Screening method and application of aptamer

Abstract

The invention relates to the technical field of biological medicine, in particular to a screening method of cell specificity and killing aptamers, the aptamers obtained through screening and application of the aptamers. The aptamer which specifically binds and / or specifically kills the target cells is directly and efficiently screened through CS-SELEX and CT-SELEX steps, and the aptamer obtained through screening has the functions of promoting target cell apoptosis, inhibiting target cell growth, invasion and migration and / or inflammatory factor generation and the like and can be used for preventing and / or treating target cell related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and to a method for screening aptamers and applications thereof, and more specifically, to a method for screening cell-specific and lethal aptamers, an aptamer for targeted degradation of NCL and applications thereof. Background Art

[0002] Drugs with cell-killing activity, also known as cytotoxic drugs, are currently the main treatment for many diseases. For example, chemotherapy drugs in tumor treatment exert anti-tumor effects by affecting biological events such as cell DNA replication, transcription, and microtubule stability that are critical to cell proliferation and survival; antibiotics in the treatment of infectious diseases kill and eliminate harmful bacteria that infect the body by inhibiting the synthesis of bacterial cell walls, interacting with cell membranes, interfering with protein synthesis, and inhibiting the replication and transcription of nucleic acids; immune-blocking drugs in the treatment of autoimmune diseases relieve inflammation by inhibiting the proliferation and growth of immune-related cells. However, these drugs are generally small molecule drugs and have no cell targeting. The target molecules they intervene in are usually also critical to normal cells, especially rapidly dividing normal cells (such as small intestinal epithelial cells, bone marrow stem cells and hair follicle cells, and intestinal flora, etc.). This also determines that these drugs inevitably produce toxic side effects, such as hepatotoxicity, gastrointestinal toxicity, blood system toxicity, hair loss, dysbacteriosis, etc. Therefore, it is necessary to screen for killer drugs that can target specific disease cells, reduce toxic side effects on normal cells, and achieve targeted treatment of diseases.

[0003] Aptamers usually refer to oligonucleotide sequences (ssDNA or RNA) obtained by in vitro screening using the systematic evolution of ligands by exponential enrichment (SELEX) technique, which can bind to the target with high affinity and high specificity. Aptamers form stable secondary structures such as pseudoknots, hairpins, convex loops, and G-quadruplexes through intramolecular base pairing, giving them a specific molecular conformation. Aptamers are similar to antibodies and are called "chemical antibodies." However, compared with traditional antibodies, aptamers have a larger target range, including small molecules such as amino acids and metal ions, as well as biological macromolecules such as growth factors and enzymes, and even complete bacteria and cells. In addition, aptamers have unique advantages, including small size, low cost, high stability, and low immunogenicity. Based on these characteristics, aptamers are widely used in biomarker discovery, cell recognition and sorting, biosensing, bioimaging, disease diagnosis, and targeted drug delivery. In addition, aptamers themselves can also be used as new drugs to directly target diseases and reduce toxic side effects.

[0004] SELEX targeting intact living cells is called Cell-SELEX. This strategy uses the interaction between living cell surface molecules and single-stranded oligonucleotides to screen aptamers. However, the screening strategy of Cell-SELEX only considers the specificity of aptamer binding to target cells, so the aptamers screened are aptamers that specifically bind to target cells. However, it is difficult for Cell-SELEX to directly and efficiently screen aptamers that specifically kill target cells. Summary of the invention

[0005] The first object of the present invention is to provide a method for screening aptamers (cell-specific and cytotoxic SELEX, CSCT-SELEX), wherein the aptamers bind to and / or kill target cells, preferably specifically bind to and / or specifically kill target cells;

[0006] The screening method comprises:

[0007] CS-SELEX: random sequences are co-incubated with target cells to obtain a binding sequence enrichment library with peak binding ability to target cells;

[0008] CT-SELEX: The binding sequence enrichment library obtained by CS-SELEX is co-incubated with target cells, apoptotic cells are separated after incubation, and sequences that bind to and enter the apoptotic cells are eluted.

[0009] Preferably, the CT-SELEX further comprises amplifying and isolating the obtained sequences that bind to and enter the apoptotic cells to obtain an enriched induced single-stranded library.

[0010] In a specific embodiment of the present invention, the CT-SELEX comprises:

[0011] i) co-incubating the binding sequence enriched library obtained by CS-SELEX with target cells, separating apoptotic cells after incubation, and eluting the sequences that bind to and enter the apoptotic cells;

[0012] ii) amplifying and separating the obtained sequences that bind to and enter the apoptotic cells to obtain an enriched induced single-stranded library;

[0013] iii) using the enriched induced single-strand library as a binding sequence enriched library to repeat steps i) and ii) for at least one round, preferably 2-20 rounds; until the sequence screened out with a peak ability to induce cell apoptosis is the aptamer.

[0014] Preferably, the separation of apoptotic cells comprises sorting apoptotic cells using magnetic beads, preferably using annexin-V based magnetic beads.

[0015] Preferably, the elution sequence that binds to and enters the apoptotic cells comprises resuspending the apoptotic cells, then heating them and placing them on ice, and taking the supernatant (preferably taking the supernatant after centrifugation);

[0016] Preferably, the mixture is heated at 80-100°C (e.g., 80, 85, 90, 95 or 100°C) for 3-10 minutes (e.g., 3, 4, 5, 6, 7, 8, 9 or 10), placed on ice for 5-20 minutes (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 minutes), and the supernatant is taken (preferably the supernatant is taken after centrifugation).

[0017] Preferably, the CS-SELEX comprises co-incubating the random sequences with the target cells, obtaining the sequences binding to the target cells by positive screening, and preferably, the positive screening is repeated for 1-20 rounds; preferably, the CS-SELEX further comprises removing the sequences binding to the non-target cells by negative screening of the sequences binding to the target cells, and preferably, the negative screening is repeated for 1-20 rounds;

[0018] Further preferably, negative screening is performed after 1-20 rounds of positive screening, and then this step is repeated at least once, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times.

