Tobacco ntiral gene and its use

Abstract

The present application relates to the field of biotechnology, and more particularly to a tobacco NtTIRa1 gene and application thereof. The present application proves for the first time that the NtTIRa1 gene has the function of regulating the resistance to quinclorac, and the test result shows that the mutant with the function loss of the NtTIRa1 gene has the increased resistance to quinclorac, thereby eliminating or reducing the loss caused by the drug damage to the tobacco production, and providing a new idea for improving the quinclorac resistance of tobacco and a new means for obtaining a fine tobacco variety.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a tobacco NtTIRa1 gene and an application thereof. Background Art

[0002] Tobacco is an important cash crop, with tobacco leaves being the primary harvested organ. Leaf yield determines its economic benefits. Therefore, reducing or eliminating yield losses caused by various biotic and abiotic stresses is an effective way to increase tobacco farmers' income and enrich them. Furthermore, tobacco leaves are the essential raw material for the leaf-rolling industry, and their quality determines their industrial viability.

[0003] Quinclorac, primarily used to control barnyardgrass in rice fields, is the primary herbicide used in both pre- and post-emergence rice paddies in my country, with annual application covering approximately 25% of rice-growing areas. Quinclorac damage to tobacco typically occurs from the clumping to vigorous growth stages. Symptoms include narrowing and thickening of leaves, with leaf margins curling toward the underside. In severe cases, the leaves become thread-like, resulting in a significant drop in tobacco yield or even total failure. Regarding tobacco quality, affected leaves experience increased nicotine content, decreased reducing sugar content, and an imbalance in their chemical composition, severely degrading their quality and impacting their industrial viability and safety. Consequently, quinclorac damage to tobacco results in significant yield and quality losses, impacting not only farmers' income but also the sustainable development of the tobacco industry. Quinclorac damage to tobacco stems from the application of quinclorac to the previous rice crop, which leaves residue in the soil and causes damage to subsequent tobacco crops.

[0004] Improving tobacco's resistance to quinclorac through genetic engineering is an effective method. Therefore, exploring tobacco resistance genes is of great significance in the field of providing tobacco breeding that is resistant to quinclorac. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide tobacco NtTIRa1 gene and application thereof.

[0006] The present invention provides the use of tobacco TIRa1 as a target in plant breeding and / or in preparing products that assist plant breeding;

[0007] The amino acid sequence of the tobacco TIRa1 is shown in SEQ ID NO: 2.

[0008] Further,

[0009] The plant breeding includes regulating the resistance of plants to quinclorac.

[0010] The regulation includes increasing or decreasing.

[0011] The plants include tobacco.

[0012] The present invention provides a plant breeding or assisted breeding product, which includes at least one of the following A) to C:

[0013] A), amplification primers, detection primers and / or targeting primers using a nucleic acid encoding tobacco TIRa1 as a template;

[0014] B) Interference fragment targeting tobacco TIRa1;

[0015] C), gRNA targeting tobacco TIRa1;

[0016] D) an expression cassette containing the interference fragment as described in B) or the gRNA as described in C);

[0017] E) a recombinant vector containing the interfering fragment as described in B), or the gRNA as described in C), or the interfering fragment as described in D);

[0018] F), transforming or transfecting the host cell with the recombinant vector described in E);

[0019] G) Cultivating the mixture obtained by culturing the host cells described in F).

[0020] In the product of the present invention,

[0021] The nucleotide sequence of the nucleic acid encoding tobacco TIRa1 is shown in SEQ ID NO: 1.

[0022] In the present invention, the nucleic acid may be DNA, RNA, cDNA or PNA. In an embodiment of the present invention, the nucleic acid is in the form of RNA or DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. Nucleic acid may include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). Nucleic acid may be linear or circular in topology. Nucleic acid may be obtained directly from natural sources, or may be prepared with the assistance of recombination, enzymatic methods or chemical techniques.

[0023] The present invention provides a gRNA fragment, which is a fragment targeting a target gene and located about 20 bp before the recognition site (PAM site) of the CRISPR / endonuclease system (such as CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas12b, CRISPR / Cas13a and CRISPR / Cas14a) editing system; the recognition site of the CRISPR / endonuclease system editing system is different according to the different endonucleases. Generally, the recognition site includes NGG (C as9) and / or TTN (Cpf1), etc.; in a specific embodiment of the present invention, the CRISPR / Cas9 system is used, and its recognition site is NGG, wherein N represents any one of A, T, C or G bases, and the position of the NGG can be at any position of the 5' end, the middle or the 3' end of the nucleic acid encoding tobacco NtTIRa1, and the present invention is not limited thereto; in the present invention, tobacco NtTIRa1 is used as the target, and gene editing is performed using the CRISPR / Cas9 system. Specifically, the nucleotide sequence of the target segment of the gRNA fragment is shown in SEQ ID NO: 5;

[0024] Furthermore, in the present invention, a tobacco NtTIRa1 variant was obtained after gene editing by the CRISPR / Cas9 system, in which the base A at 16bp of the sequence shown in SEQ ID NO:1 was deleted, resulting in a frameshift mutation, leading to the loss and / or reduction of NtTIRa1 function.

