an application of pancreas-targeted liposomes for preparing a drug targeting the pancreas.

[0018] Compared with the prior art, the technical solution of this application has the following beneficial technical effects:

[0019] The pancreas-targeted liposomes described in this application can effectively improve the stability of polypeptides in the blood circulation system, increase the half-life of drugs, and improve the therapeutic effect. The water solubility of fat-soluble drugs is improved, which can effectively increase their utilization rate and improve the therapeutic effect. The carrier system constructed in this application can achieve active targeting, effectively increase the drug concentration in the target tissue, and at the same time promote the distribution of drugs to the pancreas, improve the oxidative stress of the islets, and restore the function of the islets. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the specific implementation of the present application or the technical solution in the prior art, the following is a brief introduction to the drawings required for the specific implementation or the prior art description. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual scale.

[0021] Figure 1 This is the particle size distribution diagram of (E+Q)-Lip-Apt described in Example 4 of the present application.

[0022] Figure 2 This is a transmission electron micrograph of the (E+Q)-Lip-Apt described in Example 4 of the present application.

[0023] Figure 3 This is the in vitro imaging picture of (E+Q)-Lip-Apt acting on diabetic mice as described in Example 4 of the present application.

[0024] Figure 4 This is a graph showing the effect of (E+Q)-Lip-Apt on glycated hemoglobin in diabetic mice as described in Example 4 of the present application.

[0025] Figure 5 This is a graph showing the effect of (E+Q)-Lip-Apt on the insulin resistance index of diabetic mice as described in Example 4 of the present application.

[0026] Figure 6 This is a graph showing the effect of (E+Q)-Lip-Apt on the MDA content in the liver of diabetic mice as described in Example 4 of the present application.

[0027] Figure 7 This is a graph showing the effect of (E+Q)-Lip-Apt on the SOD activity in the liver of diabetic mice as described in Example 4 of the present application.

[0028] Figure 8 This is the particle size distribution diagram of Cur-Lip-Apt described in Example 2 of the present application.

[0029] Fig. 9 This is a transmission electron micrograph of Cur-Lip-Apt described in Example 2 of the present application.

[0030] Fig.10 This is an in vitro imaging picture of Cur-Lip-Apt acting on diabetic mice as described in Example 2 of the present application.

[0031] Fig.11 This is a graph showing the effect of Cur-Lip-Apt described in Example 2 of the present application on glycated hemoglobin in diabetic mice.

[0032] Fig.12 This is a graph showing the effect of Cur-Lip-Apt on TC in the liver of diabetic mice as described in Example 2 of the present application.

[0033] Fig.13 This is the particle size distribution diagram of (S+Q)-Lip-Apt described in Example 5 of the present application.

[0034] The realization of the purpose, functional features and advantages of this application will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0035] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0036] Under high glucose conditions, β cells will experience oxidative stress imbalance, which will damage the activity of cellular antioxidant enzymes SOD, GPH-Px, and CAT. Oxidative stress and inflammation can damage pancreatic function. Excessive ROS can lead to damage to insulin signal transduction, including GLUT-4, leading to reduced insulin secretion and insulin resistance. Oxidative stress, in turn, can damage and cause pancreatic β cells to apoptosis. It can be seen that oxidative stress-induced impairment of pancreatic β cell function is an important cause of diabetes.

[0037] Liposomes are orderly arranged single-layer or multi-layer vesicles synthesized from phospholipids and cholesterol, which can be used to encapsulate water-soluble drugs or fat-soluble drugs. Compared with other nanomaterials, the composition of liposomes is similar to that of cell membranes, with high biocompatibility and low toxicity. Liposomes have a unique bilayer structure and can deliver water-soluble drugs and fat-soluble drugs at the same time, improving the stability of drugs in the body.

[0038] Aptamers are easy to synthesize, have high specificity, and are easy to modify. They can be synthesized using the graphene-assisted systematic evolution of ligands by exponential enrichment (SELEX) technology. Aptamers can be flexibly anchored to various nanocarriers through various conjugation methods. Modifying cholesterol on aptamers is beneficial to improving the stability of aptamers, facilitating the anchoring of aptamers to liposomes, and realizing the active targeting effect of liposomes.

[0039] The present application constructs a nano-delivery system with active targeting performance. The aptamer is connected to the liposome by a post-insertion method to obtain a liposome with targeting function.

[0040] In order to further illustrate the present application, the preparation method and application of the targeted liposomes provided by the present application are described in detail below in conjunction with the examples.