[0019] Specifically, the screening method comprises the following steps:

[0020] CS-SELEX screening is used to obtain an enriched library whose binding ability to target cells reaches a peak value, and the steps are as follows: in vitro chemical synthesis of a single-stranded oligonucleotide library; mixing the single-stranded oligonucleotide library with target cells, washing away nucleic acid sequences that do not bind to the target cells after incubation, separating nucleic acid sequences that bind to the target cells, amplifying, and separating single strands to obtain a positive screening enriched library; in order to ensure screening specificity, negative screening is introduced in the screening process, that is, the positive screening enriched library is incubated with non-target cells (control cells) and sequences that do not bind to non-target cells (control cells) are separated to obtain a negative screening enriched library, the negative screening enriched library is then positively screened, and negative screening and positive screening are repeated until an enriched library whose binding ability to the target cells reaches a peak value and is not bound to the non-target cells (control cells) is selected for screening of cell-killing aptamers in CT-SELEX.

[0021] The target cell killing aptamer is obtained by CT-SELEX screening, and the steps are as follows: adding the single-chain enriched library obtained by CS-SELEX screening during the target cell culture process, separating apoptotic cells after incubation, eluting the sequences that bind to the apoptotic cells and enter the apoptotic cells, separating the single chains after amplification, and detecting the ability of the single-chain enriched library with different screening rounds to induce apoptosis of target cells and non-target cells after repeated screening, until the ability of the single-chain enriched library obtained by screening to induce apoptosis of target cells reaches a peak and does not induce apoptosis of non-target cells, sequencing the sequence of the enriched library to obtain the killing aptamer of the target cell.

[0022] Preferably, the random sequence comprises 20 to 60, preferably 30 to 40 random DNA oligonucleotides, such as 20, 25, 30, 35, 40, 45, 50, 55 or 60 random oligonucleotides, wherein the random oligonucleotides are any one of A, T, C, G or U.

[0023] Preferably, the target cells include activated synovial fibroblasts, immune cells or tumor cells.

[0024] Preferably, the immune cells include one or more of lymphocytes, dendritic cells, monocytes / macrophages, granulocytes or mast cells, and the lymphocytes preferably include T cells, B cells and / or NK cells.

[0025] Preferably, the tumor includes lymphoma (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as one or more of lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer , gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

[0026] In a specific embodiment of the present invention, the screening method comprises the following steps:

[0027] S1, synthesizing an initial random single-stranded DNA library, a forward primer and a reverse primer, preferably the forward primer includes the sequence shown in SEQ ID NO: 4, preferably the reverse primer includes the sequence shown in SEQ ID NO: 5; preferably, the initial random single-stranded DNA library includes a random sequence, a forward primer sequence and a reverse complementary sequence of the reverse primer, and further preferably, the sequence of the initial random single-stranded DNA library includes SEQ ID NO: 3;

[0028] SEQ ID NO: 3: 5'-TGAGAATATGTAGACGATCC-(N)-CGGAGCTTCAAGATGATCTG-3', wherein N is a random sequence, and the random sequence comprises 20 to 60, preferably 30 to 40 random DNA oligonucleotides;

[0029] SEQ ID NO: 4: 5'-TGAGAATATGTAGACGATCC-3';

[0030] SEQ ID NO: 5'-CAGATCATCTTGAAGCTCCG-3';

[0031] S2. Determine target cells and non-target cells:

[0032] Preferably, activated synovial fibroblasts are selected as target cells, and non-synovial fibroblasts are selected as non-target cells;

[0033] Preferably, tumor cells are selected as target cells, and non-tumor cells are selected as non-target cells;

[0034] Preferably, immune cells are selected as target cells and non-immune cells are selected as non-target cells.

[0035] S3, after incubating the initial random single-stranded DNA library and the target cells, washing, resuspending, eluting the sequences bound to the target cells and taking the supernatant (preferably centrifuging to take the supernatant), preferably the elution comprises heating at 80-100° C., such as 80, 85, 90, 95 or 100° C., for 3-10 minutes, such as 3, 4, 5, 6, 7, 8, 9 or 10 minutes, and then placing on ice for 5-20 minutes, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 minutes;

[0036] S4, amplifying the supernatant obtained in step S3 with the forward primer and the reverse primer to separate the single-stranded sequence;

[0037] S5. Further repeating steps S3 and S4 for at least 2-5 rounds, for example, 2, 3, 4 or 5 rounds, using the single-stranded sequences obtained in step S4 as the initial random single-stranded DNA library.

[0038] S6. Incubate the obtained single-stranded sequence with non-target cells and take the supernatant (preferably centrifuge to take the supernatant).

[0039] S7, using the supernatant obtained in step S6 as an initial random single-stranded DNA library for sequentially executing steps S3 and S4, and then repeating the order of step S6, step S3, and step S4 until a binding sequence enrichment library is selected whose binding ability with the target cell reaches a peak value (the binding ability no longer increases) and has no binding with the non-target cells;

[0040] S8, incubating the binding sequence enriched library obtained in step S7 with the target cells, separating the apoptotic cells (preferably by magnetic bead sorting, more preferably by annexin-V-based magnetic bead sorting), eluting the sequences bound to and entering the apoptotic cells and taking the supernatant (preferably by centrifugation), preferably the elution comprises heating at 80-100° C., such as 80, 85, 90, 95 or 100° C., for 3-10 minutes, such as 3, 4, 5, 6, 7, 8, 9 or 10 minutes, and then placing on ice for 5-20 minutes, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 minutes;

[0041] S9, amplifying the supernatant obtained in step S8 with the forward primer and the reverse primer and then separating to obtain an enriched induced single-stranded library;

[0042] S10, using the enriched apoptosis-inducing single-strand library as the binding sequence enrichment library to repeat steps S8-S9 until the screened sequence whose ability to induce cell apoptosis reaches a peak (the ability to induce apoptosis no longer increases) is the aptamer.

[0043] Preferably, the screening method further comprises a step of sequencing to determine the aptamer sequence.

[0044] In a specific embodiment of the present invention, in step S2, the target cells are preferably activated synovial fibroblasts, including activated synovial fibroblasts from humans, rats and mice, preferably activated synovial fibroblasts from rheumatoid arthritis patients (RA-FLSs) or activated synovial fibroblasts from osteoarthritis patients (OA-FLSs), and the non-target cells (control cells) are preferably human osteoblast line hFOB1.19 and human monocytic cell line THP-1.

