A D-psicose 3-epimerase mutant and its application
By performing specific amino acid sequence mutations on D-psicose 3-episomerase, the problem of insufficient stability and catalytic activity of the enzyme under high temperature conditions is solved, and the efficient biological preparation of D-psicose is achieved, improving the thermal stability and substrate conversion efficiency of the enzyme.
Patent Information
- Application Number
- CN202411899178.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-23
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2044-12-23
AI Technical Summary
The thermal stability and catalytic activity of the existing D-psicose 3-episomerase cannot meet the industrial production requirements, especially the enzyme isomerial denaturation and inactivation under high temperature conditions, which limits its application.
D-psicose 3-episomerase was prepared by modifying single point or combination of amino acid sequences of D-psicose 3-episomerase, especially phenylalanine at 155, aspartic acid at 281 and cysteine at 289, to improve the thermal stability and substrate affinity of the enzyme.
The half-life of mutant enzymes at 60℃, 70℃ and 80℃ is significantly extended, the conversion efficiency of substrate D-fructose is improved, and the yield of product D-psicose is increased, providing a green and environmentally friendly biological preparation method.
Smart Images

Figure CN119331861B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of enzyme engineering, and particularly relates to a D-allulose 3-epimerase mutant and its application. Background Art
[0002] D-allulose is a hexulose and is the C-3 epimer of D-fructose in terms of chemical structure. D-allulose is a functional rare sugar with high sweetness but extremely low energy value, having only 10% of the calories of relative sucrose. It is an ideal natural sweetener and sucrose substitute, and has been listed as "Generally Recognized as Safe" food by the U.S. Food and Drug Administration and is allowed to be added as an additive to candies, juices, soy sauces and other dietary products.
[0003] The production methods of D-allulose mainly include extraction method, chemical synthesis method and bioconversion method. Among them, the extraction method has low yield and high cost; the chemical synthesis method has complex reaction conditions, expensive raw materials and safety risks; while the bioconversion method has become the main method for industrial production of D-allulose due to its advantages of strong specificity, safety and environmental protection. It uses D-fructose as a substrate and ketose 3-epimerase as a catalyst to carry out isomerization at the C-3 position to generate D-allulose in one step. Ketose 3-epimerase can be divided into three types: D-allulose 3-epimerase (DAEase), D-tagatose 3-epimerase (DTEase) and L-ribulose 3-epimerase (LREase). Among them, DAEase has the largest variety and is the most widely studied. In industrial production, there are many requirements for the performance of enzymes, and the stability, catalytic activity, substrate specificity and acid resistance of enzymes are the main limiting factors. At high temperature, the reaction rate of enzymes becomes faster and the solubility of substrates increases, but too high temperature will cause the enzymes to isomerize and inactivate. However, the stability and catalytic activity of DAEase still cannot meet the requirements of industrial production. Therefore, it has become an urgent task to improve the thermal stability and catalytic activity of DAEase. Summary of the Invention
[0004] To solve the above problems, the present invention provides a D-allulose 3-epimerase mutant, which has high thermal stability and can be used as a catalyst for preparing D-allulose.
[0005] The technical solution of the present invention to solve the above problems is as follows:
[0006] A D-allulose 3-epimerase mutant, wherein the D-allulose 3-epimerase mutant has a single-point mutation or a combined mutation of only phenylalanine at position 155, aspartic acid at position 281, and cysteine at position 289 relative to the amino acid sequence SEQ ID NO.1 of wild-type D-allulose 3-epimerase.
[0007] The wild-type D-psicose 3-epimerase is derived from Clostridium cellulolyticum H10, and the coding gene sequence is SEQ ID NO.2.
[0008] Preferably, the D-psicose 3-epimerase mutant is a single-point mutation or a combined mutation in which only the 155th phenylalanine is mutated to tyrosine (F155Y), the 281st aspartic acid is mutated to glycine (D281G), and the 289th cysteine is mutated to arginine (C289R) relative to the amino acid sequence SEQ ID NO.1 of the wild-type D-psicose 3-epimerase.
[0009] Single-point mutation:
[0010] When the 281st aspartic acid is mutated to glycine, the amino acid sequence of the mutant CcDAE-D281G is SEQ ID NO.3;
[0011] When the 289th cysteine is mutated to arginine, the amino acid sequence of the mutant CcDAE-C289R is SEQ ID NO.5;
[0012] When the 155th phenylalanine is mutated to tyrosine, the amino acid sequence of the mutant CcDAE-F155Y is SEQ ID NO.7;
[0013] Combined mutation:
[0014] When the 281st aspartic acid is mutated to glycine, the 289th cysteine is mutated to arginine, and the 155th phenylalanine is mutated to tyrosine, the mutant CcDAE-F155Y / D281G / C289R is obtained, and the amino acid sequence is SEQ ID NO.9.
[0015] The present invention also provides a gene encoding the above-mentioned D-psicose 3-epimerase mutant.
[0016] The coding gene sequence of CcDAE-D281G is SEQ ID NO.4; the coding gene sequence of CcDAE-C289R is SEQ ID NO.6; the coding gene sequence of CcDAE-F155Y is SEQ ID NO.8; the coding gene sequence of CcDAE-F155Y / D281G / C289R is SEQ ID NO.10.
[0017] The present invention also provides a recombinant vector containing the above-mentioned coding gene. The recombinant vector uses pET28a(+) as the vector, and the insertion sites are Xba I and Xho I.
[0018] The present invention also provides a genetically engineered bacterium into which the above recombinant vector has been introduced. The genetically engineered bacterium is E. coli BL21(DE3).
