D-psicose 3-epimerase mutant and application thereof

Abstract

According to the D-psicose 3-epimerase mutant and the application thereof, the D-psicose 3-epimerase mutant is obtained through protein C-terminal sequence modification, software analysis and sequence alignment of different sources of D-psicose 3-epimerase, the half-life period of the mutant enzyme at 60 DEG C, 70 DEG C and 80 DEG C is prolonged, and the activity of the mutant enzyme is improved. The substrate affinity and conversion efficiency of the enzyme to D-fructose as a substrate for synthesizing D-psicose are improved, and the Tm value of the mutant is 73.23 DEG C and is improved by 11.98 DEG C compared with that of a wild type; the half-life period at the temperature of 60 DEG C is 255.35 min and is 17.60 times that of a wild type, the problem that the half-life period of the wild type is too short at the high temperature is solved, the relative action time of the mutant enzyme is long, the yield of the product D-psicose is remarkably increased by applying the genetically engineered bacterium containing the modified enzyme for biotransformation, the product yield is increased by 4.3%, the equilibrium conversion rate reaches 33%, and the yield of the product is greatly increased. And a green, environment-friendly, sanitary and safe biological preparation method is provided for the preparation process of the D-psicose.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering, and in particular relates to a D-psicose 3-epimerase mutant and application thereof. Background Art

[0002] D-psicose is a ketohexose, which is the C-3 diastereomer of D-fructose in terms of structural formula. D-psicose is a functional rare sugar with high sweetness but extremely low energy value, and only 10% of the calories of sucrose. It is an ideal natural sweetener and sucrose substitute. It has been listed as a "generally recognized as safe" food by the U.S. Food and Drug Administration and is allowed to be added as an additive to candy, juice, soy sauce and other dietary products.

[0003] The production methods of D-psicose mainly include extraction, chemical synthesis and biotransformation. Among them, the extraction method has low yield and high cost; the chemical synthesis method has complex reaction conditions, expensive raw materials and safety risks; and the biotransformation method has become the main method for industrial production of D-psicose due to its advantages of strong specificity, safety and environmental protection. It uses D-fructose as a substrate and ketose 3-epimerase as a catalyst to isomerize at the C-3 position to generate D-psicose in one step. Ketose 3-epimerase can be divided into three types: D-psicose 3-epimerase (DAEase), D-tagatose 3-epimerase (DTEase) and L-ribulose 3-epimerase (LREase). Among them, DAEase is the most widely studied and most widely used. In industrial production, there are many requirements for the performance of enzymes, and the stability, catalytic activity, substrate specificity and acid resistance of the enzymes are the main limiting factors. Under high temperature conditions, the enzyme reaction speed becomes faster and the substrate solubility increases, but too high a temperature will cause the enzyme to denature and inactivate. However, the stability and catalytic activity of DAEase still cannot meet the requirements of industrial production. Therefore, improving the thermal stability and catalytic activity of DAEase has become a top priority. Summary of the invention

[0004] To solve the above problems, the present invention provides a D-psicose 3-epimerase mutant, which has high thermal stability and can be used as a catalyst for preparing D-psicose.

[0005] The technical solution of the present invention to solve the above problems is as follows: A D-psicose 3-epimerase mutant, wherein the D-psicose 3-epimerase mutant has only a single point mutation or a combination of mutations in the 155th phenylalanine, the 281st aspartic acid, and the 289th cysteine ​​mutations relative to the amino acid sequence SEQ ID NO.1 of the wild-type D-psicose 3-epimerase.

[0006] Wild-type D-psicose 3-epimerase is derived from Clostridium cellulolyticum H10, the coding gene sequence is SEQ ID NO.2.

[0007] Preferably, the D-psicose 3-epimerase mutant is a single point mutation or a combination of mutations, wherein the 155th phenylalanine is mutated to tyrosine (F155Y), the 281st aspartic acid is mutated to glycine (D281G), and the 289th cysteine ​​is mutated to arginine (C289R), relative to the amino acid sequence SEQ ID NO.1 of the wild-type D-psicose 3-epimerase.

[0008] Single point mutation: The amino acid sequence of the mutant CcDAE-D281G obtained by mutation of aspartic acid at position 281 to glycine is SEQ ID NO.3; The amino acid sequence of the mutant CcDAE-C289R obtained by mutating cysteine ​​at position 289 to arginine is SEQ ID NO.5; The amino acid sequence of the mutant CcDAE-F155Y obtained by mutating the 155th phenylalanine to tyrosine is SEQ ID NO.7; Combination mutations: The 281st aspartic acid was mutated to glycine, the 289th cysteine ​​was mutated to arginine, and the 155th phenylalanine was mutated to tyrosine to obtain the mutant CcDAE-F155Y / D281G / C289R, and the amino acid sequence is SEQ ID NO.9.

[0009] The present invention also provides a gene encoding the above-mentioned D-psicose 3-epimerase mutant.

[0010] The coding gene sequence of CcDAE-D281G is SEQ ID NO.4; the coding gene sequence of CcDAE-C289R is SEQ ID NO.6; the coding gene sequence of CcDAE-F155Y is SEQ ID NO.8; and the coding gene sequence of CcDAE-F155Y / D281G / C289R is SEQ ID NO.10.

[0011] The present invention also provides a recombinant vector containing the above coding gene. The recombinant vector uses pET28a(+) as a vector and inserts sites Xba I and Xho I.

