Poplar freeze-thaw injury repair related protein PzXPB1 and coding gene and application thereof

Abstract

The application discloses a poplar freeze-thaw injury repair related protein PzXPB1, a coding gene and application thereof. The protein is a protein as shown in 1) or 2) below: 1) a protein consisting of an amino acid residue sequence in SEQ ID sequence 2 in the sequence listing; 2) a protein derived from the amino acid residue sequence in 1) and having a freeze-thaw injury repair function through substitution and / or deletion and / or addition of one or more amino acid residues. Through a tobacco genetic transformation experiment and relative conductivity detection, it is proved that the protein can improve the cold resistance of tobacco.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biology, and relates to a poplar freeze-thaw injury repair related protein PzXPB1, a coding gene thereof and application. BACKGROUND

[0002] Temperature is the main limiting factor for the geographical distribution of plants, and the economic loss caused by low temperature to plants all over the world reaches tens of billions of yuan per year. Poplar (Populus spp.) is the general term of Populus L. tree species of Salicaceae, and is mainly distributed in southwest, northwest, northeast and north China. Poplar has small genome, fast growth, easy genetic transformation, and is the ideal material for studying the molecular mechanism of freeze-thaw resistance, and is called the model tree species of forest genetic engineering. The freeze-thaw injury of poplar is divided into reversible freeze-thaw injury and irreversible freeze-thaw injury, and the cumulative effect of effective freeze-thaw injury is the main reason for the overwintering death of poplar. The self-repairing ability of poplar after reversible freeze-thaw injury is the key to its survival in winter cold.

[0003] DNA repair is a response of cells to DNA damage, which can restore the structure of DNA to its original state, re-execute its original function, and enable the cell to continue to survive. If the cell does not have this repair function, it cannot cope with the frequent DNA damage events and cannot survive, so studying DNA repair is an important topic for exploring life. The research on DNA repair of poplar freeze-thaw injury has important significance for poplar cold resistance breeding. SUMMARY

[0004] Therefore, the purpose of the present application is to provide a poplar freeze-thaw injury repair related protein PzXPB1, a coding gene thereof and application.

[0005] The poplar freeze-thaw injury repair related protein provided by the present application is derived from poplar and is named PzXPB1, and has the following 1) or 2) biological characteristics of the protein:

[0006] 1) a protein consisting of the amino acid residue sequence of SEQ ID NO: 2 in the sequence listing;

[0007] 2) a protein derived from SEQ ID NO: 2 having freeze-thaw injury repair function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid residue sequence of 1).

[0008] SEQ ID NO: 2 in the sequence listing consists of 769 amino acid residues.

[0009] The coding gene PzXPB1 of the poplar freeze-thaw injury repair related protein also belongs to the protection scope of the present application.

[0010] The cDNA of the poplar freeze-thaw injury repair-related protein is a DNA molecule having the following 1) or 2) or 3) biological characteristics:

[0011] 1) the nucleotide sequence of SEQ ID 1 in the sequence listing;

[0012] 2) a nucleotide sequence that can hybridize to the DNA sequence of 1) or 2) under stringent conditions;

[0013] 3) a nucleotide sequence having more than 90% homology to the nucleotide sequence of 1) or 2) and encoding a protein having a freeze-thaw injury repair function.

[0014] The full length of sequence 1 in the sequence listing is 2307 nucleotides, encoding a protein of 769 amino acids in length (sequence 2 in the sequence listing).

[0015] The recombinant expression vector, expression cassette or recombinant bacteria containing the coding gene all belong to the protection scope of the present application.

[0016] The recombinant expression vector is a recombinant vector for expressing the elicitor protein, obtained by inserting the nucleotide fragment of sequence 1 in the sequence listing into a starting vector. Preferably, the transgenic recombinant bacteria are transgenic recombinant bacteria for expressing the elicitor protein, obtained by transforming the recombinant expression vector into Agrobacterium.