[0025] The present invention provides a recombinant vector comprising at least one of the interfering fragment, gRNA and / or expression cassette described in the present invention and a vector backbone.

[0026] Furthermore, the vector backbone of the present invention may be derived from plants, animals, bacteria, fungi, bacteriophages, or viruses, but the present invention is not limited thereto. The viral vectors include tobacco mosaic virus, adenovirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, or lentiviral vectors.

[0027] In a specific embodiment of the present invention, the recombinant vector is derived from bacteria and / or plants, and the vector derived from bacteria is used for cloning, expressing, preserving or performing a certain function of the NtTIRa1 gene. In a specific embodiment of the present invention, the vector specifically includes a cloning vector and / or a CRISPR / Cas9 vector.

[0028] The transformation methods include chemical transformation and electroporation; the transfection methods include calcium phosphate co-precipitation, artificial liposome method, and viral transfection. The viral transfection methods include adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, Agrobacterium-mediated transfection, etc.

[0029] The present invention provides a kit comprising the product of the present invention and auxiliary materials.

[0030] Furthermore, the auxiliary materials include: at least one of a DNA extraction reagent, a DNA reverse transcription reagent, a culture medium, an antibiotic and / or a buffer.

[0031] The present invention provides application of the product or the kit in plant breeding or assisted plant breeding.

[0032] The present invention provides a method for plant breeding or assisted plant breeding, which comprises using the product of the present invention or the kit of the present invention to carry out plant breeding.

[0033] The present invention proves for the first time that the NtTIRa1 gene has the function of regulating dichloroquine resistance. The experimental results show that the mutant strain with NtTIRa1 gene function loss has increased dichloroquine resistance, thereby eliminating or reducing the losses caused by pesticide damage to tobacco production. It provides a new idea for improving the dichloroquine resistance of tobacco and a new means for obtaining excellent tobacco varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Shows the electrophoresis pattern of the CDS amplified products of NtTIRa1 gene;

[0035] Figure 2 Shown is the PCR detection diagram of CRISPR / Cas9 recombinant plasmid colony;

[0036] Figure 3 Figure 2 shows the target site mutation type;

[0037] Figure 4 Shows the sequencing peak diagram of the mutation site;

[0038] Figure 5 Shown is the leaf width analysis of the mutants. DETAILED DESCRIPTION

[0039] The present invention provides tobacco NtTIRa1 genes and their applications. Those skilled in the art can refer to the contents herein and appropriately improve the process parameters for implementation. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0040]

[0041] Amino acid sequence of the protein encoded by the tobacco NtTIRa1 gene: (SEQ ID NO: 2);

[0042] Tobacco varieties: K326, a common cultivated tobacco variety, were used. Seeds were provided by the National Tobacco Gene Research Center. Cultures were performed in the tobacco growing room at the National Tobacco Gene Research Center under the following conditions: temperature (27 ± 1)°C, relative humidity (60 ± 5)%, and a 16 h / 8 h light / dark cycle.

[0043] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0044] Example 1 Acquisition of the Tobacco Auxin Receptor NtTIRa1 Gene

[0045] (1) PCR amplification primer design

[0046] Based on the existing tobacco genome sequence, primers for amplifying the CDS region of the NtTIRa1 gene were designed. The sequences are as follows:

[0047] Upstream primer 21033f: 5′-ccattactttattgggatgcag-3′ (SEQ ID NO: 3);

[0048] Downstream primer 21033r: 5′-ctttcgatcacaaggagacag-3′ (SEQ ID NO: 4);

[0049] (2) Preparation of PCR amplification template

[0050] Total RNA was extracted from K326 tobacco leaves using the SuperPure Plant polyRNA Kit. The extracted total RNA was reverse transcribed into cDNA using the II Reverse Transcriptase Kit, and the cDNA was used as a template for PCR amplification.