[0045] Preferably, in step S3, 200 pmol to 20 nmol (preferably 1 nmol to 10 nmol, for example 200 pmol, 500 pmol, 800 pmol, 1 nmol, 2 nmol, 3 nmol, 4 nmol, 5 nmol, 6 nmol, 7 nmol, 8 nmol, 9 nmol, 10 nmol, 11 nmol, 12 nmol, 13 nmol, 14 nmol, 15 nmol, 16 nmol, 17 nmol, 18 nmol, 19 nmol or 20 nmol) of the initial random single-stranded DNA library is dissolved in a binding buffer (preferably Dulbecco's phosphate buffered saline (DPBS) containing glucose, MgCl2, tRNA and bovine serum albumin (BSA)), heated at 80 to 100°C for 3 to 10 minutes, and then placed on ice for 5 to 10 minutes for forward screening; the initial random single-stranded DNA library dissolved in the binding buffer is mixed with 1 to 10×10 6 (For example, 1×10 6 , 2×10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 ,7×10 6 , 8×10 6 ,9×10 6 or 10×10 6 )RA-FLSs are incubated at 4-37°C (e.g., 4, 5, 10, 15, 20, 25, 30, 35, 36, 37°C) for 0.5-6 hours (e.g., 0.5, 1, 2, 3, 4, 5 or 6 hours), and after the incubation, the cells are washed 3-5 times (e.g., 3, 4 or 5 times) with a washing buffer (DPBS containing glucose and MgCl2), and the cells are resuspended with DPBS buffer, and the sequences bound to RA-FLSs are eluted by heating at 80-100°C for 3-10 minutes, and the cells are placed on ice for 5-10 minutes, and the supernatant is collected by centrifugation.

[0046] Preferably, in step S4, the enriched single-stranded sequences can be separated from the supernatant obtained in step S3 by magnetic bead method, asymmetric PCR, enzyme digestion method, electrophoresis separation method and a combination of these methods.

[0047] Further preferably, in step S4, the supernatant obtained in step S3 is subjected to PCR amplification using the forward primer and the reverse primer labeled with 5'-end biotin. Preferably, part of the supernatant obtained in step S3 is firstly taken to determine the optimal cycle number for amplification by a cycle number gradient experiment, and then the optimal cycle number is selected to perform PCR amplification on the remaining supernatant; the amplified double-stranded DNA product is incubated with streptavidin magnetic beads at room temperature for 0.1 to 1 hour (for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1 hour), and the biotin present on the double-stranded DNA product is bound to the streptavidin magnetic beads, thereby being fixed on the surface of the magnetic beads; then The magnetic beads are placed on a magnetic rack, and after magnetic liquid separation, the obtained supernatant is removed, and the magnetic beads are washed with DPBS for 3 to 5 times (e.g., 3, 4 or 5 times); in order to separate the single-stranded sequence for the next round of screening, 50 to 200 mM NaOH solution (e.g., 50, 100, 150, 200 mM) is added to the magnetic beads, and the reaction is carried out for 5 to 30 minutes (e.g., 5, 10, 15, 20, 25 or 30 minutes), and the magnetic beads are placed on a magnetic rack. After magnetic liquid separation, a single-stranded DNA with biotin remains on the streptavidin magnetic beads, and a single-stranded DNA without biotin remains in the obtained supernatant, and the supernatant is collected, neutralized with a 1 M acetic acid solution, and added to a desalting column for desalting to obtain a single-stranded sequence.

[0048] Preferably, in step S6, negative screening is introduced, that is, 200 pmol to 10 nmol (preferably 1 nmol to 10 nmol, such as 200 pmol, 500 pmol, 800 pmol, 1 nmol, 2 nmol, 3 nmol, 4 nmol, 5 nmol, 6 nmol, 7 nmol, 8 nmol, 9 nmol or 10 nmol) of the single-stranded sequence is dissolved in the binding buffer, heated at 80 to 100° C. for 3 to 10 minutes, and then placed on ice for 5 to 10 minutes, and then the single-stranded sequence is mixed with 1 to 10×10 6 Non-target cells (control cells, e.g. 1×10 6 , 2×10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 ,7×10 6 , 8×10 6 ,9×10 6 or 10×10 6 hFOB1.19 and THP-1) are incubated at 4-37° C. for 0.5-6 hours (e.g., 0.5, 1, 2, 3, 4, 5 or 6 hours), and the supernatant is collected by centrifugation after the incubation.

[0049] Preferably, in step S7, the binding sequence enrichment library that specifically binds to the target cells is screened through multiple rounds, and the incubation time is gradually shortened during the repeated screening process. Preferably, the number of washes is gradually increased to ensure that the enriched library has a strong binding ability with the target cells. During the screening process, the libraries of different screening rounds are PCR amplified using a forward primer labeled with a fluorescent group (such as Cy3) and a reverse primer labeled with biotin, and the amplified products are separated (for example, the magnetic bead method in step S4 or asymmetric PCR, enzyme digestion, electrophoresis separation, and a combination of these methods, preferably the magnetic bead method), and the binding ability of the screened binding sequence enrichment library to the target cells and non-target cells is detected (for example, using an enzyme reader or a flow cytometer), until the binding ability to the target cells reaches a peak and the binding sequence enrichment library is not bound to the non-target cells.

[0050] It can be understood that steps S1-S7 are the steps performed by the CS-SELEX screening module in the aforementioned CSCT-SELEX. The binding sequence enrichment library obtained by the above process is used for the CT-SELEX screening module in the following CSCT-SELEX.

[0051] Preferably, in step S8, the binding sequence enrichment library is heated at 80-100°C for 3-5 minutes, placed on ice for 5-10 minutes, and then placed in a culture medium with 1-10×10 6 (For example, 1×10 6 , 2×10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 ,7×10 6 , 8×10 6 ,9×10 6 or 10×10 6) target cells are incubated at 4-37° C. (e.g., 4, 5, 10, 15, 20, 25, 30, 35 or 37° C.) for 24 to 72 hours (e.g., 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 72 hours), and the medium is replaced every 12-48 hours (e.g., 12, 24, 36 or 48 hours), the final concentration of the binding sequence enrichment library is 50 to 1000 nM, apoptotic cells are detected by annexin-V-based flow cytometer or magnetic bead sorting, the sorted apoptotic cells are resuspended in binding buffer, the sequences bound to and entering apoptotic cells are eluted by heating at 80 to 100° C. for 3 to 5 minutes, the solution is placed on ice for 5 to 10 minutes, and the supernatant is obtained by centrifugation. Here, the mechanism of action of Annexin-V is as follows: in normal living cells, phosphatidylserine (PS) is located on the inner side of the cell membrane, but in early apoptotic cells, PS flips from the inner side of the cell membrane to the surface of the cell membrane and is exposed to the extracellular environment. Annexin-V can bind to PS with high affinity, thereby identifying and detecting early apoptotic cells.