[0017] The protein and its coding gene for use in improving the cold resistance of plants, preferably tobacco, also belong to the protection scope of the present application.

[0018] The present application is the first to discover that the DNA repair pathway gene PzXPB1 has the function of improving the cold tolerance of tobacco, opening up a path for the research of DNA repair genes in improving the stress resistance of plants. The present application helps to clarify the molecular mechanism of safe wintering of poplar and lays a foundation for molecular breeding of poplar cold resistance. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Figure 1 is a map of the pBWA(V)HS-ccdb-Glosgfp expression vector

[0020] Figure 2 Figure 3 is the phenotype of tobacco after 2h of cold stress at 3℃. Figure 2 In the figure, No. 6 and No. 3 are transgenic tobacco, and CK is wild-type tobacco control.

[0021] Figure 3 Figure 5 is the detection electrophoretogram of positive transgenic PzXPB1 tobacco, note: the first marker from the left is a positive control, the second marker from the right is a negative control, and the third marker from the right is a water control.

[0022] Figure 4Figure 1 shows the tissue culture diagram of transgenic PzXPB1 tobacco.

[0023] Figure 5 Figure 2 shows the initial growth of transgenic tobacco and control group after transplanting seedlings. CK is wild-type tobacco, which is a control; No. 1, 3, 4 and 6 are transgenic PzXPB1 tobacco. DETAILED DESCRIPTION

[0024] The following examples facilitate a better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent stores unless otherwise specified. In the quantitative tests in the following examples, three repeated experiments were set, and the average value was taken as the result.

[0025] Example 1, Obtaining of Key Gene PzXPB1 for Repairing Freezing and Thawing Injury of Poplar

[0026] I. Cloning of Key Gene PzXPB1 for Repairing Freezing and Thawing Injury of Poplar

[0027] In early November, the one-year-old branches of Zhongliao 1 poplar (P. × canadensis ‘Zhongliao 1’) were collected, and subjected to 24 h of-40℃ environmental stress, and then placed in a 20℃ environment for 30 min. The phloem on the branches was collected to extract RNA, and RNA-seq transcriptome sequencing (Accession number in NCBI SRA: PRJNA891633) was performed, and bioinformatics analysis was performed on the sequencing results. Through transcriptome analysis of Zhongliao 1 poplar under freezing and thawing stress, a gene related to freezing and thawing injury repair function was found and identified, and named PzXPB1.

[0028] The leaves of Zhongliao 1 poplar tissue culture seedlings were used as materials to extract RNA and reverse transcribe into cDNA;

[0029] (1) Synthesis of amplification primers of target gene PzXPB1

[0030] F1: ggagagaacacgggggactttgcaacATGGGACACGGTGATAAAAG

[0031] R1: ccactccctgaagcggccgctgtacaGCCAAAGCGCCTTTTGAAC

[0032] (2) PCR amplification system and procedure

[0033] The cDNA obtained by reverse transcription was used as a template, and the primers F1 and R1 described above were used for PCR amplification:

[0034] A 50 uL system was prepared and amplification was performed according to the following procedure, the system is shown in Table 1 and the procedure is shown in Table 2:

[0035] Table 1 PCR system

[0036]

[0037]

[0038] Table 2 PCR procedure

[0039]

[0040] The electrophoresis fragments of PzXPB1 were cut out under the ultraviolet lamp and placed in a system for gel recovery. The PCR product was dissolved in a total volume of 40 uL of water for recovery, and after detection, the vector pBWA(V)HS-ccdb-Glosgfp (vector map is shown in Figure 1) was subjected to vector digestion and recombination reaction. 5-10 uL of the ligation product was transformed into E. coli competent cells, and the Kan-resistant plates were cultured at 37℃ for 12 hours, and then subjected to colony PCR identification and sequencing. Figure 1 ) were subjected to vector digestion and recombination reaction. 5-10 uL of the ligation product was transformed into E. coli competent cells, and the Kan-resistant plates were cultured at 37℃ for 12 hours, and then subjected to colony PCR identification and sequencing.