[0041] Example 1 Targeted Coenzyme Q10 Liposome (CoQ10-Lip-Apt)

[0042] S1. Weigh 60.0 mg hydrogenated lecithin, 15.22 mg cholesterol and 7.52 mg coenzyme Q10 (the molar ratio of hydrogenated lecithin to cholesterol is 2:1, and the mass ratio of drug lipid is 1:10), dissolve in chloroform, remove chloroform in a vacuum rotary evaporator to obtain a phospholipid film. The rotation speed for removing chloroform is 20 rpm / min, the temperature is 37°C, and the time is 20 min.

[0043] S2. Add 10 mL of PBS to the phospholipid film, and rotate and hydrate the film at 50°C, 120 rpm / min, at normal pressure for 20 min to completely hydrate the phospholipid film to obtain the initial liposome solution.

[0044] S3. Prepare a 100 μM aptamer solution, take 10 μL of the above 100 μM aptamer solution and add it to the initial liposome solution, protect from light and place it in an ice bath for probe ultrasonication to obtain a coenzyme Q10 liposome solution. The probe ultrasonication time is 15 minutes, and the ultrasonic power is 100 W (2 seconds on and 3 seconds off).

[0045] Example 2 Targeted Curcumin Liposome (Cur-Lip-Apt)

[0046] S1. Weigh 104.4 mg hydrogenated lecithin, 34.8 mg cholesterol and 4.64 mg curcumin (the molar ratio of hydrogenated lecithin to cholesterol is 1.5:1, and the mass ratio of drug-lipid is 1:30) and dissolve them in chloroform. Remove chloroform in a vacuum rotary evaporator to obtain a phospholipid film. The rotation speed for removing chloroform is 20 rpm / min, the temperature is 37°C, and the time is 20 min.

[0047] S2. Add 10 mL of physiological saline to the phospholipid film, and rotate and hydrate the film at 40°C, 120 rpm / min, at normal pressure for 20 min to completely hydrate the phospholipid film to obtain the initial liposome solution.

[0048] S3. Prepare a 100 μM aptamer solution, take 10 μL of the above 100 μM aptamer solution and add it to the initial liposome solution, protect from light, and perform probe ultrasound on ice to obtain a curcumin liposome solution. The probe ultrasound time is 15 minutes, and the ultrasound power is 100 W (supersonic for 2 seconds and stop for 3 seconds).

[0049] Example 3 Targeted Exenatide Liposome (Ext-4-Lip-Apt)

[0050] S1. Weigh 60.0 mg hydrogenated lecithin and 15.22 mg cholesterol (the molar ratio of hydrogenated lecithin to cholesterol is 2:1), dissolve them in chloroform, remove chloroform in a vacuum rotary evaporator, and obtain a phospholipid film. The rotation speed when removing chloroform is 20 rpm / min, the temperature is 37°C, and the time is 20 min.

[0051] S2. Prepare a PBS solution of 0.3 mg / ml exenatide, take 10 ml of the above exenatide solution, add it to the phospholipid film for hydration, rotate and hydrate for 20 minutes at 50°C and 120 rpm / min at normal pressure to completely hydrate the phospholipid film to obtain the initial liposome solution.

[0052] S3. Prepare a 100 μM aptamer solution, take 10 μL of the above 100 μM aptamer solution and add it to the initial liposome solution, protect from light and perform probe ultrasound in an ice bath to obtain a targeted exenatide liposome solution. The probe ultrasound time is 15 minutes, and the ultrasound power is 100 W (supersonic for 2 seconds and stop for 3 seconds).

[0053] Example 4 Targeted co-loading of exenatide and coenzyme Q10 liposomes ((E+Q)-Lip-Apt)

[0054] S1. Weigh 60.0 mg hydrogenated lecithin, 15.22 mg cholesterol and 7.52 mg coenzyme Q10 (the molar ratio of hydrogenated lecithin to cholesterol is 2:1, and the mass ratio of drug-lipid is 1:10), place in a 500 ml eggplant-shaped bottle, add 15 ml chloroform, and after complete dissolution in a water bath ultrasonic, remove the chloroform in a vacuum rotary evaporator to obtain a phospholipid film. The rotation speed when removing chloroform is 20 rpm / min, the temperature is 37°C, and the time is 20 min.