[0012] The present invention also provides a genetically engineered bacterium into which the above-mentioned recombinant vector is introduced. The genetically engineered bacterium is E. coli BL21(DE3).

[0013] In a second aspect, the present invention also provides use of the D-psicose 3-epimerase mutant in the preparation of D-psicose.

[0014] Preferably, D-psicose is prepared by using D-fructose as a substrate and the above-mentioned D-psicose 3-epimerase mutant as a catalyst to carry out a catalytic reaction in a buffer solution.

[0015] Preferably, the catalyst is added in the form of: wet cells of genetically engineered bacteria containing the D-psicose 3-epimerase mutant, and pure enzyme extracted from wet cells of genetically engineered bacteria containing the D-psicose 3-epimerase mutant by ultrasonic disruption.

[0016] Preferably, the final concentration of D-fructose is 100-500 g / L, the amount of the catalyst added in the form of wet bacteria is 40-60 g / L; the amount of the catalyst added in the form of pure enzyme is 0.2-0.5 g / L based on protein content.

[0017] Preferably, the temperature of the catalytic reaction is 50-80° C.; the pH of the catalytic reaction is 6.0-8.0; and the stirring rate of the catalytic reaction is 100-200 r / min.

[0018] Preferably, the wet cells are prepared as follows: a genetically engineered bacterium containing a D-psicose 3-epimerase mutant encoding gene is streaked onto an LB solid culture medium, inverted and cultured at 37°C for 12 h, inoculated into an LB liquid culture medium containing a final concentration of 50 ug / mL kanamycin resistance, and cultured at 37°C for 8 h; the culture solution is transferred to an LB culture medium containing a final concentration of 50 μg / mL kanamycin resistance at a transfer volume of 2% (v / v), cultured at 37°C and 150 r / min to OD600=0.6~0.8, isopropylthiogalactoside (IPTG) is added at a final concentration of 0.5 mM to induce expression, and fermentation is induced at 28°C and 150 r / min for 12 h, centrifuged and the supernatant is discarded, and the wet cells are collected.

[0019] Preferably, the pure enzyme is prepared as follows: 1 g of wet bacteria induced by genetically engineered bacteria containing a D-psicose 3-epimerase mutant encoding gene is resuspended in 20 mL of 50 mM PBS (pH 7.0) buffer, and ultrasonically disrupted for 30 min at 50 W, with 1 s working and 2 s intervals, and the disrupted mixture is centrifuged at 8000 r / min for 10 min, and the supernatant is collected as the crude enzyme solution as the loading solution; a Ni-NTA affinity chromatography column (Bio-Scale MiniProfinity IMAC prepacked column, 40 mm×12.6 mm inner diameter) is used for purification, and the chromatography column is first equilibrated with an equilibration buffer (20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0), and the loading solution is loaded at a rate of 1 mL / min for 4 column volumes, and then an elution solution (50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) Elution is performed at a rate of 1 mL / min. According to the signal responses of the UV detector and the conductivity detector, the corresponding eluate is collected when the signals of the UV detector and the conductivity detector rise at the same time. Collection is stopped when the signal of the conductivity detector remains unchanged and the signal of the UV detector decreases, which means pure enzyme is obtained.

[0020] The present invention has the following beneficial effects: The invention obtains a D-psicose 3-epimerase mutant through protein C-terminal sequence modification, software analysis, and sequence comparison of D-psicose 3-epimerases from different sources, enhances the half-life of the mutant enzyme at 60° C., 70° C., and 80° C., improves the substrate affinity and conversion efficiency of the enzyme to D-fructose, a substrate used for synthesizing D-psicose, and the Tm value of the mutant is 73.23° C., which is 11.98° C. higher than that of the wild type; the half-life at 60° C. is 255.35 min, which is 17.60 times that of the original enzyme, improves the problem of the wild enzyme having a short half-life at high temperature, and the mutant enzyme has a long relative action time. When a genetically engineered bacterium containing the modified enzyme is used for bioconversion, the yield of the product D-psicose is significantly increased, the product yield is increased by 4.3%, and the equilibrium conversion rate reaches 33%, thereby providing a green, environmentally friendly, hygienic, and safe biological preparation method for the preparation process of D-psicose. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the structural simulation diagram of the original enzyme CcDAE and the electrostatic potential distribution diagram of the C-terminus; Figure 2 The resolution and retention time of each substance detected by liquid phase mixed with fructose and D-allulose standards; Figure 3The residual enzyme activity results of the C-terminal modified mutants in Example 2; Figure 4 The residual enzyme activity result of the C289 saturation mutant in Example 4; Figure 5 The residual enzyme activity results of the mutants in Example 5; Figure 6 The sequence alignment result diagram in Example 6; Figure 7 The residual enzyme activity results of the mutants in Example 6; Figure 8 is the half-life of the original enzyme CcDAE and the dominant mutant; Fig. 9 is the half-life of the original enzyme CcDAE and its combined mutant enzymes; Fig.10 The effect of pH on the catalytic activity of the mutant enzyme CcDAE-F155Y / D281G / C289R; Fig.11 The effect of temperature on the catalytic activity of the mutant enzyme CcDAE-F155Y / D281G / C289R; Fig.12 The effect of metal ions on the catalytic activity of the mutant enzyme CcDAE-F155Y / D281G / C289R; Fig.13 is the Tm temperature of the original enzyme CcDAE and its mutant enzyme CcDAE-F155Y / D281G / C289R; Fig.14 is the conversion rate of the original enzyme CcDAE and its mutant enzyme CcDAE-F155Y / D281G / C289R pure enzyme. DETAILED DESCRIPTION

[0022] This specific implementation is only an explanation of the present invention, not a limitation of the present invention. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by the patent law as long as they are within the scope of the claims.