[0051] (3) PCR amplification

[0052] Referring to the instructions of 2×TransTaq High Fidelity (HiFi) PCR SuperMix, the cDNA prepared in step (2) was used as a template, and PCR amplification was performed using the primers designed in step (1). The reaction system was added according to the instructions, and the PCR reaction was performed. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 100 s, for 30 cycles; and extension at 72°C for 5 min.

[0053] The PCR amplification products were detected by 1% agarose gel electrophoresis. Figure 1 As shown, there is a clear and single target band at about 1800 bp.

[0054] The target fragment was recovered from gel and sent for sequencing. The sequencing result is shown as SEQ ID NO: 1.

[0055] Example 2 Construction of gene editing vector

[0056] In order to obtain tobacco plants with quinclorac resistance, CRISPR / Cas9 technology was used to construct a gene editing vector and perform gene transformation to obtain tobacco plants with NtTIRa1 gene knockout.

[0057] This example provides a brief introduction to the construction of relevant gene editing vectors as follows:

[0058] (1) Editing target primer design

[0059] For the target site region of the NtTIRa1 gene (specific sequence of the target site: atcccagcttgaaaaaaccg, SEQ ID NO: 5), the editing primer sequences were designed as follows:

[0060] TIRa1-f: 5'-gattgatcccagcttgaaaaaaccg-3' (SEQ ID NO: 6);

[0061] TIRa1-r: 5'-aaaccggttttttcaagctgggatc-3' (SEQ ID NO: 7);

[0062] (2) Primer annealing and vector ligation

[0063] Refer to the Annealing Buffer for DNA Oligos (5×) kit instructions to obtain double-stranded DNA at the target site by primer annealing. The annealing reaction system is as follows: Annealing Buffer for DNA Oligos (5×), 4 μL; upstream and downstream primers (TIRa1-f, TIRa1-r), 4 μL each (50 μmol / μL); Nuclease-free water is added to make up to 20 μL. The reaction program is: 95°C for 5 min, decreasing the temperature by 0.1°C every 8 s to 25°C.

[0064] The above annealing product (double-stranded DNA of the target site) was ligated with the CRISPR / Cas9 vector after BsaⅠ digestion, and the CRISPR / Cas9 expression vector for knocking out the NtTIRa1 gene was screened. The 20 μL ligation system was designed as follows: annealing product, 6 μL; digestion product (CRISPR / Cas9 vector after BsaⅠ digestion), 3 μL; 10×T4 DNA Ligase Buffer, 2 μL; T4 DNA Ligase, 1 μL; sterile water was added to 20 μL, and ligation was carried out at 37°C for 3 h.

[0065] The above ligation products were transformed into DH5α E. coli competent cells for replication, and then screened and identified by colony PCR. During identification, primers U26-jiance-F (5'-ttaggtttacccgccaata-3', SEQ ID NO: 8) and TIRa1-r were used to detect positive clones. The electrophoresis results were as follows: Figure 2 As shown, lanes 1 and 4 have specific target bands at around 500 bp, which are positive clones. The editing plasmids of the positive clones were extracted.

[0066] Example 3 Obtaining a transgenic strain with NtTIRa1 gene knockout

[0067] The edited plasmid extracted in Example 2 was transformed into Agrobacterium, and then into tobacco plants to construct transgenic plants with NtTIRa1 gene knockout. The specific experimental process is as follows.

[0068] (1) Transformation of Agrobacterium

[0069] Thaw competent Agrobacterium GV3101 cells on ice, add 6 μL of the editing vector prepared in Example 2, and gently mix. Place the mixture in a pre-chilled electroporation cuvette and place on ice for 5 minutes. Blot any water droplets from the outer wall of the cuvette with absorbent paper, then place the cuvette in an electroporation tank for electroporation transformation. The electroporation conditions are: voltage 2.5 kV, capacitance 25 μF, and resistance 200 Ω. After electroporation, quickly add 800 μL of YEB liquid medium preheated to 28°C and shake at 220 rpm for 3 hours at 28°C. Spread the bacterial suspension evenly on YEB solid medium containing rifampicin (100 μg / mL), streptomycin (50 μg / mL), and kanamycin (50 μg / mL) and incubate at 28°C until single colonies form. Pick a single colony, expand it, and then perform PCR analysis on the bacterial suspension using primers U26-jiance-F and TIRa1-r. The correct strain is identified as the positive engineered bacteria.