[0019] In a second aspect, the present invention also provides the use of the above D-allulose 3-epimerase mutant in the preparation of D-allulose.
[0020] Preferably, using D-fructose as a substrate and the above D-allulose 3-epimerase mutant as a catalyst, a catalytic reaction is carried out in a buffer solution to prepare D-allulose.
[0021] Preferably, the forms of addition of the catalyst include: wet cells of a genetically engineered bacterium containing the D-allulose 3-epimerase mutant, and pure enzyme extracted by ultrasonic disruption of the wet cells of the genetically engineered bacterium containing the D-allulose 3-epimerase mutant.
[0022] Preferably, the final concentration of D-fructose is 100-500 g / L, the amount of the catalyst added in the form of wet cells is 40-60 g / L; the amount of the catalyst added in the form of pure enzyme is 0.2-0.5 g / L in terms of protein content.
[0023] Preferably, the temperature of the catalytic reaction is 50-80 °C; the pH of the catalytic reaction is 6.0-8.0, and the stirring rate of the catalytic reaction is 100-200 r / min.
[0024] Preferably, the wet cells are prepared as follows: The genetically engineered bacterium containing the gene encoding the D-allulose 3-epimerase mutant is streaked onto an LB solid medium and cultured inverted at 37 °C for 12 h, inoculated into an LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / mL, and cultured at 37 °C for 8 h; the culture solution is transferred to an LB medium containing kanamycin resistance at a final concentration of 50 μg / mL with a transfer amount of 2% (v / v), and cultured at 37 °C and 150 r / min until OD600 = 0.6-0.8, and isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.5 mM is added for induction expression, and induced fermentation is carried out at 28 °C and 150 r / min for 12 h, and the supernatant is discarded by centrifugation to collect the wet cells.
[0025] Preferably, the pure enzyme is prepared as follows: The wet cells obtained by inducing and culturing the genetically engineered bacterium containing the gene encoding the D-allulose 3-epimerase mutant are resuspended in 20 mL of 50 mM PBS (pH 7.0) buffer per 1 g of wet cells, sonicated for 30 min under the condition of 50 W, with 1 s of working and 2 s of interval, the disrupted mixture is centrifuged at 8000 r / min for 10 min, and the supernatant is collected as the crude enzyme solution, which is used as the sample loading solution; Ni-NTA affinity chromatography column (Bio-Scale MiniProfinity IMAC pre-packed column, 40 mm×12.6 mm inner diameter) is used for purification. First, the chromatography column is equilibrated with the equilibration buffer (20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0), the sample loading solution is loaded at a rate of 1 mL / min for 4 column volumes, and then the elution buffer (50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) is used for elution at a rate of 1 mL / min. According to the signal responses of the ultraviolet detector and the conductivity detector, the corresponding elution solution is collected when the signals of the ultraviolet detector and the conductivity detector rise simultaneously, and the collection is stopped when the signal of the conductivity detector remains unchanged and the signal of the ultraviolet detector decreases, which is the pure enzyme.
[0026] The present invention has the following beneficial effects:
[0027] Through protein C-terminal sequence modification, software analysis, and sequence alignment of D-allulose 3-epimerases from different sources, the present invention obtains a D-allulose 3-epimerase mutant, which enhances the half-life of the mutant enzyme at 60 °C, 70 °C, and 80 °C, improves the substrate affinity and conversion efficiency of the enzyme for the substrate D-fructose used in the synthesis of D-allulose. The Tm value of the mutant is 73.23 °C, which is 11.98 °C higher than that of the wild type; the half-life at 60 °C is 255.35 min, which is 17.60 times that of the original enzyme, improving the problem of the too short half-life of the wild enzyme at high temperature. The mutant enzyme has a relatively long action time. Using the genetically engineered bacterium containing the modified enzyme for biotransformation, the yield of the product D-allulose is significantly increased, the product yield is increased by 4.3%, and the equilibrium conversion rate reaches 33%, providing a green, environmentally friendly, hygienic, and safe biological preparation method for the preparation process of D-allulose. Description of the Drawings
[0028] Figure 1 It is the structural simulation diagram of the original enzyme CcDAE and the C-terminal electrostatic potential distribution diagram;
[0029] Figure 2 It is the resolution and retention time of each substance in the liquid phase detection of the mixture of the standard samples of fructose and D-allulose.
[0030] Figure 3 Results of the residual enzyme activity of the C-terminal modified mutants in Example 2;
[0031] Figure 4 Results of the residual enzyme activity of the C289 saturation mutants in Example 4;
[0032] Figure 5 Results of the residual enzyme activity of the mutants in Example 5;
[0033] Figure 6 Sequence alignment result diagram in Example 6;
[0034] Figure 7 Results of the residual enzyme activity of the mutants in Example 6;
[0035] Figure 8 Half-life of the original enzyme CcDAE and the dominant mutants;
[0036] Figure 9 Half-life of the original enzyme CcDAE and its combined mutant enzymes;
[0037] Figure 10 Effect of pH on the catalytic activity of the mutant enzyme CcDAE-F155Y / D281G / C289R;
[0038] Figure 11 Effect of temperature on the catalytic activity of the mutant enzyme CcDAE-F155Y / D281G / C289R;
[0039] Figure 12 Effect of metal ions on the catalytic activity of the mutant enzyme CcDAE-F155Y / D281G / C289R;
[0040] Figure 13 Tm temperature of the original enzyme CcDAE and its mutant enzyme CcDAE-F155Y / D281G / C289R;
[0041] Figure 14 Conversion rate of the original enzyme CcDAE and its mutant enzyme CcDAE-F155Y / D281G / C289R in pure enzyme form. Specific implementation manner
[0042] This specific implementation manner is only an interpretation of the present invention and does not limit the present invention. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by the Patent Law as long as they are within the scope of the claims.