[0052] Preferably, in step S9, the enriched induced single-stranded library that induces apoptosis of the target cells can be separated from the supernatant obtained in step S8 by magnetic bead method, asymmetric PCR, enzyme digestion method, electrophoresis separation method and a combination of these methods, preferably by magnetic bead method.

[0053] In a further preferred embodiment of the present invention, in step S9, the supernatant obtained in step S8 is collected and PCR amplified using a forward primer and a reverse primer labeled with 5'-end biotin. Preferably, part of the supernatant obtained in step S8 is firstly taken to determine the optimal cycle number for amplification by a cycle number gradient experiment, and then the optimal cycle number is selected to perform PCR amplification on the remaining supernatant; the amplified double-stranded DNA product is incubated with streptavidin magnetic beads at room temperature for 0.1 to 1 hour (for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1 hour), and the biotin present on the double-stranded DNA product is bound to the streptavidin magnetic beads, thereby being fixed on the surface of the magnetic beads; then Then, the magnetic beads are placed on a magnetic rack, and after magnetic liquid separation, the obtained supernatant is removed, and the magnetic beads are washed with DPBS for 3 to 5 times (for example, 3, 4 or 5 times); in order to separate the enriched induced single-stranded library for the next round of screening, 50 to 200 mM (for example, 50, 100, 150 or 200 mM) NaOH solution is added to the magnetic beads, and the reaction is carried out for 5 to 30 minutes (for example, 5, 10, 15, 20, 25 or 30 minutes), and the magnetic beads are placed on a magnetic rack. After magnetic liquid separation, a single-stranded DNA with biotin remains on the streptavidin magnetic beads, and a single-stranded DNA without biotin remains in the supernatant. The supernatant is collected, neutralized with a 1M acetic acid solution, and added to a desalting column for desalting to obtain an enriched induced single-stranded library.

[0054] Preferably, in step S10, multiple rounds of screening are performed to identify aptamers that induce apoptosis of the target cells. Preferably, the ability of the enriched induced single-chain library screened out by annexin-V flow cytometry or magnetic bead sorting to induce apoptosis of the target cells and non-target cells is detected during the screening process as follows: 100-500 nM (e.g., 100, 200, 300, 400 or 500 nM) of the enriched induced single-chain library is incubated with target cells or non-target cells at 4-37° C. (e.g., 4, 5, 10, 15, 20, 25, 30, 35 or 37° C.) for 24 to 72 hours (e.g., 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 72 hours), and the medium is replaced every 12-48 hours (e.g., 12, 24, 36 or 48 hours), and the replaced medium contains the enriched induced single-chain library; until the ability of the enriched induced single-chain library to induce apoptosis of the target cells no longer increases and does not induce apoptosis of non-target cells, the above screening is stopped. The above process is the CT-SELEX screening module in CSCT-SELEX. Finally, the obtained enriched sequence is cloned and sequenced to obtain the aptamer.

[0055] Preferably, the aptamer comprises SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence having 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more homology with SEQ ID NO: 25 or 26; or, comprises a sequence having no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide difference with SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence in which one or more nucleotides are substituted, deleted or inserted with respect to SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence having 1-30 nucleotides extended at the 5' end and / or 3' end of SEQ ID NO: 25 or 26, respectively; preferably, the extended nucleotide is selected from any one of A, T, C, G or U;

[0056] TCGX1X2TGGCGTAGCTAX3X4CGATCTGGTTACCCA (SEQ ID NO: 25);

[0057] CCGX5X6TGCTGCGGCAX7CGG (SEQ ID NO: 26);

[0058] Wherein, X1, X2, X3, X4, X5, X6 or X7 are independently selected from any one of A, T, C, G or U.

[0059] Preferably, X1, X2, X3 or X4 are independently selected from A or T.

[0060] Preferably, X5 is selected from A or G or T.

[0061] Preferably, X6 is selected from A or C or T.

[0062] Preferably, X7 is selected from A or T.

[0063] In a specific embodiment of the present invention, X1X2 is TT, or X1X2 is AA.

[0064] In a specific embodiment of the present invention, X3X4 is TT, or X3X4 is AA.

[0065] In a specific embodiment of the present invention, X5X6 is GC, or, X5X6 is AA, or, X5X6 is TT.

[0066] In a specific embodiment of the present invention, X1X2 is TT, and X3X4 is TT.

[0067] In a specific embodiment of the present invention, X1X2 is AA, and X3X4 is AA.

[0068] In a specific embodiment of the present invention, X5X6 is GC, and X7 is T.

[0069] In a specific embodiment of the present invention, X5X6 is AA, and X7 is A.

[0070] In a specific embodiment of the present invention, X5X6 is TT, and X7 is T.

[0071] Preferably, the sequence of the aptamer is extended by 1-20 nucleotides at the 5' end and / or 3' end, respectively, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides; preferably, the nucleotides are selected from any one of A, T, C, G or U.

[0072] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 1 nucleotide at the 5' end and the 3' end of SEQ ID NO: 25, preferably by 1 nucleotide T at the 5' end and by 1 nucleotide C at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 1.

[0073] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 1 nucleotide at the 5' end and 7 nucleotides at the 3' end of SEQ ID NO: 25, preferably by 1 nucleotide T at the 5' end and by 7 nucleotides CTTTTTT at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 10.

[0074] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 7 nucleotides at the 5' end and 1 nucleotide at the 3' end of SEQ ID NO: 25, preferably by 7 nucleotides AAAAAAT at the 5' end and by 1 nucleotide C at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 11.

[0075] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 3 nucleotides at the 3' end of SEQ ID NO:26, preferably by 3 nucleotides GCT at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO:14.

[0076] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 6 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 6 nucleotides GCTAGA at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 13.

[0077] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 10 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 10 nucleotides GCTAGATATC (SEQ ID NO: 22) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 12.

[0078] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 2.

[0079] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 6 nucleotides at the 5' end and 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 6 nucleotides CCCCCC at the 5' end and by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 18.

[0080] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 3 nucleotides at the 5' end and 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 3 nucleotides CCC at the 5' end and by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 19.

[0081] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 6 nucleotides at the 5' end and 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 6 nucleotides AAAAAA at the 5' end and by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 20.