[0070] (2) Transformation of tobacco plants

[0071] The positive engineered bacteria prepared above were cultured to OD 600 = 0.6, centrifuge at 4000rpm for 5min to collect the cells, and then suspend the cells in 20mL of MS liquid medium. Take the leaves of K326 sterile seedlings that have grown for about one month and cut them into 0.5-1cm 2 A square leaf disc was placed in the bacterial solution and inoculated for 10 minutes. Excess bacterial solution around the inoculated leaf disc was blotted with sterile filter paper and incubated in the dark for 3 days on a solid medium containing MS, 2 mg / L 6-BA, and 0.5 mg / L NAA. The MS solid medium formula is: 4.4 g / L MS inorganic salts, 30 g / L sucrose, 2.5 g / L phytogel, pH 5.8-5.9.

[0072] The leaf disc was washed with sterile water containing Cef (400 mg / L), and the excess liquid was absorbed with sterile filter paper. The leaf disc was transferred to MS solid screening medium containing 6-BA (2 mg / L), NAA (0.5 mg / L), Cef (200 mg / L) and Kan (50 mg / L) and cultured at 28°C under light.

[0073] When the adventitious buds grew to 0.5 cm, they were transferred to MS solid medium containing Cef (200 mg / L) and Kan (50 mg / L) for rooting.

[0074] After about a month of growth, transplant the plants into soil. A small number of leaves were collected for genomic DNA extraction and PCR detection of positive transgenic strains using primers U26-jiance-F and TIRa1-r.

[0075] Based on the genome sequence, detection primers spanning the NtTIRa1 gene target site were designed to detect the mutation type of the target site. The specific primers are:

[0076] CK-2950-F: 5'-agtttccttgaggagagtaaac-3' (SEQ ID NO: 9);

[0077] CK-2950-R: 5'-ctgcattgtaccaatcctta-3' (SEQ ID NO: 10);

[0078] The PCR amplification product was sent for sequencing, and the mutation type was determined based on the sequencing results. Figure 3 As shown, in the T0 generation plant AP-31-22-15-5, a nucleotide base deletion mutation was detected at the target site of the NtTIRa1 gene, deleting one base A (specifically, the base A at 16bp of the sequence shown in SEQ ID NO: 1 was deleted), causing a frameshift mutation in the NtTIRa1 protein, thereby inactivating the NtTIRa1 protein. No mutation was detected at the target site of the NtTIRa1 gene in the wild-type plant. The sequencing peak diagram is shown in FIG. Figure 4 As shown, the peak shape of the site where the base deletion occurred is single, indicating that the mutation site is homozygous, proving that AP-31-22-15-5 is a homozygous mutant strain.

[0079] Example 4 Quinclorac resistance assay

[0080] In order to clarify the resistance level of NtTIRa1 gene knockout mutant to quinclorac, the resistance of wild type K326 and NtTIRa1 gene mutant plant AP-31-22-15-5 to quinclorac was determined using leaf width as an indicator.

[0081] A potted plant experiment was performed, in which quinclorac was added for treatment to determine the resistance of the mutants in Example 3 to quinclorac. Specifically, mutant AP-31-22-15-5 and wild type K326 were used as materials. At the 5-leaf stage, each tobacco plant was irrigated with 20 mL of quinclorac solution, with a final concentration of 0.2 mg / kg of quinclorac. Leaf width was measured after 30 days of treatment. The upper 3 leaves were measured, with untreated K326 (irrigated with equal volumes of clear water) as the control. Data statistics were performed, and the results are shown in FIG. Figure 5As shown. Under the phytotoxicity of quinclorac, the widths of the three upper leaves of AP-31-22-15-5 increased by 69.7%, 71.3%, and 69.3% respectively compared with the control K326. Quinclorac had no significant inhibitory effect on the leaf width of AP-31-22-15-5, and AP-31-22-15-5 showed good resistance ( Figure 5 The control is K326; K326Q is K326 treated with quinclorac; AP-31-22-15-5 is AP-31-22-15-5 not treated with quinclorac; AP-31-22-15-5Q is AP-31-22-15-5 treated with quinclorac, of which 71.0% and 0.2% represent the first leaves of K326 and AP-31-22-15-5, respectively. The decrease in leaf width before and after quinclorac treatment; 79.50% and 12.0% represent the decrease in leaf width of the second leaf K326 and AP-31-22-15-5 before and after quinclorac treatment, respectively; 81.6% and 12.1% represent the decrease in leaf width of the third leaf K326 and AP-31-22-15-5 before and after quinclorac treatment, respectively).

[0082] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of tobacco TIRa1 as a target to improve tobacco resistance to quinclorac; The amino acid sequence of the tobacco TIRa1 is shown in SEQ ID NO: 2; The improvement of tobacco's resistance to quinclorac is achieved by knocking out gRNA, and the nucleotide sequence of the gRNA is shown in SEQ ID NO: 5.

Images