[0023] Example 1: Screening and site-directed mutagenesis of key amino acid sites at the C-terminus of D-psicose 3-epimerase sequence 1. Homology modeling and structural analysis of the original enzyme (referred to as CcDAEase) Use the online software SWIESS-MODEL (https: / / swissmodel.expasy.org / ) for online modeling. Caballeronia concitansThe amino acid sequence of DAEase (CcDAEase, GenBank, number WP_040049840.1) was input into the above website to obtain a homologous structure model, 3VHJ with high model similarity was selected as the model, and its PDB file was downloaded. The obtained PDB file was opened using the application software Pymol to analyze the structure of CcDAEase. The amino acid sequence of CcDAEase is shown in SEQ ID N0.1, and the nucleotide sequence is shown in SEQ ID N0.2.

[0024] 2. Screening of the C-terminal site of the original enzyme (referred to as CcDAEase) The N-terminal and C-terminal regions are usually the most flexible parts of the protein backbone. Through experimental studies, it was found that the C-terminal of CcDAEase has a greater influence on thermal stability. Combining the change in protein folding free energy and protein B-factor analysis, the key sites Q277, A278, D281, S283 and C289 were obtained. According to the calculation of protein folding free energy, the following mutants were obtained (mutants analyzed by sequence alignment and software are not included here): Q277L, A278L, A278M, A278F, D281A, D281G, D281I, D281H, D281R, S283L, S283M, C289R, C289H and C289K.

[0025] According to the gene sequence of the original enzyme CcDAE, mutation primers for site-directed mutagenesis were designed. Rapid PCR technology was used to introduce single mutations into the obtained key sites with the recombinant vector pET28a / CcDAE as a template. The primer list is shown in Table 1.

[0026] Table 1: Key site primer list Primer name Primer sequences Q277L-F CTGGATCGTGAAGCACTGGCAGCACTGGAT Q277L-R TGCTTCACGATCCAGCATTTTTTCATCTGC A278L-F GATCGTGAAGCACAGCTGGCACTGGATTTT A278M-F GATCGTGAAGCACAGATGGCACTGGATTTT A278F-F GATCGTGAAGCACAGTTTGCACTGGATTTT A278-R CTGTGCTTACGATCCAGCATTTTTTCATC D281A-F GCACAGGCAGCACTGGCGTTTAGCCGTTAT D281G-F GCACAGGCAGCACTGGGCTTTAGCCGTTAT D281I-F GCACAGGCAGCACTGATTTTTAGCCGTTAT D281H-F GCACAGGCAGCACTGCATTTTAGCCGTTAT D281R-F GCACAGGCAGCACTGCGCTTTAGCCGTTAT D281-R CAGTGCTGCCTGTGCTTCACGATCCAGCAT S283L-F GCAGCACTGGATTTTCTGCGTTATGTTTCTG S283M-F GCAGCACTGGATTTTATGCGTTATGTTTCTG S283-R AAAATCCAGTGCTGCCTGTGCTTCACGATC C289R-F CGTTATGTTCTGGAACGCCATAAACATAGC C289H-F CGTTATGTTCTGGAACATCATAAACATAGC C289K-F CGTTATGTTCTGGAAAAAACATAAACATAGC C289-R TTCCAGAACATAACGGCTAAAATCCAGTGC The site-directed mutagenesis process is as follows: Site-directed mutagenesis of the target gene was achieved by PCR. The PCR system construction and PCR instrument program settings are shown in Tables 2 and 3.

[0027] Table 2: Site-directed mutagenesis PCR system (50 μL) PCR Reactants Volume (μL) 2×PCR Buffer 25 dNTPs (10 mM) 1 Primer F 1 Primer R 1 Template DNA 1 Phanta DNA Polymerase 1 <![CDATA[ddH 2 The]]> 20 Table 3: Site-directed mutagenesis PCR reaction procedure After PCR, the PCR product was detected by agarose electrophoresis, and the electrophoresis band was observed by a multifunctional imaging instrument. The PCR product band was detected to see if it was consistent with the target gene. If the band size was consistent, Dpn I enzyme was added to the PCR product to digest it and eliminate the original template. The Dpn I enzyme digestion system is shown in Table 4.