[0082] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 19 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 19 nucleotides GCTAGATATCGATAAAAAA (SEQ ID NO: 24) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 21.

[0083] Preferably, the aptamer comprises one or more of SEQ ID NOs: 1, 2, 7-21, or comprises a nucleotide sequence having more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95% or more homology with one or more of SEQ ID NOs: 1, 2, 7-21.

[0084] Preferably, the aptamer further comprises a modification, and the modification preferably comprises a base modification, a backbone modification or a transformation into a nucleic acid analog or a linking functional group.

[0085] Preferably, the base modification includes one or more of phosphorylation, methylation, hydroxymethylation, acetylation, amination, glycosylation, sulfhydrylation or isotope modification.

[0086] Preferably, the backbone modification comprises a phosphate backbone modification, preferably a thiophosphate backbone modification.

[0087] Preferably, the nucleic acid analogs include one or more of peptide nucleic acid, morpholino nucleic acid, bridge nucleic acid, locked nucleic acid, glycol nucleic acid or threose nucleic acid.

[0088] Preferably, the functional groups include one or more of fluorescent groups, radioactive groups, therapeutic drugs, biotin, digoxin, nanoluminescent materials, nucleic acids or enzyme markers.

[0089] Preferably, the aptamer binds to target cells and / or kills target cells.

[0090] The screening method of the present invention does not require accurate knowledge of the molecular and structural information on the surface of the target cells. The screened aptamers can be used as specific and lethal aptamers for target cells, and have the functions of promoting apoptosis of target cells (such as activated synovial fibroblasts), inhibiting the growth, migration, invasion or production of inflammatory factors of target cells (such as activated synovial fibroblasts), and can be directly used for disease treatment to reduce toxic side effects; in addition, the screened aptamers can also be used for target cell biomarker discovery, target cell identification and sorting, biosensing, bioimaging, disease diagnosis and drug targeted delivery.

[0091] The second object of the present invention is to provide an aptamer screening kit, comprising a CS-SELEX module for screening sequences binding to target cells, and a CT-SELEX module connected in series with the CS-SELEX module and further screening sequences having target cell cytotoxicity based on the sequences binding to target cells screened by the CS-SELEX module.

[0092] Preferably, the CT-SELEX module is used to co-incubate the binding sequence enrichment library obtained by CS-SELEX with target cells, separate apoptotic cells after incubation, and elute the sequences that bind to and enter the apoptotic cells;

[0093] Preferably, the CT-SELEX module is further used to amplify and separate the sequences obtained by binding to and entering the apoptotic cells to obtain an enriched induced single-stranded library.

[0094] Preferably, the screening kit comprises reagents required for CT-SELEX; ​​the CT-SELEX comprises co-incubating random sequences with target cells, isolating apoptotic cells, and screening sequences that bind to and / or enter apoptotic cells;

[0095] Preferably, the screening kit further comprises reagents required for CS-SELEX; ​​the CS-SELEX comprises co-incubating random sequences with target cells and obtaining sequences binding to target cells by positive screening, and preferably the CS-SELEX further comprises subjecting the sequences binding to target cells to negative screening to remove sequences binding to non-target cells.

[0096] Preferably, the screening kit comprises target cells, and more preferably also comprises non-target cells.

[0097] Preferably, the screening kit comprises an initial random single-stranded DNA library, which is composed of a random sequence, a forward primer sequence and a reverse complementary sequence of a reverse primer, and further comprises a label, such as biotin and / or streptavidin.

[0098] Preferably, the screening kit comprises a buffer for resuspending cells and a buffer for washing.

[0099] Preferably, the screening kit comprises a reagent for screening apoptotic cells, such as Annexin-V.

[0100] Preferably, the screening kit comprises reagents required for PCR, reagents required for sequencing, magnetic beads, reagents for detecting the binding force between the sequence and the target cell, or reagents for detecting the induction of apoptosis of the target cell.

[0101] Specifically, the screening kit includes a CS-SELEX module for screening cell-specific aptamers, and a CT-SELEX module connected in series with the CS-SELEX module and after the CS-SELEX module; the CS-SELEX module preferably includes: in vitro chemical synthesis of a single-stranded oligonucleotide library; mixing the single-stranded oligonucleotide library with target cells, washing away nucleic acid sequences that do not bind to the target cells after incubation, separating nucleic acid sequences that bind to the target cells, amplifying, and separating single strands to obtain a positive screening enrichment library; in order to ensure screening specificity, negative screening is introduced in the screening process, that is, the positive screening enrichment library is incubated with non-target cells and sequences that do not bind to non-target cells are separated to obtain a negative screening enrichment library; negative screening and positive screening are repeated until the enrichment library with a peak binding ability to the target cells and no binding to the non-target cells is selected, thereby being used for screening cell-killing aptamers of the CT-SELEX module. The CT-SELEX module step preferably includes adding the enriched library during the target cell culture process, isolating apoptotic cells after incubation, eluting sequences that bind to and enter the apoptotic cells, isolating single chains after amplification, and detecting the ability of the enriched library to induce apoptosis of target cells and non-target cells after repeated screening, until the ability of the screened enriched library to induce apoptosis of target cells reaches a peak and does not induce apoptosis of non-target cells, sequencing the sequence of the enriched library to obtain the target cell-killing aptamer.

[0102] In the present invention, the purpose of the CS-SELEX module is to screen aptamers that specifically bind to target cells, while the purpose of the CT-SELEX module is to further screen aptamers that specifically kill target cells based on the aptamers that specifically bind to target cells. The screening kit of the present application uses the two modules in series, which can directly and efficiently screen specific and killing aptamers of target cells.

[0103] The third object of the present invention is to provide the above screening method, or the aptamer or its derivative obtained by the above screening kit.

[0104] The derivatives of the sequence shown in SEQ ID NO: 1 include: derivatives obtained by modifying at least one base of the sequence shown in SEQ ID NO: 1, sequences with a homology of more than 60% with the sequence shown in SEQ ID NO: 1, sequences that hybridize with the sequence shown in SEQ ID NO: 1, sequences transcribed from the sequence shown in SEQ ID NO: 1, phosphorothioate backbone sequences derived from the backbone of the sequence shown in SEQ ID NO: 1, and peptide nucleic acids modified from the sequence shown in SEQ ID NO: 1;

[0105] The derivatives of the sequence shown in SEQ ID NO: 2 include: derivatives obtained by modifying at least one base of the sequence shown in SEQ ID NO: 2, sequences with a homology of more than 60% with the sequence shown in SEQ ID NO: 2, sequences that hybridize with the sequence shown in SEQ ID NO: 2, sequences transcribed from the sequence shown in SEQ ID NO: 2, thiophosphate backbone sequences derived from the backbone of the sequence shown in SEQ ID NO: 2, and peptide nucleic acids modified from the sequence shown in SEQ ID NO: 2.