[0043] Example 1: Screening and site-directed mutagenesis of key amino acid sites at the C-terminus of the D-allulose 3-epimerase sequence
[0044] 1. Homology Modeling and Structural Analysis of the Original Enzyme (Abbreviation: CcDAEase)
[0045] Online modeling was performed using the online software SWIESS-MODEL (https: / / swissmodel.expasy.org / ). The amino acid sequence of Caballeronia concitans DAEase (CcDAEase, GenBank, accession number WP_040049840.1) was input into the above website to obtain a homologous structure model. 3VHJ with a high model similarity was selected as the model, and its PDB file was downloaded. The obtained PDB file was opened using the application software Pymol to analyze the structure of CcDAEase. The amino acid sequence of CcDAEase is shown as SEQ ID N0.1, and the nucleotide sequence is shown as SEQ ID N0.2.
[0046] 2. Screening of the C-Terminal Sites of the Original Enzyme (Abbreviation: CcDAEase)
[0047] The N-terminal and C-terminal regions are usually the most flexible parts of the protein backbone. Through experimental research, it was found that the C-terminal of CcDAEase has a greater impact on thermal stability. Combining the change in protein folding free energy and the B-factor analysis of the protein, the key sites Q277, A278, D281, S283, and C289 were obtained. According to the calculation of protein folding free energy, the following mutants were obtained (mutants obtained by sequence alignment and software analysis are not included here), Q277L, A278L, A278M, A278F, D281A, D281G, D281I, D281H, D281R, S283L, S283M, C289R, C289H, and C289K.
[0048] Site-directed mutagenesis primers were designed based on the gene sequence of the original enzyme CcDAE. Using the rapid PCR technique, with the recombinant vector pET28a / CcDAE as the template, single mutations were introduced into the obtained key sites respectively. The primer list is shown in Table 1.
[0049] Table 1: Primer List for Key Sites
[0050] Primer Name Primer Sequence Q277L-F CTGGATCGTGAAGCACTGGCAGCACTGGAT Q277L-R TGCTTCACGATCCAGCATTTTTTCATCTGC A278L-F GATCGTGAAGCACAGCTGGCACTGGATTTT A278M-F GATCGTGAAGCACAGATGGCACTGGATTTT A278F-F GATCGTGAAGCACAGTTTGCACTGGATTTT A278- R CTGTGCTTCACGATCCAGCATTTTTTCATC D281A-F GCACAGGCAGCACTGGCGTTTAGCCGTTAT D281G-F GCACAGGCAGCACTGGGCTTTAGCCGTTAT D281I-F GCACAGGCAGCACTGATTTTTAGCCGTTAT D281H-F GCACAGGCAGCACTGCATTTTAGCCGTTAT D281R-F GCACAGGCAGCACTGCGCTTTAGCCGTTAT D281-R CAGTGCTGCCTGTGCTTCACGATCCAGCAT S283L-F GCAGCACTGGATTTTCTGCGTTATGTTCTG S283M-F GCAGCACTGGATTTTATGCGTTATGTTCTG S283-R AAAATCCAGTGCTGCCTGTGCTTCACGATC C289R-F CGTTATGTTCTGGAACGCCATAAACATAGC C289H-F CGTTATGTTCTGGAACATCATAAACATAGC C289K-F CGTTATGTTCTGGAAAAACATAAACATAGC C289-R TTCCAGAACATAACGGCTAAAATCCAGTGC
[0051] The site-directed mutagenesis process is as follows:
[0052] Site-directed mutagenesis of the target gene was achieved through PCR. The construction of the PCR system and the setting of the PCR instrument program are shown in Tables 2 and 3.
[0053] Table 2: Site-Directed Mutagenesis PCR System (50 μL)
[0054] PCR Reactants Volume (μL) 2×PCR Buffer 25 dNTP(10 mM) 1 Primer F 1 Primer R 1 Template DNA 1 Phanta DNA Polymerase 1 <![CDATA[ddH2O]]> 20
[0055] Table 3: Fixed-point mutation PCR reaction program
[0056]
[0057] After PCR, use agarose nucleic acid electrophoresis to detect the PCR products, and observe the electrophoresis bands using a multi-functional imager. Detect whether the bands of the PCR products are consistent with the target gene. If the band sizes are consistent, add Dpn I enzyme to the PCR products for digestion to eliminate the original template. The Dpn I enzyme digestion system is shown in Table 4.