[0028] Table 4: Dpn I enzyme digestion system system Volume (μL) Dpn I enzyme 0.5 Buffer 1 PCR products 20 Place the PCR product containing Dpn I enzyme at 37℃, digest for 30 min, and transform 10 μL of the mutant product into competent cells E. coli DH5α. Take 10 μL of PCR product, add it to 100 μL of E. coli DH5α cell suspension in an ice bath, let it stand on ice for 30 min, heat shock the transformation product at 42℃ for 60s, quickly cool it on ice for 5 min, add 600 μL of LB liquid culture medium to the tube, and culture it at 37℃ and 150r / min for 60 min. Centrifuge at 4000r / min for 1 min, discard 400 μL of supernatant and resuspend the bacterial solution. Take 200 μL of the above resuspension and apply it to a LB solid culture medium plate containing kanamycin resistance at a final concentration of 50 μg / mL. After the bacterial solution is completely absorbed by the culture medium, invert and culture at 37°C for 12 hours. Pick the colonies and inoculate them in 10 mL LB liquid culture medium containing kanamycin resistance at a final concentration of 50 μg / mL. Culture at 37°C for 12 hours to obtain the respective bacterial solutions. The bacterial solution is sent to a sequencing company to detect the nucleotide sequence and the sequencing results are correctly aligned, which is a recombinant bacterium containing a mutant enzyme: E.coli DH5α / pET28b / CcDAE / Q277L, E.coli DH5α / pET28b / CcDAE / A278L, E.coli DH5α / pET28b / CcDAE / A278M, E.coli DH5α / pET28b / CcDAE / A278F, E.coli DH5α / pET28b / CcDAE / D281A, E.coli DH5α / pET28b / CcDAE / D281G, E.coli DH5α / pET28b / CcDAE / D281I, E.coli DH5α / pET28b / CcDAE / D281H, E.coli DH5α / pET28b / CcDAE / D281R, E.coli DH5α / pET28b / CcDAE / S283L, E.coli DH5α / pET28b / CcDAE / S283M, E.coli DH5α / pET28b / CcDAE / C289R, E.coli DH5α / pET28b / CcDAE / C289H, E.coli DH5α / pET28b / CcDAE / C289K.

[0029] Extract plasmids from recombinant bacteria that have been sequenced successfully, take 1 μL of plasmid, add it to 100 μL of E. coli BL21 (DE3) competent cell suspension in an ice bath, let it stand on ice for 30 minutes, heat shock the transformation product at 42°C for 90 seconds, quickly put it on ice to cool for 5 minutes, add 600 μL of LB liquid culture medium to the tube, culture at 37°C and 150 r / min for 60 minutes, centrifuge at 4000 r / min for 1 minute, discard 400 μL of supernatant and resuspend the bacterial solution. Take 200 μL of the above resuspension and apply it to a LB solid culture medium plate containing a final concentration of 50 μg / mL kanamycin resistance. After the bacterial solution is completely absorbed by the culture medium, invert and culture at 37°C for 12 hours, pick the colonies and inoculate them in 10 mL LB liquid culture medium containing a final concentration of 50 μg / mL kanamycin resistance, and culture at 37°C for 12 hours to obtain the respective bacterial solutions. This is the recombinant bacteria containing mutant enzymes. Pipette 700 μL of bacterial solution and 700 μL of 50% glycerol into a glycerol tube respectively, mix well, and store at -80°C.

[0030] The obtained recombinant expression plasmid pET28a / CcDAE was transformed into E.coli BL21 (DE3) recipient bacteria, coated on LB agar plates containing a final concentration of 100mM kanamycin, and cultured at 37°C for 12 hours. The clones were randomly picked from the colonies grown on the plates and the plasmids were extracted for agarose gel electrophoresis identification and nucleotide sequence determination, respectively, to obtain genetically engineered bacteria containing the mutated Cc gene, i.e., recombinant bacteria containing the mutant enzyme. At the same time, the expression plasmid with the original gene inserted was used as a control to construct E.coliBL21 (DE3) / pET28a / CcDAE.

[0031] The above genetically engineered bacteria were inoculated into LB liquid culture medium containing a final concentration of 50ug / mL kanamycin, and cultured at 37°C and 150r / min for 8h to obtain seed solution; the seed solution was inoculated into fresh LB liquid culture medium containing a final concentration of 50ug / mL kanamycin at a 2% (v / v) inoculation amount, and cultured at 37°C and 150r / min until OD600 reached 0.6~0.8, and then IPTG with a final concentration of 1mM was added to the culture solution, and expression was induced at 28°C for 12h, and centrifuged at 4°C and 8000r / min for 10min, the supernatant was discarded, and the wet bacteria were collected for later use.

[0032] Example 2: Determination of enzyme activity of CcDAEase sequence C-terminal mutant Reaction system: 50mM HEPES buffer (pH 7.0), 50g / L fructose and 20g / L wet bacteria, a total of 1mL system. Reaction conditions: hot compress at 70℃ for 15min, 55℃ for 5min, and boil for 10min to terminate the reaction. The reaction solution was taken and HPLC was used to detect the content of D-psicose. The resolution and retention time of each substance detected by the liquid phase mixed with fructose and D-psicose as standard samples are shown in the figure. Figure 2 shown.

[0033] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractometer, column oven 80°C, mobile phase ultrapure water, flow rate 0.4 mL / min. Enzyme activity definition (U): The amount of enzyme required to catalyze the synthesis of 1 μmol of D-psicose per unit time (min) under standard reaction conditions. Comparison of residual enzyme activities of 14 screened mutants with the original enzyme Figure 3 shown.

[0034] Depend on Figure 3 The results showed that the modification of sites 281 and 289 was of great help in improving thermal stability. After incubation at 70℃ for 15 min, the residual enzyme activities of D281G and C289R were 9.63 and 12.49 times of the wild type, respectively. Compared with the wild type, the residual enzyme activities of other mutants D281A, D281I, D281H, D281R, C289H and C289K increased by 4.99 times, 3.25 times, 4.04 times, 6.04 times, 6.06 times and 5.78 times, respectively, and the residual enzyme activities were lower than those of mutants D281G and C289R. The residual enzyme activities of mutants at other mutation sites were lower than those of the wild type after incubation.