[0106] The fourth object of the present invention is to provide a method for screening aptamers, which includes using the above-mentioned screening kit.

[0107] The fifth object of the present invention is to provide an aptamer.

[0108] Preferably, the sequence of the aptamer comprises SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence having 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more homology with SEQ ID NO: 25 or 26; or, comprises a sequence having no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide difference with SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence in which one or more nucleotides are substituted, deleted or inserted with respect to SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence in which the 5' end and / or the 3' end of SEQ ID NO: 25 or 26 are respectively extended by 1-30 nucleotides; preferably, the extended nucleotide is selected from any one of A, T, C, G or U;

[0109] TCGX1X2TGGCGTAGCTAX3X4CGATCTGGTTACCCA (SEQ ID NO: 25);

[0110] CCGX5X6TGCTGCGGCAX7CGG (SEQ ID NO: 26);

[0111] Wherein, X1, X2, X3, X4, X5, X6 or X7 are independently selected from any one of A, T, C, G or U.

[0112] Preferably, X1, X2, X3 or X4 are independently selected from A or T.

[0113] Preferably, X5 is selected from A or G or T.

[0114] Preferably, X6 is selected from A or C or T.

[0115] Preferably, X7 is selected from A or T.

[0116] In a specific embodiment of the present invention, X1X2 is TT, or X1X2 is AA.

[0117] In a specific embodiment of the present invention, X3X4 is TT, or X3X4 is AA.

[0118] In a specific embodiment of the present invention, X5X6 is GC, or, X5X6 is AA, or, X5X6 is TT.

[0119] In a specific embodiment of the present invention, X1X2 is TT, and X3X4 is TT.

[0120] In a specific embodiment of the present invention, X1X2 is AA, and X3X4 is AA.

[0121] In a specific embodiment of the present invention, X5X6 is GC, and X7 is T.

[0122] In a specific embodiment of the present invention, X5X6 is AA, and X7 is A.

[0123] In a specific embodiment of the present invention, X5X6 is TT, and X7 is T.

[0124] Preferably, the sequence of the aptamer is extended by 1-20 nucleotides at the 5' end and / or 3' end, respectively, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides; preferably, the nucleotides are selected from any one of A, T, C, G or U.

[0125] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 1 nucleotide at the 5' end and the 3' end of SEQ ID NO: 25, preferably by 1 nucleotide T at the 5' end and by 1 nucleotide C at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 1.

[0126] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 1 nucleotide at the 5' end and 7 nucleotides at the 3' end of SEQ ID NO: 25, preferably by 1 nucleotide T at the 5' end and by 7 nucleotides CTTTTTT at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 10.

[0127] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 7 nucleotides at the 5' end and 1 nucleotide at the 3' end of SEQ ID NO: 25, preferably by 7 nucleotides AAAAAAT at the 5' end and by 1 nucleotide C at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 11.

[0128] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 3 nucleotides at the 3' end of SEQ ID NO:26, preferably by 3 nucleotides GCT at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO:14.

[0129] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 6 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 6 nucleotides GCTAGA at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 13.

[0130] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 10 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 10 nucleotides GCTAGATATC (SEQ ID NO: 22) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 12.

[0131] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 2.

[0132] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 6 nucleotides at the 5' end and 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 6 nucleotides CCCCCC at the 5' end and by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 18.

[0133] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 3 nucleotides at the 5' end and 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 3 nucleotides CCC at the 5' end and by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 19.

[0134] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 6 nucleotides at the 5' end and 13 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 6 nucleotides AAAAAA at the 5' end and by 13 nucleotides GCTAGATATCGAT (SEQ ID NO: 23) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 20.

[0135] In a specific embodiment of the present invention, the sequence of the aptamer is extended by 19 nucleotides at the 3' end of SEQ ID NO: 26, preferably by 19 nucleotides GCTAGATATCGATAAAAAA (SEQ ID NO: 24) at the 3' end. Preferably, the sequence of the aptamer comprises SEQ ID NO: 21.

[0136] Preferably, the aptamer comprises one or more of SEQ ID NOs: 1, 2, 7-21, or comprises a nucleotide sequence having more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95% or more homology with one or more of SEQ ID NOs: 1, 2, 7-21.

[0137] Preferably, the aptamer further comprises a modification, and the modification preferably comprises a base modification, a backbone modification or a transformation into a nucleic acid analog or a linking functional group.

[0138] Preferably, the base modification includes one or more of phosphorylation, methylation, hydroxymethylation, acetylation, amination, glycosylation, sulfhydrylation or isotope modification.

[0139] Preferably, the backbone modification comprises a phosphate backbone modification, preferably a thiophosphate backbone modification.

[0140] Preferably, the nucleic acid analogs include one or more of peptide nucleic acid, morpholino nucleic acid, bridge nucleic acid, locked nucleic acid, glycol nucleic acid or threose nucleic acid.

[0141] Preferably, the functional groups include one or more of fluorescent groups, radioactive groups, therapeutic drugs, biotin, digoxin, nanoluminescent materials, nucleic acids or enzyme markers.

[0142] Preferably, the functional group may be connected to the 3' end, the 5' end and / or the middle base of the nucleotide sequence of the aptamer.

[0143] According to the needs of the specific implementation, in the present invention, the nucleotide sequence of the above-mentioned aptamer can be modified by any known method and any known group, as long as it does not affect the performance of the obtained sequence, that is, the modification of the aptamer does not lose its basic function, that is, specifically targeting and killing target cells (such as activated synovial fibroblasts, immune cells or tumor cells). These modifications can be used to improve the stability of the aptamer, provide a detection signal, or be used to connect the aptamer with other substances to form a composition.

[0144] Preferably, the target cells include activated synovial fibroblasts, immune cells or tumor cells.