[0058] Table 4: Dpn I enzyme digestion system
[0059] System Volume (μL) Dpn I Enzyme 0.5 Buffer 1 PCR Product 20
[0060] Place the PCR products containing Dpn I enzyme at 37 °C for 30 min of digestion, and then transform 10 μL of the mutant products into competent cells E. coli DH5α. Take 10 μL of the PCR products and add them to 100 μL of ice-bathed E. coli DH5α cell suspension. Let it stand on ice for 30 min, heat shock the transformation products at 42 °C for 60 s, quickly place them on ice for cooling for 5 min, add 600 μL of LB liquid medium to the tube, and culture at 37 °C and 150 r / min for 60 min. Centrifuge at 4000 r / min for 1 min, discard 400 μL of the supernatant and resuspend the bacterial solution. Take 200 μL of the above resuspended solution and spread it on an LB solid medium plate containing kanamycin resistance at a final concentration of 50 μg / mL. After the bacterial solution is completely absorbed by the medium, incubate it upside down at 37 °C for 12 h. Pick colonies and inoculate them into 10 mL of LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / mL, and culture at 37 °C for 12 h to obtain their respective bacterial solutions. Send the bacterial solutions to a sequencing company to detect the nucleotide sequences, and if the sequencing results are correctly aligned, they are recombinant bacteria containing mutant enzymes:
[0061] E. coli DH5α / pET28b / CcDAE / Q277L, E. coli DH5α / pET28b / CcDAE / A278L,
[0062] E. coli DH5α / pET28b / CcDAE / A278M, E. coli DH5α / pET28b / CcDAE / A278F,
[0063] E. coli DH5α / pET28b / CcDAE / D281A, E. coli DH5α / pET28b / CcDAE / D281G,
[0064] E.coli DH5α / pET28b / CcDAE / D281I, E.coli DH5α / pET28b / CcDAE / D281H,
[0065] E.coli DH5α / pET28b / CcDAE / D281R, E.coli DH5α / pET28b / CcDAE / S283L,
[0066] E.coli DH5α / pET28b / CcDAE / S283M, E.coli DH5α / pET28b / CcDAE / C289R,
[0067] E.coli DH5α / pET28b / CcDAE / C289H, E.coli DH5α / pET28b / CcDAE / C289K.
[0068] For the recombinant bacteria with successful sequencing, extract the plasmids. Take 1 μL of the plasmid and add it to 100 μL of the ice-bathed E.coli BL21(DE3) competent cell suspension. Let it stand on ice for 30 min. Heat shock the transformation product at 42 °C for 90 s, and quickly place it on ice to cool for 5 min. Add 600 μL of LB liquid medium to the tube, culture it at 37 °C and 150 r / min for 60 min, centrifuge at 4000 r / min for 1 min, discard 400 μL of the supernatant and resuspend the bacterial liquid. Take 200 μL of the above resuspended liquid and spread it on an LB solid medium plate containing kanamycin at a final concentration of 50 μg / mL. After the bacterial liquid is completely absorbed by the medium, culture it inverted at 37 °C for 12 h. Pick colonies and inoculate them into 10 mL of LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and culture at 37 °C for 12 h to obtain their respective bacterial liquids. These are the recombinant bacteria containing mutant enzymes. Respectively pipette 700 μL of the bacterial liquid and 700 μL of 50% glycerol into a glycerol tube, mix well, and store at -80 °C.
[0069] Transform the obtained recombinant expression plasmid pET28a / CcDAE into the E.coli BL21(DE3) recipient bacteria, spread them on an LB agar plate containing kanamycin at a final concentration of 100 mM, and culture at 37 °C for 12 h. Then randomly pick clones from the colonies grown on the plate and extract the plasmids respectively for agarose gel electrophoresis identification and nucleotide sequence determination to obtain the genetically engineered bacteria containing the mutated Cc gene, which are the recombinant bacteria containing mutant enzymes. At the same time, use the expression plasmid inserted with the original gene as a control to construct E.coliBL21(DE3) / pET28a / CcDAE.
[0070] The above-mentioned genetically engineered bacteria were separately inoculated into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, cultured at 37 °C and 150 r / min for 8 h to obtain seed solutions; the seed solutions were inoculated into fresh LB liquid medium containing kanamycin at a final concentration of 50 μg / mL at an inoculation amount of 2% (v / v), cultured at 37 °C and 150 r / min until the OD600 reached 0.6 - 0.8, then IPTG at a final concentration of 1 mM was added to the culture solution, induced for expression at 28 °C for 12 h, centrifuged at 4 °C and 8000 r / min for 10 min, the supernatant was discarded, and the wet bacterial cells were collected for standby.
[0071] Example 2: Enzyme activity determination of C-terminal mutants of CcDAEase sequence
[0072] Reaction system: 50 mM HEPES buffer (pH 7.0), 50 g / L fructose and 20 g / L wet bacterial cells, with a total system volume of 1 mL. Reaction conditions: React with hot compress at 70 °C for 15 min, react at 55 °C for 5 min, and terminate the reaction by boiling for 10 min. The reaction solution was taken and the content of D-allulose was detected by HPLC. The resolution and retention time of each substance in the liquid phase detection of the mixed standard samples of fructose and D-allulose are as Figure 2 shown.
[0073] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractive index detector, column oven at 80 °C, mobile phase is ultrapure water, flow rate is 0.4 mL / min. Definition of enzyme activity (U): Under standard reaction conditions, the amount of enzyme required to catalyze the synthesis of 1 μmol D-allulose per unit time (min). The residual enzyme activities of 14 screened mutants were compared with the original enzyme as Figure 3 shown.
[0074] From Figure 3 the results, it can be seen that the modification of sites 281 and 289 is very helpful for improving thermal stability. After incubation at 70 °C for 15 min, the residual enzyme activities of D281G and C289R are 9.63 times and 12.49 times that of the wild type, respectively. Compared with the wild type, the residual enzyme activities of other mutants D281A, D281I, D281H, D281R, C289H and C289K are increased by 4.99 times, 3.25 times, 4.04 times, 6.04 times, 6.06 times and 5.78 times, respectively, and the residual enzyme activities are all lower than those of mutants D281G and C289R. The residual enzyme activities of mutants at other mutation sites are all lower than that of the wild type after incubation.