[0035] Example 3: Site-directed saturation mutagenesis of D-psicose 3-epimerase sequence C289 according to Figure 3 It can be seen that the C289 site has the greatest improvement in stability, so a site-directed saturation mutagenesis was performed on this site to mutate it into the remaining 19 amino acids.

[0036] According to the gene sequence of the original enzyme CcDAE, mutation primers for site-directed mutagenesis were designed. Rapid PCR technology was used to introduce single mutations into the C289 position using the recombinant vector pET28a / CcDAE as a template. The site-directed mutagenesis process was the same as in Example 1. The primer list is shown in Table 5.

[0037] Table 5: C289 site-directed saturation mutagenesis primer list Primer name Primer sequences C289A-F CGTTATGTTCTGGAAGCGCATAAACATAGC C289D-F CGTTATGTTCTGGAAGATCATAAACATAGC C289E-F CGTTATGTTCTGGAAGAACATAAACATAGC C289F-F CGTTATGTTCTGGAATTTCATAAACATAGC C289G-F CGTTATGTTCTGGAAGGCCATAAACATAGC C289H-F CGTTATGTTCTGGAACATCATAAACATAGC C289I-F CGTTATGTTCTGGAAATTCATAAACATAGC C289K-F CGTTATGTTCTGGAAAAACATAAACATAGC C289L-F CGTTATGTTCTGGAACTGCATAAACATAGC C289M-F CGTTATGTTCTGGAAATGCATAAACATAGC C289N-F CGTTATGTTCTGGAAAACCATAAACATAGC C289P-F CGTTATGTTCTGGAACCGCATAAACATAGC C289Q-F CGTTATGTTCTGGAAGAGCATAAACATAGC C289R-F CGTTATGTTCTGGAACGCCATAAACATAGC C289S-F CGTTATGTTCTGGAAAGCCATAAACATAGC C289T-F CGTTATGTTCTGGAAACCCATAAACATAGC C289V-F CGTTATGTTCTGGAAGTGCATAAACATAGC C289W-F CGTTATGTTCTGGAATGGCATAAACATAGC C289Y-F CGTTATGTTCTGGAATATCATAAACATAGC C289-R TTCCAGAACATAACGGCTAAAATCCAGTGC Example 4: C289 saturation mutant enzyme activity assay Reaction system: 50mM HEPES buffer (pH 7.0), 50g / L fructose and 20g / L wet bacteria, a total of 1mL system. Reaction conditions: hot compress at 70℃ for 15min, 55℃ for 5min, and boil for 10min to terminate the reaction. The reaction solution was taken and the D-psicose content was detected by HPLC.

[0038] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractometer, column oven 80℃, mobile phase ultrapure water, flow rate 0.4 mL / min. Enzyme activity definition (U): The amount of enzyme required to catalyze the synthesis of 1 μmol of D-psicose per unit time (min) under standard reaction conditions. Residual enzyme activity compared with original enzyme Figure 4 shown.

[0039] Depend on Figure 4 The results showed that the relative residual enzyme activity of the mutant C289R was the highest, 12.49 times that of the wild type. The protease terminal of CcDAEase has more negative charges. The mutation of C289 to positively charged amino acids greatly improves the stability of the amino acids, while the mutation to negatively charged amino acids does not improve the stability and even brings side effects.

[0040] Example 5: Software analysis to find mutation sites and enzyme activity determination The stability mutation sites of CcDAEase were predicted by online software such as Hotspot wizard 3.0, Fireprot v2.0 and DeepDDG. Finally, 14 key sites were obtained, which were mutated to the following amino acids S38F, D45N, C54T, A70P, A85G, T90Q, K1118E, T119C, C143M, G166A, N176P, L208F, S255W, Q277R. The site-directed mutagenesis process was the same as in Example 1, and the primer list is shown in Table 6.

[0041] Table 6: Primer list Primer Name Sequence (5’—3’) S38F-F CTGGAAATTGCAGCATTTCCGCTGCCGTTT S38F-R TGCTGCAATTTCCAGAATATCAAAACCCAG D45N-F CTGCCGTTTTATAGCAACATTCAGATCAAT D45N-R GCTATAAAACGGCAGCGGGCTTGCTGCAAT C54T-F AATGAACTGAAAGCAACCGCACATGGTAAC C54T-R TGCTTTCAGTTCATTGATCTGAATATCGCT A70P-F GGTCATGGTCCGTCTCCGGAACAGAATCTG A70P-R AGACGGACCATGACCCACGGTCAGGGTAAT A85G-F GATATTCGTAAAAATGGCAAAGCATTTTAT A85G-R ATTTTTACGAATATCCGGATCCGGACTACT T90Q-F GCAAAAGCATTTTATCAGGATCTGCTGAAA T90Q-R ATAAAATGCTTTTGCATTTTTACGAATATC K118E-F CCTATTGATTATACCGAAACCATTGATAAA K118E-R GGTATAATCAATAGGCCAATAGCTATACAG T119C-F ATTGATTATACCAAATGCATTGATAAAAAG C143M-F AAAGTTGCGGAAGCAATGGGTGTTGATTTT C143M-R TGCTTCCGCAACTTTCGCAACTTCACGCAC G166A-F AACACCGCGCAGGAAGCGGTGGATTTTGTT G166A-R TTCCTGCGCGGTGTTAATCAGATAATTTTC N176P-F AAACAGGTAGATCATCCGAACGTGAAAGTG N176P-R ATGATCTACCTGTTTAACAAAATCCACACC L208F-F AGCTATCTGGGTCATTTTCATACAGGTGAA L208F-R ATGACCCAGATAGCTACCTGCTGTGCGAAT S255W-F GGTGGTACCGTTGGTTGGAATATTAAAGTT S255W-R ACCAACGGTACCACCCATACGAACAAACGG Q277R-F CTGGATCGTGAAGCACGCGCAGCACTGGAT Q277R-R TGCTTCACGATCCAGCATTTTTTCATCTGC The enzyme activity determination method is the same as in Example 4, and the results are as follows Figure 5 As shown, the relative residual enzyme activity of mutant Q277R is the highest, which is much better than that of the wild type.