[0055] S2. Prepare a PBS solution containing 0.3 mg / ml exenatide, take 10 ml of the exenatide solution, add it to the phospholipid film to hydrate and obtain a liposome initial solution. The hydration temperature is 50°C, the rotation speed is 120 rpm / min, the time is 20 minutes, and the hydration is performed at normal pressure to obtain a liposome initial solution.

[0056] S3. Prepare a 100 μM aptamer solution, take 10 μL of the above 100 μM aptamer solution and add it to the initial liposome solution, put it in an ice bath and avoid light with a 100 W (supersonic for 2 seconds and stop for 3 seconds) probe ultrasound for 15 minutes, and finally obtain a liposome solution co-loaded with exenatide and coenzyme Q10.

[0057] Example 5 Targeted co-loading of semaglutide and coenzyme Q10 liposomes ((S+Q)-Lip-Apt)

[0058] S1. Weigh 60.0 mg hydrogenated lecithin, 15.22 mg cholesterol and 7.52 mg coenzyme Q10 (the molar ratio of hydrogenated lecithin to cholesterol is 2:1, and the mass ratio of drug-lipid is 1:10), place in a 500 ml eggplant-shaped bottle, add 15 ml chloroform, and after complete dissolution in a water bath ultrasonic, remove the chloroform in a vacuum rotary evaporator to obtain a phospholipid film. The rotation speed when removing chloroform is 20 rpm / min, the temperature is 37°C, and the time is 20 min.

[0059] S2. Prepare a PBS solution containing 0.3 mg / ml semaglutide, take 10 ml of the semaglutide solution, add it to the phospholipid film to hydrate and obtain a liposome initial solution. The hydration temperature is 50° C., the rotation speed is 120 rpm / min, the time is 20 min, and the hydration is performed at normal pressure to obtain a liposome initial solution.

[0060] S3. Prepare a 100 μM aptamer solution, take 10 μL of the above 100 μM aptamer solution and add it to the initial liposome solution, and perform ultrasound with a 100 W (supersonic for 2 seconds and stop for 3 seconds) probe for 15 minutes in an ice bath and away from light to finally obtain a liposome solution co-loaded with semaglutide and coenzyme Q10.

[0061] Experimental Example 1 Characterization of (E+Q)-Lip-Apt

[0062] Determination of particle size and distribution: The liposomes were diluted 10 times and the particle size and distribution, polydispersity index (PDI) and Zeta potential of the liposomes were determined using a particle size analyzer.

[0063] Determination of encapsulation efficiency:

[0064] Coenzyme Q10 encapsulation efficiency (EE%): Free coenzyme Q10 and drug-loaded liposomes were separated by low-speed centrifugation. The liposome supernatant was removed and methanol was added to break the emulsion. The drug concentration in the supernatant was measured and the drug mass in the supernatant, i.e., the encapsulated drug mass, was calculated. An equal amount of liposome solution was taken and methanol was added to break the emulsion. The total drug concentration was measured and the total drug mass was calculated. The coenzyme Q10 encapsulation efficiency was calculated according to the following formula:

[0065] Encapsulation rate (%) = encapsulated drug mass / total drug mass*100%

[0066] Exenatide encapsulation efficiency (EE%): Exenatide is a water-soluble macromolecular substance, which is difficult to separate by ordinary centrifugation methods and is suitable for separation by ultrafiltration centrifugation. The peptide is quantified by the BCA method. Use a 50kd ultrafiltration tube at 4°C and high-speed centrifugation to separate free peptides and liposomes. Collect the filtrate in the lower tube to determine the concentration and calculate the drug mass as m 游离 , take the uncentrifuged liposome solution, break the emulsion to determine the total polypeptide concentration and calculate its total drug mass as m 总 The encapsulation efficiency was calculated according to the following formula:

[0067] Exenatide encapsulation efficiency (%) = (1-m 游离 / m 总 )*100%

[0068] Aptamer modification rate (CE%): The fluorescent group FAM was modified at the end of the aptamer, and the free aptamer and the modified liposome were separated by low-temperature high-speed centrifugation using a 50kd ultrafiltration tube. The lower layer is the free aptamer solution, and the upper layer of the ultrafiltration tube solution was collected and its fluorescence intensity was measured, which is the fluorescence intensity of the modified liposome. An equal amount of liposome solution was taken to measure the total fluorescence intensity. The modification rate was calculated according to the following formula:

[0069] Aptamer modification rate (%) = fluorescence intensity of modified liposomes / total fluorescence intensity*100%

[0070] TEM analysis: Transmission electron microscopy (TEM) was used to examine the microscopic morphology of liposomes.