[0075] Example 3: Site-directed saturation mutagenesis of position C289 in the D-allulose 3-epimerase sequence
[0076] According to Figure 3 it can be seen that the C289 site has the greatest improvement in stability. Therefore, site-directed saturation mutagenesis was performed on this site, and this point was mutated into the other 19 kinds of amino acids.
[0077] Mutation primers for site-directed mutagenesis were designed according to the gene sequence of the original enzyme CcDAE. Using the rapid PCR technique, with the recombinant vector pET28a / CcDAE as the template, single mutations were introduced at the C289 site respectively. The process of site-directed mutagenesis was the same as that in Example 1, and the primer list is shown in Table 5.
[0078] Table 5: Primer list for site-directed saturation mutagenesis at C289
[0079] Primer Name Primer Sequence C289A-F CGTTATGTTCTGGAAGCGCATAAACATAGC C289D-F CGTTATGTTCTGGAAGATCATAAACATAGC C289E-F CGTTATGTTCTGGAAGAACATAAACATAGC C289F-F CGTTATGTTCTGGAATTTCATAAACATAGC C289G-F CGTTATGTTCTGGAAGGCCATAAACATAGC C289H-F CGTTATGTTCTGGAACATCATAAACATAGC C289I-F CGTTATGTTCTGGAAATTCATAAACATAGC C289K-F CGTTATGTTCTGGAAAAACATAAACATAGC C289L-F CGTTATGTTCTGGAACTGCATAAACATAGC C289M-F CGTTATGTTCTGGAAATGCATAAACATAGC C289N-F CGTTATGTTCTGGAAAACCATAAACATAGC C289P-F CGTTATGTTCTGGAACCGCATAAACATAGC C289Q-F CGTTATGTTCTGGAAGAGCATAAACATAGC C289R-F CGTTATGTTCTGGAACGCCATAAACATAGC C289S-F CGTTATGTTCTGGAAAGCCATAAACATAGC C289T-F CGTTATGTTCTGGAAACCCATAAACATAGC C289V-F CGTTATGTTCTGGAAGTGCATAAACATAGC C289W-F CGTTATGTTCTGGAATGGCATAAACATAGC C289Y-F CGTTATGTTCTGGAATATCATAAACATAGC C289-R TTCCAGAACATAACGGCTAAAATCCAGTGC
[0080] Example 4: Determination of enzyme activity of C289 saturated mutants
[0081] Reaction system: 50 mM HEPES buffer (pH 7.0), 50 g / L fructose and 20 g / L wet bacterial cells, a total of 1 mL system. Reaction conditions: React with hot compress at 70 °C for 15 min, react at 55 °C for 5 min, and terminate the reaction by boiling for 10 min. Take the reaction solution and detect the content of D-allulose by HPLC.
[0082] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractive index detector, column oven at 80 °C, mobile phase ultrapure water, flow rate 0.4 mL / min. Definition of enzyme activity (U): Under standard reaction conditions, the amount of enzyme required to catalyze the synthesis of 1 μmol D-allulose per unit time (min). The comparison of residual enzyme activity with the original enzyme is as Figure 4 shown.
[0083] From Figure 4 the results, it can be seen that the relative residual enzyme activity of the mutant C289R is the highest, which is 12.49 times that of the wild type. The protease terminal of CcDAEase has more negative charges. Mutating C289 into a positively charged amino acid greatly improves the stability of the amino acid, while mutating into a negatively charged amino acid does not improve the stability and even brings side effects.
[0084] Example 5: Software analysis to find mutation sites and determination of enzyme activity
[0085] Online software such as Hotspot wizard 3.0, Fireprot v2.0, and DeepDDG were used to predict the stability mutation sites of CcDAEase. Finally, 14 key sites were obtained and mutated into the following amino acids: S38F, D45N, C54T, A70P, A85G, T90Q, K1118E, T119C, C143M, G166A, N176P, L208F, S255W, Q277R. The site-directed mutagenesis procedure was the same as in Example 1, and the primer list is shown in Table 6.
[0086] Table 6: Primer List
[0087] Primer Name Sequence (5’—3’) S38F-F CTGGAAATTGCAGCATTTCCGCTGCCGTTT S38F-R TGCTGCAATTTCCAGAATATCAAAACCCAG D45N-F CTGCCGTTTTATAGCAACATTCAGATCAAT D45N-R GCTATAAAACGGCAGCGGGCTTGCTGCAAT C54T-F AATGAACTGAAAGCAACCGCACATGGTAAC C54T-R TGCTTTCAGTTCATTGATCTGAATATCGCT A70P-F GGTCATGGTCCGTCTCCGGAACAGAATCTG A70P-R AGACGGACCATGACCCACGGTCAGGGTAAT A85G-F GATATTCGTAAAAATGGCAAAGCATTTTAT A85G-R ATTTTTACGAATATCCGGATCCGGACTACT T90Q-F GCAAAAGCATTTTATCAGGATCTGCTGAAA T90Q-R ATAAAATGCTTTTGCATTTTTACGAATATC K118E-F CCTATTGATTATACCGAAACCATTGATAAA K118E-R GGTATAATCAATAGGCCAATAGCTATACAG T119C-F ATTGATTATACCAAATGCATTGATAAAAAG C143M-F AAAGTTGCGGAAGCAATGGGTGTTGATTTT C143M-R TGCTTCCGCAACTTTCGCAACTTCACGCAC G166A-F AACACCGCGCAGGAAGCGGTGGATTTTGTT G166A-R TTCCTGCGCGGTGTTAATCAGATAATTTTC N176P-F AAACAGGTAGATCATCCGAACGTGAAAGTG N176P-R ATGATCTACCTGTTTAACAAAATCCACACC L208F-F AGCTATCTGGGTCATTTTCATACAGGTGAA L208F-R ATGACCCAGATAGCTACCTGCTGTGCGAAT S255W-F GGTGGTACCGTTGGTTGGAATATTAAAGTT S255W-R ACCAACGGTACCACCCATACGAACAAACGG Q277R-F CTGGATCGTGAAGCACGCGCAGCACTGGAT Q277R-R TGCTTCACGATCCAGCATTTTTTCATCTGC
[0088] The method for measuring enzyme activity was as described in Example 4, and the results are as Figure 5 shown. The relative residual enzyme activity of the mutant Q277R was the highest, far superior to that of the wild type.