[0042] Example 6: Sequence alignment, mutation site screening, site-directed mutagenesis, and enzyme activity determination of D-psicose 3-epimerase from different sources In order to improve the thermal stability of CcDAEase, we searched the literature to find homologous genes with higher thermal stability for sequence comparison. The detailed information of the selected homologous genes is shown in Table 7.

[0043] Table 7: High stability DAEases information By comparing the amino acid sequence of CcDAEase with that of Uncultured bacterium DAEase, Staphylococcus aureus DAEase, Labedella endophytica DAEase and Mesorhizobium japonicum The amino acid sequences of DAEase were compared to find mutation sites with higher homology. The sequence comparison results are as follows: Figure 6 As shown in the figure, KEases from different sources have sequence diversity, but are highly conserved, with high conservation at sites such as 29-34, 150-163, 183-191 and 209-221. Among them, the three amino acid residues E156, H186 and R215 that interact with d-fructose O-1, O-2 and O-3 positions form a catalytic triad. The following mutants were obtained by sequence alignment: H3I, Y18I, L28A, A37L, Q47D, P68L, N72D, Y89L, D100G, A107V, L152V, F155Y, T210I, C213S, M248S, V253I, D262N, I263L, A278I.

[0044] Site-directed mutagenesis was performed by PCR, and the site-directed mutagenesis process was the same as in Example 1. The selected mutation sites and primer design list are shown in Appendix 8.

[0045] Table 8: Primer list Primer Name Sequence (5’—3’) H3I-F TATACCGCAATGAAAATTGGTATTTATTAT H3I-R TTTCATTGCGGTATATCTCCTTCTTAAAGT Y18I-F GAATGGGAAGCAGATATTAAATATTATATC Y18I-R ATCTGCTTCCCATTCCTGTTCCCAATAGGC L28A-F GAAAAAGTGGCAAAAGCGGGTTTTGATATT L28A-R TTTTGCCACTTTTTCGATATAATATTTAT A37L-F ATTCTGGAAATTGCACTGAGCCCGCTGCCG A37L-R TGCAATTTCCAGAATATCAAAACCCAGTTT Q47D-F TTTTATAGCGATATTGATATCAATGAACTG Q47D-R AATATCGCTATAAAACGGCAGCGGGCTTGC P68L-F ACCGTGGGTCATGGTCTGTCTGCGGAACAG P68L-R ACCATGACCCACGGTCAGGGTAATACCGTT N73D-F CCGTCTGCGGAACAGGATCTGAGTAGTCCG N73D-R CTGTTCCGCAGACGGACCATGACCCACGGT Y89L-F AATGCAAAAGCATTTCTGACCGATCTGCTG Y89L-R AAATGCTTTTGCATTTTTACGAATATCCGG D100G-F CGCCTGTATAAACTGGGCGTTCATCTGATT D100G-R CAGTTTATACAGGCGTTTCAGCAGATCGGT A107V-F CATCTGATTGGTGGTGTGCTGTATAGCTAT A107V-R ACCACCAATCAGATGAACATCCAGTTTATA L152V-F TTTTGTCTGGAAGTGGTGAACCGTTTTGAA L152V-R CACTTCCAGACAAAAATCAACACCACATGC F155Y-F GAAGTGCTGAACCGTTATGAAAATTATCTG F155Y-R ACGGTTCAGCACTTCCAGACAAAAATCAAC T210I-F CTGGGTCATCTGCATATTGGTGAATGTAAC T210I-R ATGCAGATGACCCAGATAGCTACCTGCTGT C213S-F CTGCATACAGGTGAAAGCAACCGTAAAGTT C213S-R TTCACCTGTATGCAGATGACCCAGATAGCT M249S-F GAACCGTTTGTTCGTAGCGGTGGTACCGTT M249S-R ACGAACAAACGGTTCCATAACAACGCTGCC V253I-F CGTATGGGTGGTACCATTGGTAGCAATATT V253I-R GGTACCACCCATACGAACAAACGGTTCCAT D262N-F ATTAAAGTTTGGCGTAACATTAGTAACGGT D262N-R ACGCCAAACTTTAATATTGCTACCAACGGT I263L-F AAAGTTTGGCGTGATCTGAGTAACGGTGCA I263L-R ATCACGCCAAACTTTAATATTGCTACCAAC A278I-F GATCGTGAAGCACAGATTGCACTGGATTTT A278I-R CTGTGCTTACGATCCAGCATTTTTTCATC According to the site-directed mutagenesis through PCR reaction, the PCR product was verified by agarose nucleic acid electrophoresis. The 19 mutation sites selected by sequence alignment all had bands, and the band size was consistent with the theoretical value. The PCR product with the correct band was transformed, connected to the test tube and shaken for testing. The mutants that were successfully sequenced were induced and harvested, and the wet bacteria were obtained for biotransformation to produce d-psicose. After the mutant bacteria were incubated at 70℃ for 15 min, reacted under the optimal reaction conditions for 5 min, boiled and inactivated, the residual enzyme activity of the mutant was determined by HPLC, and the results were as follows Figure 7 As shown. The mutants with improved relative residual enzyme activity are F155Y and V253I, and the residual enzyme activity is increased by 2.3 times and 1.24 times compared with the wild type. Among them, the residual enzyme activity of mutant A37L did not change much before and after mutation. Compared with the wild type, the residual enzyme activity of mutants at other mutation sites decreased, especially mutants P68L, C213S, M249S and D262N, whose residual enzyme activity was less than 10% of the wild type.