[0145] Synovial fibroblasts (fibroblast-like synoviocytes, FLSs) are a type of mesenchymal cell that is mainly located in the inner layer of the synovium. Under normal physiological conditions, FLSs are related to joint homeostasis and provide extracellular matrix for cartilage. However, in the pathogenesis of diseases such as synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis, and ankylosing spondylitis, FLSs are the core effector cells of the hyperplastic synovium. Under the stimulation of the inflammatory microenvironment, the cells are activated and differentiated into invasive subtypes, producing cytokines, chemokines, and matrix degradation molecules, and migrate to the articular cartilage to erode and destroy the cartilage and bone structure. Activated FLSs have many tumor-like lesions, such as breaking away from growth restrictions and acquiring the ability to invade, migrate, and resist apoptosis. In recent years, they have been considered as one of the target cells that cannot be ignored in the treatment of the above diseases.

[0146] Preferably, phosphorothioate modification is the simplest and most widely used chemical modification that can be applied to increase nuclease resistance. Unmodified nucleic acid aptamers can show activity, but they will be rapidly degraded by nucleases, so their effect is limited. On the phosphate backbone of oligonucleotides, the phosphorothioate bond replaces the non-bridging oxygen atom with a sulfur atom, making the internucleotide bond resistant to nuclease degradation and more stable. Peptide nucleic acids (PNA) are a class of DNA analogs that replace the sugar phosphate backbone with a polypeptide backbone, and replace the pentose phosphodiester bond backbone in DNA with a neutral peptide chain amide 2-aminoethylglycine bond, and the rest is the same as DNA. PNA can recognize and bind to DNA or RNA sequences in the form of Watson-Crick base pairing to form a stable double helix structure, with high hybridization stability, excellent specific sequence recognition ability, and is not hydrolyzed by nucleases and proteases, and can be connected to a ligand and co-transfected into cells.

[0147] Preferably, the at least one base is modified by phosphorylation, methylation, amination, sulfhydrylation or isotopization, or is replaced by at least one of locked nucleic acid (LNA), unlocked nucleic acid (UNA) or glycol nucleic acid (GNA), morpholine nucleic acid (MNA), peptide nucleic acid (PNA), suare nucleic acid (SNA) or bridged nucleic acid (BNA).

[0148] The aptamers in the present invention can specifically bind to and / or specifically kill target cells (such as activated synovial fibroblasts), and have the functions of promoting apoptosis of target cells (such as activated synovial fibroblasts), inhibiting the growth, invasion, migration and production of inflammatory factors of target cells (such as activated synovial fibroblasts).

[0149] The aptamer of the present invention also has uses such as discovery of biomarkers of target cells (such as activated synovial fibroblasts), identification and sorting of target cells (such as activated synovial fibroblasts), biosensing, bioimaging, disease diagnosis and targeted drug delivery.

[0150] The sixth object of the present invention is to provide a drug comprising the above-mentioned aptamer.

[0151] Preferably, the drug further comprises other active ingredients, such as one or more of methotrexate, leflunomide, hydroxychloroquine or sulfasalazine, abatacept, adalimumab, anakinra, becelizumab, etanercept, golimumab, infliximab, rituximab, salizumab, tocilizumab, baricitinib, tofacitinib, upadacitinib, ibuprofen, diclofenac, indomethacin, meloxicam, celecoxib, ciproamide, azathioprine, mycophenolate mofetil, cyclosporine, prednisone, prednisone or triamcinolone acetonide.

[0152] Preferably, the medicine further comprises pharmaceutically acceptable excipients.

[0153] Preferably, the pharmaceutically acceptable excipient is selected from one or a combination of two or more of a diluent, an absorbent, a wetting agent, a binder, a disintegrant, a lubricant, a solvent, a pH adjuster, a buffer, an antioxidant, a metal ion chelator, an antibacterial agent or an isotonicity adjuster.

[0154] Preferably, the drug can be in the form of a suspension, powder, granule, tablet, aqueous solution, cream, gel or emulsion. The various dosage forms of the drug can be prepared according to conventional production methods in the pharmaceutical field.

[0155] Preferably, the pharmaceutical preparation is a unit dose preparation. The amount of the active pharmaceutical ingredient in the unit dose preparation can be changed or adjusted from 0.001 mg to 1000 mg, depending on the specific application and efficacy of the active pharmaceutical ingredient.

[0156] The drug is suitable for enteral or parenteral administration.

[0157] The preparations for enteral administration, such as oral administration, enteral administration or catheter administration, include one or more of oral agents (such as capsules, sachets, pills, tablets, lozenges, powders, granules, water or non-aqueous solutions or suspensions, water-in-oil or oil-in-water emulsions, elixirs or syrups), rectal suppositories or rectal enemas.

[0158] The drug is suitable for parenteral administration such as, for example, preparations administered by intravenous, intramuscular, intradermal and subcutaneous routes include aqueous and non-aqueous isotonic sterile injections, which may contain antioxidants, buffers, bacteriostats, and solutes that make the preparation isotonic with the recipient's blood, and aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers or preservatives. The preparation may be present in unit dose or multi-dose sealed containers such as ampoules and vials. Solutions and suspensions for injection may be prepared from sterile powders, granules and tablets of the types previously described.

[0159] Preferably, the administration of the drug includes, but is not limited to, oral administration, enteral administration, catheter administration, intramuscular injection, subcutaneous injection, intraperitoneal injection, intravenous infusion, local administration, intraperitoneal administration or intrathecal administration, etc.

[0160] In a specific embodiment of the present invention, the drug is used for the prevention and / or treatment of diseases related to activated synovial fibroblasts, inflammatory diseases, infectious diseases, autoimmune diseases or tumors. The diseases related to activated synovial fibroblasts include one or more of synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, etc. The inflammatory diseases include degenerative inflammation, exudative inflammation (such as one or more of serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation or specific inflammation (such as one or more of tuberculosis, syphilis, leprosy or lymphogranuloma). The autoimmune diseases include one or more of systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, dermatomyositis, ankylosing spondylitis, hyperthyroidism, idiopathic thrombocytic purpura, autoimmune hemolytic anemia, inflammatory bowel disease, atopic dermatitis, vasculitis or psoriasis. The infectious diseases include diseases caused by one or more of bacteria, fungi or viruses. The tumors include lymphomas (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, The invention relates to one or more of cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

[0161] Preferably, the drug can be used alone or in combination with other therapeutic agents.