[0089] Example 6: Sequence alignment, mutation site screening, site-directed mutagenesis, and enzyme activity measurement of D-allulose 3-epimerase from different sources
[0090] To improve the thermal stability of CcDAEase, homologous genes with high thermal stability were found through literature review for sequence alignment. The detailed information of the selected homologous genes is shown in Table 7.
[0091] Table 7: Information on High-Stability DAEases
[0092]
[0093] By aligning the amino acid sequence of CcDAEase with the amino acid sequences of Uncultured bacterium DAEase, Staphylococcus aureus DAEase, Labedella endophytica DAEase, and Mesorhizobium japonicum DAEase, homologous mutation sites with high homology were found. The sequence alignment results are as Figure 6As shown, KEases from different sources have sequence diversity but relatively high conservation, with high conservation at sites such as 29 - 34, 150 - 163, 183 - 191, and 209 - 221. Among them, the three amino acid residues E156, H186, and R215 that interact with the O - 1, O - 2, and O - 3 positions of d - fructose form a catalytic triad. The following mutants were obtained through sequence alignment: H3I, Y18I, L28A, A37L, Q47D, P68L, N72D, Y89L, D100G, A107V, L152V, F155Y, T210I, C213S, M248S, V253I, D262N, I263L, A278I.
[0094] Site - directed mutagenesis was carried out by PCR, and the process of site - directed mutagenesis was the same as that in Example 1. The selected mutation sites and primer design list are shown in Table 8 in the appendix.
[0095] Table 8: Primer List
[0096] Primer Name Sequence (5’—3’) H3I-F TATACCGCAATGAAAATTGGTATTTATTAT H3I-R TTTCATTGCGGTATATCTCCTTCTTAAAGT Y18I-F GAATGGGAAGCAGATATTAAATATTATATC Y18I-R ATCTGCTTCCCATTCCTGTTCCCAATAGGC L28A-F GAAAAAGTGGCAAAAGCGGGTTTTGATATT L28A-R TTTTGCCACTTTTTCGATATAATATTTAT A37L-F ATTCTGGAAATTGCACTGAGCCCGCTGCCG A37L-R TGCAATTTCCAGAATATCAAAACCCAGTTT Q47D-F TTTTATAGCGATATTGATATCAATGAACTG Q47D-R AATATCGCTATAAAACGGCAGCGGGCTTGC P68L-F ACCGTGGGTCATGGTCTGTCTGCGGAACAG P68L-R ACCATGACCCACGGTCAGGGTAATACCGTT N73D-F CCGTCTGCGGAACAGGATCTGAGTAGTCCG N73D-R CTGTTCCGCAGACGGACCATGACCCACGGT Y89L-F AATGCAAAAGCATTTCTGACCGATCTGCTG Y89L-R AAATGCTTTTGCATTTTTACGAATATCCGG D100G-F CGCCTGTATAAACTGGGCGTTCATCTGATT D100G-R CAGTTTATACAGGCGTTTCAGCAGATCGGT A107V-F CATCTGATTGGTGGTGTGCTGTATAGCTAT A107V-R ACCACCAATCAGATGAACATCCAGTTTATA L152V-F TTTTGTCTGGAAGTGGTGAACCGTTTTGAA L152V-R CACTTCCAGACAAAAATCAACACCACATGC F155Y-F GAAGTGCTGAACCGTTATGAAAATTATCTG F155Y-R ACGGTTCAGCACTTCCAGACAAAAATCAAC T210I-F CTGGGTCATCTGCATATTGGTGAATGTAAC T210I-R ATGCAGATGACCCAGATAGCTACCTGCTGT C213S-F CTGCATACAGGTGAAAGCAACCGTAAAGTT C213S-R TTCACCTGTATGCAGATGACCCAGATAGCT M249S-F GAACCGTTTGTTCGTAGCGGTGGTACCGTT M249S-R ACGAACAAACGGTTCCATAACAACGCTGCC V253I-F CGTATGGGTGGTACCATTGGTAGCAATATT V253I-R GGTACCACCCATACGAACAAACGGTTCCAT D262N-F ATTAAAGTTTGGCGTAACATTAGTAACGGT D262N-R ACGCCAAACTTTAATATTGCTACCAACGGT I263L-F AAAGTTTGGCGTGATCTGAGTAACGGTGCA I263L-R ATCACGCCAAACTTTAATATTGCTACCAAC A278I-F GATCGTGAAGCACAGATTGCACTGGATTTT A278I-R CTGTGCTTCACGATCCAGCATTTTTTCATC
[0097] According to the site - directed mutagenesis by PCR reaction, agarose nucleic acid electrophoresis was used to verify the PCR products. Bands were observed for all 19 mutation sites selected through sequence alignment, and the band sizes were consistent with the theoretical values. The PCR products with correct bands were transformed, and after connecting to test tubes, the bacteria were shaken and sent for sequencing. The mutants with successful sequencing were induced to harvest bacteria, and the wet bacterial cells were obtained for the bioconversion production of d - allulose. After incubating the mutant bacteria at 70 °C for 15 min, the reaction was carried out for 5 min under the optimal reaction conditions, and then inactivated by boiling. The residual enzyme activity of the mutants was measured by HPLC, and the results are as Figure 7 shown. The mutants with increased relative residual enzyme activity were F155Y and V253I. Compared with the wild - type, the residual enzyme activity increased by 2.3 - fold and 1.24 - fold respectively. Among them, the residual enzyme activity of the mutant A37L did not change significantly before and after mutation. Compared with the wild - type, the residual enzyme activities of the mutants at other mutation sites decreased, especially for the mutants P68L, C213S, M249S, and D262N, and the residual enzyme activities were lower than 10% of the wild - type.