[0046] Example 7: Dominant mutant t 1 / 2 Measurement results Example 6 is constructed as follows: E. coli BL21(DE3) / pET28a / CcDAE / F155Y, E. coli BL21(DE3) / pET28a / CcDAE / V253I; E. coli BL21(DE3) / pET28a / CcDAE / Q277R constructed in Example 5; Example 1 constructed: E. coli BL21(DE3) / pET28a / CcDAE / D281 and E. coli BL21(DE3) / pET28a / CcDAE / C289R were streaked onto LB solid medium, inverted and cultured at 37°C for 12 h, single colonies were picked and inoculated into 10 mL LB liquid medium, cultured at 37°C for 8 h, then transferred to 100 mL LB medium at a transfer volume of 2% (v / v), cultured at 37°C and 150 r / min to OD600 = 0.6-0.8, IPTG was added at a final concentration of 0.1 mM to induce expression, induced at 28°C and 150 r / min for 12 h, and the supernatant was discarded to collect the bacteria by centrifugation.

[0047] Reaction system: 50mM HEPES buffer (pH 7.0), 50g / L fructose and 20g / L wet bacteria, a total of 1mL system. Reaction conditions: Incubate the wild type and dominant mutant at 70°C, take samples at certain time intervals, react for 10min under optimal conditions, and boil for 10min to terminate the reaction. Take the reaction solution and use HPLC to detect the D-psicose content.

[0048] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractometer, column oven 80°C, mobile phase ultrapure water, flow rate 0.4 mL / min. Enzyme activity definition (U): The amount of enzyme required to catalyze the synthesis of 1 μmol of D-psicose per unit time (min) under standard reaction conditions. Mutant t 1 / 2 Compared with the original enzyme Figure 8 shown.

[0049] Depend on Figure 8It can be seen that compared with the wild type, the half-lives of the dominant mutants are all improved. The half-lives of F155Y, V253I, Q277R, D281G and C289R are 104.22 min, 38.51 min, 40.05 min, 128.12 min and 101.47 min, respectively, which are 7.18 times, 2.62 times, 2.76 times, 8.83 times and 6.99 times higher than those of the wild type.

[0050] Example 8: Multi-point combined mutation study Through the study of the half-life of the dominant mutants in Example 7, 155Y, D281G and C289R have better half-lives. The above dominant mutants were combined and mutated to construct a multi-point combined mutant strain: E.coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G、 E.coliBL21(DE3) / pET28a / CcDAE / F155Y / C289R、 E.coliBL21(DE3) / pET28a / CcDAE / D281G / C289R、 E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R.

[0051] Reaction system: 50mM HEPES buffer (pH 7.0), 50g / L fructose and 20g / L wet bacteria, a total of 1mL system. Reaction conditions: Incubate the wild type and dominant mutant at 70°C, take samples at certain time intervals, react for 10min under optimal conditions, and boil for 10min to terminate the reaction. Take the reaction solution and use HPLC to detect the D-psicose content.

[0052] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractometer, column oven 80°C, mobile phase ultrapure water, flow rate 0.4 mL / min. Enzyme activity definition (U): The amount of enzyme required to catalyze the synthesis of 1 μmol of D-psicose per unit time (min) under standard reaction conditions. Mutant t 1 / 2 Compared with the original enzyme Fig. 9 shown.

[0053] Depend on Fig. 9It can be seen that compared with the wild type, the half-lives of the combined mutants F155Y / D281G, F155Y / C289R, D281G / C289R and F155Y / D281G / C289R were 207.61 min, 182.11 min, 192.34 min and 255.35 min, respectively, which were increased by 14.31 times, 12.55 times, 13.25 times and 17.60 times compared with the wild type.

[0054] Example 9: Investigation of the enzymatic properties of F155Y / D281G / C289R The optimal reaction pH of the enzyme was determined for the optimal combination mutant strain E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R. The reaction system was pH 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 (sodium acetate buffer, sodium phosphate buffer, Tris-HCl buffer), 50 g / L fructose and 20 g / L wet bacteria, a total of 1 mL system. The reaction was carried out at 55°C for 5 min and the reaction was terminated by boiling for 10 min. The reaction solution was taken and the D-psicose content was detected by HPLC.