[0071] Table 1: Characterization results of (E+Q)-Lip-Apt

[0072]

[0073] like Figure 1 Shown is the particle size distribution diagram of (E+Q)-Lip-Apt in Example 4; Figure 2 This is the transmission electron microscopy image of (E+Q)-Lip-Apt in Example 4.

[0074] Experimental Example 2 In vivo study of (E+Q)-Lip-Apt

[0075] Animals: Male C57BL / 6 mice were purchased from Zhuhai Baishitong Biotechnology Co., Ltd.

[0076] In this experiment, a HFD / STZ type 2 diabetes animal model was constructed, with 8-10 mice in each group.

[0077] Normal control group (CON): normal mice;

[0078] Model group (DM): HFD / STZ type 2 diabetic mice;

[0079] Positive control group (DM+EXT-4): HFD / STZ type 2 diabetic mice, injected with exenatide daily for 8 weeks;

[0080] Experimental group (DM+(E+Q)-Lip-Apt): HFD / STZ type 2 diabetic mice were injected with dual-drug loaded liposomes (prepared by the steps of Example 4) daily for 8 weeks.

[0081] After administration, the mouse serum was collected, and the liver was fixed or homogenized to measure its biochemical indexes and perform in vitro imaging.

[0082] like Figure 3 As shown, it is the in vitro imaging of (E+Q)-Lip-Apt acting on diabetic mice in Example 4, Figure 4 This is the result diagram of the effect of (E+Q)-Lip-Apt on glycosylated hemoglobin in diabetic mice in Example 4. Figure 5 This is the result diagram of the effect of (E+Q)-Lip-Apt on the insulin resistance index of diabetic mice in Example 4. Figure 6 This is the result diagram of the effect of (E+Q)-Lip-Apt on the MDA content in the liver of diabetic mice in Example 4. Figure 7 This is a graph showing the effect of (E+Q)-Lip-Apt on SOD activity in the liver of diabetic mice in Example 4.

[0083] Experimental Example 3 Characterization of Cur-Lip-Apt

[0084] Determination of particle size and distribution: The liposomes were diluted 10 times and the particle size and distribution, polydispersity index and Zeta potential of the liposomes were determined using a particle size analyzer.

[0085] Determination of encapsulation efficiency:

[0086] Curcumin encapsulation efficiency (EE%): Free curcumin and drug-loaded liposomes were separated by low-speed centrifugation. The liposome supernatant was removed, methanol was added to break the emulsion, and the drug concentration in the supernatant was measured to calculate the mass of the encapsulated drug. An equal amount of liposome solution was taken, the emulsion was broken, the total drug concentration was measured to calculate the total drug mass, and the curcumin encapsulation efficiency was calculated according to the following formula:

[0087] Encapsulation rate (%) = encapsulated drug mass / total drug mass*100%

[0088] Aptamer modification rate (CE%): The fluorescent group FAM was modified at the end of the aptamer, and the free aptamer and the modified liposome were separated by low-temperature high-speed centrifugation in a 50kd ultrafiltration tube. The lower layer of the ultrafiltration tube solution was collected and its fluorescence intensity was measured, which was the fluorescence intensity of the free aptamer. An equal amount of liposome solution was taken to measure the total fluorescence intensity. The modification rate was calculated according to the following formula:

[0089] Aptamer modification rate (%) = (1-free aptamer fluorescence intensity / total fluorescence intensity) * 100%

[0090] TEM analysis: Transmission electron microscopy (TEM) was used to examine the microscopic morphology of liposomes.

[0091] Table 2: Characterization results of (Cur)-Lip-Apt

[0092]

[0093] like Figure 8 As shown in FIG. 2 , the particle size distribution diagram of Cur-Lip-Apt in Example 2 is shown; Fig. 9Shown is the transmission electron microscopy image of Cur-Lip-Apt in Example 2.

[0094] Experimental Example 4 In vivo study of Cur-Lip-Apt

[0095] Animals: Male C57BL / 6 mice were purchased from Zhuhai Baishitong Biotechnology Co., Ltd.

[0096] In this experiment, a HFD / STZ type 2 diabetes animal model was constructed, with 6-8 mice in each group.