[0098] Example 7: Dominant Mutant t 1 / 2 Measurement Results
[0099] The ones constructed in Example 6:
[0100] E. coli BL21(DE3) / pET28a / CcDAE / F155Y, E. coli BL21(DE3) / pET28a / CcDAE / V253I;
[0101] E. coli BL21(DE3) / pET28a / CcDAE / Q277R constructed in Example 5;
[0102] Constructed in Example 1:
[0103] E. coli BL21(DE3) / pET28a / CcDAE / D281 and E. coli BL21(DE3) / pET28a / CcDAE / C289R were streaked on LB solid medium and cultured inverted at 37 °C for 12 h. Single colonies were picked and inoculated into 10 mL of LB liquid medium and cultured at 37 °C for 8 h. Then, they were transferred to 100 mL of LB medium at a transfer volume of 2% (v / v) and cultured at 37 °C and 150 r / min until OD600 = 0.6 - 0.8. IPTG was added at a final concentration of 0.1 mM for induction expression. Induction was carried out at 28 °C and 150 r / min for 12 h, and the supernatant was discarded by centrifugation to collect the cells.
[0104] Reaction system: 50 mM HEPES buffer (pH 7.0), 50 g / L fructose, and 20 g / L wet cells, with a total volume of 1 mL. Reaction conditions: Incubate the wild-type and dominant mutants at 70 °C, sample at certain time intervals, react for 10 min under optimal conditions, and terminate the reaction by boiling for 10 min. The reaction solution was taken for HPLC detection of the D - allulose content.
[0105] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher refractive index detector, column oven at 80 °C, mobile phase of ultrapure water, and flow rate of 0.4 mL / min. Enzyme activity definition (U): Under standard reaction conditions, the amount of enzyme required to catalyze the synthesis of 1 μmol of D - allulose per unit time (min). Mutant t 1 / 2 Compared with the original enzyme as Figure 8 shown.
[0106] From Figure 8 it can be seen that compared with the wild-type, the half-lives of the dominant mutants have all increased. The half-lives of F155Y, V253I, Q277R, D281G, and C289R are 104.22 min, 38.51 min, 40.05 min, 128.12 min, and 101.47 min, respectively, which are 7.18 times, 2.62 times, 2.76 times, 8.83 times, and 6.99 times higher than that of the wild-type.
[0107] Example 8: Study on multi-point combinatorial mutation
[0108] Through the study of the half-life of the dominant mutants in Example 7, 155Y, D281G, and C289R have better half-lives. The above dominant mutants were subjected to combined mutagenesis to construct multi-point combined mutant strains:
[0109] E.coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G,
[0110] E.coliBL21(DE3) / pET28a / CcDAE / F155Y / C289R,
[0111] E.coliBL21(DE3) / pET28a / CcDAE / D281G / C289R,
[0112] E.coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R.
[0113] Reaction system: 50 mM HEPES buffer (pH 7.0), 50 g / L fructose, and 20 g / L wet bacterial cells, with a total volume of 1 mL. Reaction conditions: Incubate the wild type and dominant mutants at 70 °C, sample at certain time intervals, react for 10 min under optimal conditions, and terminate the reaction by boiling for 10 min. Take the reaction solution and detect the D-allulose content by HPLC.
[0114] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractive index detector, column oven at 80 °C, mobile phase ultrapure water, flow rate 0.4 mL / min. Definition of enzyme activity (U): Under standard reaction conditions, the amount of enzyme required to catalyze the synthesis of 1 μmol of D-allulose per unit time (min). Mutant t 1 / 2 Compared with the original enzyme Figure 9 as shown.
[0115] From Figure 9 it can be seen that compared with the wild type, the half-lives of the combined mutants F155Y / D281G, F155Y / C289R, D281G / C289R, and F155Y / D281G / C289R are 207.61 min, 182.11 min, 192.34 min, and 255.35 min, respectively, which are 14.31-fold, 12.55-fold, 13.25-fold, and 17.60-fold higher than that of the wild type.
[0116] Example 9: Exploration of the enzymatic properties of F155Y / D281G / C289R
[0117] For the obtained optimal combined mutant strain E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R, the optimal reaction pH of the enzyme was determined. The reaction system was pH 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 (sodium acetate buffer, sodium phosphate buffer, Tris-HCl buffer), 50 g / L fructose and 20 g / L wet cells, with a total volume of 1 mL. The reaction was carried out at 55 °C for 5 min and terminated by boiling for 10 min. The reaction solution was taken and the D-allulose content was detected by HPLC.