[0055] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractometer, column oven 80℃, mobile phase ultrapure water, flow rate 0.4 mL / min. Enzyme activity definition (U): The amount of enzyme required to catalyze the synthesis of 1 μmol of D-psicose per unit time (min) under standard reaction conditions. Effect of pH on the enzyme activity of mutants Fig.10 As shown. Fig.10 It can be seen that the optimal reaction pH of the mutant is 7.0.

[0056] The optimal reaction temperature of the mutant E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R was determined. The reaction was carried out at pH 7.0 and different temperatures (40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90°C) for 5 min. Other conditions were the same as above. The results are shown in the table. Fig.11 As can be seen from the figure, the optimal reaction temperature of the mutant enzyme F155Y / D281G / C289R is 60 ℃.

[0057] The effect of metal ions on the enzyme activity of mutant E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R was determined. +、Co 2+ Mg 2+ , Cu 2+ , Ca 2+ , Fe 3+ , Fe 2+ 、Ni 2+ 、Zn 2+ ), pH 7.0, 60℃ for 5 min, other conditions were the same as above, the results are shown in Fig.12 As shown in the figure, it can be seen that the optimal metal ion for the mutant is Co 2+ .

[0058] Purification of recombinant enzyme: Purification was performed using a nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC prepacked column, 40 mm length × 12.6 mm inner diameter). The column was first equilibrated with an equilibrium buffer (20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0), 20 mL (4 column volumes) of sample solution was loaded at a rate of 1 mL / min, and then eluted with an eluent (50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a rate of 1 mL / min. According to the signal response of the UV detector and the conductivity detector, the corresponding eluent was collected when the UV detector signal and the conductivity detector signal rose at the same time, and the collection was stopped when the conductivity detector signal remained unchanged and the UV detector signal decreased, which was the respective pure enzyme solution. The protein concentration of the pure enzyme solution was tested using a BCA kit.

[0059] Example 10: Determination of the Tm value of the mutant E. coli BL21 (DE3) / pET28a / CcDAE / F155Y / D281G / C289R.

[0060] The Tm value difference between the mutant and the original enzyme was compared by circular dichroism analysis. Fig.13 As shown in the figure, it can be seen that the Tm value of the mutant is 73.23℃, which is 11.98℃ higher than that of the original enzyme (wild type).

[0061] Example 11: Reaction progress of D-psicose produced by mutant E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R.

[0062] Reaction system: 50 mM HEPES buffer (pH 7.0), 300 g / L D-fructose as substrate, 0.3 g / L pure enzyme, 1 mmol / L Co 2+, a total of 1 mL system. The reaction was carried out at 60°C for 350 min, samples were taken at certain times, and the reaction was terminated by boiling for 10 min. The reaction solution was taken and the D-psicose content was detected by HPLC.

[0063] HPLC detection conditions are the same as in Example 8, and the results are as follows Fig.14 As shown in the figure, it can be seen that the equilibrium conversion rate of the mutant is 33.33%, which is 4.29% higher than that of the wild type, and catalyzes 300 g / L D-fructose to produce 99.99 g / L D-psicone.

Claims

1. A D-psicose 3-epimerase mutant, characterized in that: The D-psicose 3-epimerase mutant has only a single point mutation or a combination mutation in the 155th phenylalanine, the 281st aspartic acid, and the 289th cysteine ​​mutation relative to the amino acid sequence SEQ ID NO.1 of the wild-type D-psicose 3-epimerase.

2. The D-psicose 3-epimerase mutant according to claim 1, characterized in that: The D-psicose 3-epimerase mutant has only a single point mutation or a combination of mutations, namely, mutation of phenylalanine at position 155 to tyrosine, mutation of aspartic acid at position 281 to glycine, and mutation of cysteine ​​at position 289 to arginine, relative to the amino acid sequence SEQ ID NO.1 of the wild-type D-psicose 3-epimerase.

3. A gene encoding the D-psicose 3-epimerase mutant according to claim 1 or 2.

4. A recombinant vector containing the gene according to claim 3.

5. A genetically engineered bacterium into which the recombinant vector according to claim 4 has been introduced.

6. Use of the D-psicose 3-epimerase mutant according to claim 1 or 2 in the preparation of D-psicose.

7. The use according to claim 6, characterized in that: D-psicose is prepared by using D-fructose as a substrate and the D-psicose 3-epimerase mutant according to claim 1 or 2 as a catalyst to carry out a catalytic reaction in a buffer solution.

8. The use according to claim 7, characterized in that: The catalyst is added in the following forms: wet bacterial cells of genetically engineered bacteria containing the D-psicose 3-epimerase mutant, and pure enzyme extracted from wet bacterial cells of genetically engineered bacteria containing the D-psicose 3-epimerase mutant through ultrasonic crushing.

9. The use according to claim 8, characterized in that: The final concentration of D-fructose is 100-500 g / L, the amount of the catalyst added in the form of wet bacteria is 40-60 g / L; the amount of the catalyst added in the form of pure enzyme is 0.2-0.5 g / L based on protein content.

10. The use according to claim 7, characterized in that: The temperature of the catalytic reaction is 50-80° C.; the pH of the catalytic reaction is 6.0-8.0.

Images