[0097] Normal control group (CON): normal mice;

[0098] Model group (DM): HFD / STZ type 2 diabetic mice;

[0099] Curcumin control group (DM+Cur): HFD / STZ type 2 diabetic mice, injected with curcumin daily for 6 weeks;

[0100] Experimental group (DM+Cur-Lip-Apt): HFD / STZ type 2 diabetic mice were injected with Cur-Lip-Apt (prepared by the steps of Example 2) daily for 6 weeks.

[0101] After administration, the mouse serum was collected, and the liver, kidney, heart, and pancreas were fixed or homogenized to measure their biochemical indicators and perform in vitro imaging.

[0102] like Fig.10 As shown, it is the in vitro imaging of Cur-Lip-Apt acting on diabetic mice in Example 2, Fig.11 The figure is the effect of Cur-Lip-Apt on glycated hemoglobin in T2DM mice in Example 2. Fig.12 This is a graph showing the effect of Cur-Lip-Apt on liver TC in T2DM mice in Example 2.

[0103] Experimental Example 5 Characterization of (S+Q)-Lip-Apt

[0104] Determination of particle size and distribution: The liposomes were diluted 10 times and the particle size and distribution, polydispersity index and Zeta potential of the liposomes were determined using a particle size analyzer. Fig.13 Shown is the particle size distribution diagram of (S+Q)-Lip-Apt.

[0105] The above are only preferred embodiments of the present application, and are not intended to limit the patent scope of the present application. Any equivalent structure or equivalent process transformation made using the contents of the present application specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present application.

Claims

1. A pancreas-targeted liposome, characterized in that: The pancreas-targeted liposome is composed of hydrogenated lecithin, cholesterol, an aptamer (Apt), a fat-soluble drug and a neutral solution; the neutral solution includes at least one of PBS, water, physiological saline, a PBS solution of a polypeptide, an aqueous solution of a polypeptide and a physiological saline solution of a polypeptide; the polypeptide includes at least one of exenatide and semaglutide; the fat-soluble drug includes at least one of coenzyme Q10 and curcumin.

2. The pancreas-targeted liposome according to claim 1, characterized in that: The sequence of the aptamer is (5' to 3'): CGTGCAATGTCGAATGCATGAGCAAACATGGCGAT, the 5' end is modified with Cholesteryl, and the 3' end is modified with FAM.

3. The pancreas-targeted liposome according to claim 1, characterized in that: The molar ratio of the hydrogenated lecithin to the cholesterol is (1.5-4):1, the mass ratio of the fat-soluble drug to the lipid is 1:(10-30), and the lipid refers to hydrogenated lecithin and cholesterol.

4. The pancreas-targeted liposome according to claim 1, characterized in that: The mass ratio of the polypeptide to the fat-soluble drug is 2:5, the mass ratio of the fat-soluble drug to the lipid is 1:10 or 1:30, and the molar ratio of the hydrogenated lecithin to the cholesterol is (1.5-2):

1.

5. A method for preparing the pancreas-targeted liposome according to any one of claims 1 to 4, characterized in that: The following steps are involved: The hydrogenated lecithin, cholesterol and fat-soluble drugs are mixed, dissolved in an organic solvent, and evaporated to obtain a phospholipid film; A neutral solution is added to the phospholipid film for hydration treatment, and an aptamer solution is added and ultrasonic treatment is performed to obtain a liposome solution.

6. The method for preparing pancreas-targeted liposomes according to claim 5, characterized in that: The hydration treatment is performed at 37°C to 50°C; the ultrasonic treatment refers to the ultrasonic power being 100W, ultrasonicating for 2s and then stopping for 3s before continuing the ultrasonication, the total ultrasonication time is 10 minutes to 20 minutes, and the ultrasonication process is performed in an ice water bath.

7. The method for preparing pancreas-targeted liposomes according to claim 6, characterized in that: The temperature of the hydration treatment is 40° C. or 50° C., and the total ultrasonic treatment time is 15 minutes.

8. The method for preparing pancreas-targeted liposomes according to claim 5, characterized in that: The evaporation to dryness treatment refers to: removing the organic solvent by rotary evaporation at 37°C and 20 rpm / min, and the evaporation time is 20 minutes; The organic solvent refers to chloroform.

9. The method for preparing pancreas-targeted liposomes according to claim 5, characterized in that: The rotation speed of the hydration treatment is 120 rpm / min, normal pressure, 40° C. to 50° C., and hydration for 15 minutes to 20 minutes.

10. An application of pancreas-targeted liposomes, characterized in that: Used in the preparation of drugs targeting the pancreas.

Images