[0041] The sequencing results show that a 2307 bp gene is obtained, the sequence is shown as sequence 1 in the sequence table, and the amino acid residue sequence (PzXPB1) encoded by sequence 2 in the sequence table is named PzXPB1.

[0042] Example 2, function verification of the poplar freeze-thaw injury repair key gene PzXPB1 of the application

[0043] 1. Construction of overexpression vector pBWA(V)HS-PzXPB1-Glosgfp

[0044] The starting vector is pBWA(V)HS (purchased from BioVector plasmid vector strain cell protein antibody gene preservation center).

[0045] The construction method of the overexpression vector is as follows:

[0046] The PzXPB1 gene (the gene shown in SEQ ID sequence 1, obtained according to the method of Example 1) and the linker fragment (SEQ ID sequence 3) osGFP fragment (SEQ ID sequence 4) connected in sequence were inserted between the 35s promoter and the NOS terminator of pBWA(V)HS, and then transformed into E. coli competent cells, and subjected to PCR and sequencing verification. The correct recombination expression vector was named pBWA(V)HS-PzXPB1-Glosgfp, and the PzXPB1 in the vector was expressed by the 35S promoter.

[0047] 2. Preparation of transgenic Agrobacterium

[0048] Take 1 μL of plasmid pBWA(V)HS-PzXPB1-Glosgfp and add it to 50 μL of GV3101 Agrobacterium competent cells. Mix well, then transfer to an electroporation cup. After electroporation, add 1 mL of LB liquid medium, mix well, then transfer to a 1.5 mL centrifuge tube. Incubate at 30°C, 180 rpm for 30 min. Take 50 μL of the activated Agrobacterium liquid and inoculate it on LB solid medium. Incubate at 30°C in the dark for 48 h. The obtained positive strain is verified by PCR (F1576-35S-452R: ggcaacttggtcttcgacaa, 35s-seq: ttcatttggagagaacacgggggac) and named as trans-pBWA(V)HS-PzXPB1-Glosgfp Agrobacterium.

[0049] 3. Obtaining of transgenic PzXPB1 tobacco

[0050] 3.1 Pre-culture

[0051] Disinfect tobacco seeds with 75% alcohol for 30 s, wash with sterile water for 1 min, then disinfect with 84 disinfectant for 3-5 min, and wash with sterile water for 3 times, 1 min each time. Sow the disinfected tobacco seeds on the germination medium, and incubate at 23°C with 16 h light / 8 h dark for 4-5 weeks. Cut the sterile tobacco leaves into small pieces with a scalpel and inoculate them on the pre-culture medium.

[0052] 3.2 Agrobacterium infection and co-culture

[0053] Prepare an OD 600 = 0.2 trans-pBWA(V)HS-PzXPB1-Glosgfp Agrobacterium resuspension liquid, inoculate the pre-cultured tobacco leaves in the Agrobacterium suspension for 10-15 min, inoculate the infected tobacco leaves on filter paper, dry, and then inoculate on the co-culture medium and incubate in the dark for 48-72 h.

[0054] 3.3 Induction Transfer the co-cultured leaves for 2 d to the induction medium to induce callus, about 10 d, and wait for the callus to grow.

[0055] 3.4 Screening Select callus that meets the standard and inoculate it on the corresponding resistant screening medium, incubate for 15-30 d, and incubate at 23±2°C.

[0056] 3.5 Differentiation and rooting The vigorous positive callus was inoculated on differentiation medium, 4-5 calli per dish, 23°C, 16h / 8h light / dark, for 15-30d. During the differentiation, if the callus had seedlings, the callus was inoculated on the seedling medium for 7-10d.

[0057] 3.6 Detection The tobacco genomic DNA was extracted by CTAB method, and PCR detection was performed (F1576-35S-452R: ggcaacttggtcttcgacaa; 35s-seq: ttcatttggagagaacacgggggac), and the detection results are shown in Figure 3 , indicating that the positive transgenic PzXPB1 tobacco was obtained. Figure 4 ).