[0118] HPLC detection conditions: Thermo Fisher (model) HPLC, Waters Sugar-Pak I sugar column, Thermo Fisher differential refractive index detector, column oven at 80 °C, mobile phase ultra-pure water, flow rate 0.4 mL / min. Enzyme activity definition (U): Under standard reaction conditions, the amount of enzyme required to catalyze the synthesis of 1 μmol D-allulose per unit time (min). The effect of pH on the enzyme activity of the mutant is as Figure 10 shown. As Figure 10 can be seen, the optimal reaction pH of the mutant is 7.0.
[0119] The optimal reaction temperature of the mutant E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R was determined. At pH 7.0, the reaction was carried out at different temperatures (40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 °C) for 5 min, and other conditions were the same as above. The results are shown in Figure 11 . As can be seen from the figure, the optimal reaction temperature of the mutant enzyme F155Y / D281G / C289R is 60 °C.
[0120] The effect of metal ions on the enzyme activity of the mutant E. coli BL21(DE3) / pET28a / CcDAE / F155Y / D281G / C289R was determined. Different metal ions were added (EDTA2 + , Co 2+ , Mg 2+ , Cu 2+ , Ca 2+ , Fe 3+ , Fe 2+ , Ni 2+ , Zn 2+ ), and the reaction was carried out at pH 7.0 and 60 °C for 5 min. Other conditions were the same as above. The results are shown in Figure 12 shown. As can be seen from the figure, the optimal metal ion for the mutant is Co 2+ .
[0121] Purified recombinant enzyme:
[0122] Purification was carried out using a nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC pre-packed column, 40 mm long × 12.6 mm inner diameter). First, the chromatography column was equilibrated with the equilibration buffer (20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0). The sample loading solution was loaded at a rate of 1 mL / min for 20 mL (4 column volumes). Then, the elution buffer (50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) was used to elute at a rate of 1 mL / min. According to the signal responses of the ultraviolet detector and the conductivity detector, the corresponding elution fractions were collected when the signals of both the ultraviolet detector and the conductivity detector increased simultaneously, and the collection was stopped when the signal of the conductivity detector remained unchanged and the signal of the ultraviolet detector decreased, obtaining the respective pure enzyme solutions. The protein concentrations of the pure enzyme solutions were measured using a BCA kit.
[0123] Example 10: Determination of the Tm value of the mutant E. coli BL21(DE_{3}) / pET28a / CcDAE / F155Y / D281G / C289R.
[0124] The difference in the Tm values between the mutant and the original enzyme was analyzed and compared by circular dichroism spectroscopy. The results are as Figure 13 shown. It can be seen from the figure that the Tm value of the mutant is 73.23 °C, which is 11.98 °C higher than that of the original enzyme (wild type).
[0125] Example 11: Reaction process of the mutant E. coli BL21(DE_{3}) / pET28a / CcDAE / F155Y / D281G / C289R catalyzing the production of D-allulose.
[0126] Reaction system: 50 mM HEPES buffer (pH 7.0), 300 g / L D-fructose as the substrate, 0.3 g / L of the pure enzyme was added, and 1 mmol / L Co 2+ , with a total volume of 1 mL. The reaction was carried out at 60 °C for 350 min. Samples were taken at certain time points, and the reaction was terminated by boiling for 10 min. The content of D-allulose in the reaction solution was detected by HPLC.
[0127] The HPLC detection conditions were the same as those in Example 8. The results are as Figure 14 shown. It can be seen from the figure that the equilibrium conversion rate of the mutant is 33.33%, which is 4.29% higher than that of the wild type, and 300 g / L D-fructose was catalyzed to produce 99.99 g / L D-allulose.
Claims
1. A D-psicose 3-epimerase mutant, characterized in that, The D-allulose 3-epimerase mutant is a combined mutant in which, relative to the amino acid sequence SEQ ID NO.1 of wild-type D-allulose 3-epimerase, only the phenylalanine at position 155 is mutated to tyrosine, the aspartic acid at position 281 is mutated to glycine, and the cysteine at position 289 is mutated to arginine.
2. A gene encoding the D-allulose 3-epimerase mutant according to claim 1.
3. A recombinant vector containing the gene according to claim 2.
4. A genetically engineered bacterium into which the recombinant vector according to claim 3 has been introduced.
5. Use of the D-allulose 3-epimerase mutant according to claim 1 in the preparation of D-allulose.
6. The application according to claim 5, characterized in that, Using D-fructose as a substrate and the D-allulose 3-epimerase mutant according to claim 1 or 2 as a catalyst, a catalytic reaction is carried out in a buffer solution to prepare D-allulose.
7. The application according to claim 6, characterized in that The forms of addition of the catalyst include: wet cells of a genetically engineered bacterium containing the D-allulose 3-epimerase mutant, and pure enzyme extracted by ultrasonic disruption of wet cells of the genetically engineered bacterium of the D-allulose 3-epimerase mutant.
8. The application according to claim 7, wherein The final concentration of the D-fructose is 100 - 500 g / L, the amount of the catalyst added in the form of wet cells is 40 - 60 g / L; the amount of the catalyst added in the form of pure enzyme is 0.2 - 0.5 g / L in terms of protein content.
9. The application according to claim 8, characterized in that, The temperature of the catalytic reaction is 50 - 80 °C; the pH of the catalytic reaction is 6.0 - 8.0.
Citation Information
Patent Citations
Improved variant of d-psicose 3-epimerase and uses thereof
CN105637089A
High-temperature-resistant D-psicose 3-epimerase, mutant and application thereof
CN110904088A