[0058] 4 、 Cold resistance index test of positive transgenic PzXPB1 tobacco

[0059] 4.1 Test method

[0060] The transgenic PzXPB1 tobacco was subjected to cold stress treatment, and the wild type tobacco was set as control (CK). The treatment method was as follows: the rooting tobacco tissue culture seedlings after 24h ventilation were placed in a 3°C plant growth box for 2h cold stress, and then the relative conductivity was tested, and the method was as follows:

[0061] The tobacco leaves with the same size were washed with tap water and then washed with deionized water for 3 times. The surface water of the leaves was absorbed by filter paper. Fresh samples of the leaves of each line were quickly weighed in triplicate (three repeats), and each sample was 0.2g. The samples were cut and placed in conical bottles containing 20ml deionized water, the bottle mouth was sealed, and the samples were placed in a shaking bed at room temperature for 12h (150r / min). The conductivity of the extraction solution (R1) and the conductivity of deionized water (R0) were measured by using DDS-IIC digital conductivity meter. Then the samples were placed in a water bath, and the conductivity of the extraction solution (R2) was measured after being heated in boiling water for 30-40min and cooled to room temperature.

[0062] Relative conductivity = (R1-R0) / (R2-R0) x 100%

[0063] 4.2 Test results of the relative conductivity of the transgenic tobacco

[0064] The relative conductivity of the tobacco with PzXPB1 gene was generally lower than that of the control (CK). The relative conductivity of No. 3 with the smallest seedling height was significantly lower than that of the control (CK) after cold stress, and the average relative conductivity was 9.77% lower than that of the control. The variance analysis result showed that the difference was significant at the 0.05 level (Table 3). The higher the relative conductivity, the more serious the cell damage. The experimental results showed that the transgenic tobacco with PzXPB1 gene had certain cold resistance.

[0065] Table 3 Analysis of variance of relative conductivity of tobacco after cold stress treatment

[0066] Tobacco No. Average Relative Conductivity (%) Arcsine Transformation Transformation to Angle CK (Control) 34.28 0.3499a 20.05a No. 1 33.07 0.3370ab 19.31ab No. 3 30.93 0.3145b 18.02b No. 4 32.86 0.3348ab 19.18ab No. 6 33.71 0.3438a 19.70a

[0067] Note: Different letters in column direction indicate significant difference at 0.05 level. CK is wild type tobacco, as control; No. 1-6 is transgenic PzXPB1 tobacco.

[0068] The leaves of transgenic tobacco and wild type tobacco (CK) after cold stress treatment wilted to different degrees, and the wild type wilted more severely (see Fig. 1). After removing the stress and growing in room temperature environment, most of the transgenic tobacco can recover to normal state (success rate of recovery 75%) ; some wild type tobacco leaves have yellowing trend, and the proportion of successful recovery to normal state is less than 50%. Figure 2

[0069] The height of tobacco seedlings (same as the tobacco line number after cold stress treatment, without cold stress) transplanted for 3 days was measured by ruler. The height growth of tobacco is shown in Table 4.

[0070] Table 4 Height of tobacco transplanted seedlings

[0071] Name CK No. 1 No. 3 No. 4 No. 6 Seedling Height / cm 7.1 5.8 2.3 5.6 5.2

[0072] The height growth of tobacco with PzXPB1 gene is generally less than that of wild type control. See Table 4 and Fig. 2. Figure 5 .

[0073] The new gene PzXPB1 cloned from Populus x euramericana cv. Liaonol, through tobacco genetic transformation experiment and relative conductivity detection, proves that it can improve the cold resistance of tobacco.​

Claims

1. Use of the protein as shown in sequence 2 of the sequence listing or of a gene encoding it for increasing the cold tolerance of a plant; the plant being tobacco.

2. Use according to claim 1, characterized in that, the encoding gene being the nucleotide as shown in sequence 1 of the sequence listing.

Images