[0162] In a specific embodiment of the present invention, the other therapeutic agents include but are not limited to non-steroidal anti-inflammatory drugs, corticosteroids, disease-modifying anti-rheumatic drugs, local joint medications, systemic analgesics, intra-articular injections, disease-modifying drugs, chondroprotective agents and / or anti-tumor drugs.

[0163] In a specific embodiment of the present invention, the aptamer is used in combination with an anti-rheumatic drug (such as etanercept) to achieve a good therapeutic effect.

[0164] The seventh object of the present invention is to provide an application of the above-mentioned screening method, the above-mentioned screening kit, the above-mentioned aptamer or the above-mentioned drug, wherein the application comprises:

[0165] 1) Use in the preparation of products for preventing and / or treating diseases;

[0166] 2) Applications in biomarker discovery, cell recognition and sorting, biosensing, bioimaging, or targeted drug delivery.

[0167] Preferably, the disease includes a disease for which killing of target cells is beneficial for treatment.

[0168] Preferably, the target cells include activated synovial fibroblasts, immune cells or tumor cells.

[0169] Preferably, the disease comprises one or more of activated synovial fibroblast-related diseases, inflammatory diseases, infectious diseases, autoimmune diseases or tumors.

[0170] Preferably, the activated synovial fibroblast-related diseases include one or more of synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis or ankylosing spondylitis.

[0171] Preferably, the inflammatory disease includes degenerative inflammation, exudative inflammation (for example, one or more of serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, and catarrhal inflammation), proliferative inflammation, or specific inflammation (for example, one or more of tuberculosis, syphilis, leprosy, or lymphogranuloma).

[0172] Preferably, the autoimmune disease includes one or more of systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, dermatomyositis, ankylosing spondylitis, hyperthyroidism, idiopathic thrombocytic purpura, autoimmune hemolytic anemia, inflammatory bowel disease, atopic dermatitis, vasculitis or psoriasis.

[0173] Preferably, the infectious diseases include diseases caused by one or more of bacteria, fungi or viruses.

[0174] Preferably, the virus includes one or more of cytomegalovirus (CMV), Epstein-Barr virus (EBV), hepatitis virus, Kaposi's sarcoma-associated herpes virus (KSHV), human papilloma virus (HPV), molluscum contagiosum virus (MCV), human T-cell leukemia virus 1 (HTLV-1) or HIV (human immunodeficiency virus).

[0175] Preferably, the bacteria include one or more of Escherichia coli, Mycobacterium tuberculosis, Staphylococcus, Streptococcus, Pneumococcus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Staphylococcus epidermidis, Listeria, Brucella, Campylobacter, Vibrio cholerae, Serratia, Pseudomonas, Salmonella, Shigella, Bacillus anthracis, Clostridium difficile or Corynebacterium diphtheriae.

[0176] Preferably, the fungus comprises one or more of Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides, Cryptococcus, Histoplasma, Mucor or Sporothrix.

[0177] Preferably, the tumor includes lymphoma (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as one or more of lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer , gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

[0178] The eighth object of the present invention is to provide a use of the above-mentioned aptamer in preparing a product for preventing and / or treating a disease. Preferably, the aptamer targets NCL.

[0179] Preferably, the aptamer degrades NCL.

[0180] Preferably, the aptamer targets and degrades NCL.

[0181] Preferably, the aptamer can treat and / or prevent diseases by targeting and / or degrading NCL.

[0182] Preferably, the aptamer can treat and / or prevent diseases by reducing the expression level of Bcl-2 and / or increasing the expression level of p53.

[0183] Preferably, the aptamer can treat and / or prevent diseases by targeting and / or degrading NCL, thereby reducing the expression level of Bcl-2, and / or increasing the expression level of p53.

[0184] Preferably, the disease expresses or abnormally expresses NCL. The NCL expressed is, for example, one or more of tumor cells, immune cells or vascular endothelial cells.

[0185] Preferably, the disease includes a disease for which degradation of NCL or reduction of NCL function is beneficial for treatment.

[0186] In a specific embodiment of the present invention, the disease comprises one or more of activated synovial fibroblast-related diseases, inflammatory diseases, infectious diseases or tumors.

[0187] Preferably, the activated synovial fibroblast-related diseases include one or more of synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis or ankylosing spondylitis.

[0188] Preferably, the inflammatory disease includes degenerative inflammation, exudative inflammation (for example, one or more of serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, and catarrhal inflammation), proliferative inflammation, or specific inflammation (for example, one or more of tuberculosis, syphilis, leprosy, or lymphogranuloma).

[0189] Preferably, the autoimmune disease includes one or more of systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, dermatomyositis, ankylosing spondylitis, hyperthyroidism, idiopathic thrombocytic purpura, autoimmune hemolytic anemia, inflammatory bowel disease, atopic dermatitis, vasculitis or psoriasis.

[0190] Preferably, the infectious diseases include diseases caused by one or more of bacteria, fungi or viruses.

[0191] Preferably, the virus includes one or more of cytomegalovirus (CMV), Epstein-Barr virus (EBV), hepatitis virus, Kaposi's sarcoma-associated herpes virus (KSHV), human papilloma virus (HPV), molluscum contagiosum virus (MCV), human T-cell leukemia virus 1 (HTLV-1) or HIV (human immunodeficiency virus).

[0192] Preferably, the bacteria include one or more of Escherichia coli, Mycobacterium tuberculosis, Staphylococcus, Streptococcus, Pneumococcus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Staphylococcus epidermidis, Listeria, Brucella, Campylobacter, Vibrio cholerae, Serratia, Pseudomonas, Salmonella, Shigella, Bacillus anthracis, Clostridium difficile or Corynebacterium diphtheriae.

[0193] Preferably, the fungus comprises one or more of Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides, Cryptococcus, Histoplasma, Mucor or Sporothrix.

[0194] Preferably, the tumor includes lymphoma (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as one or more of lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer , gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

[0195] The ninth object of the present invention is to provide a method for preventing and / or treating a disease.

[0196] Preferably, the method comprises administering an effective amount of the above-mentioned aptamer or the above-mentioned drug to a subject in need thereof.

[0197] Preferably, the effective amount is 5 μg / kg-5000 mg / kg, for example 5 μg / kg, 10 μg / kg, 50 μg / kg, 100 μg / kg,

[0198] 200μg / kg, 300μg / kg, 400μg / kg, 500μg / kg, 600μg / kg, 700μg / kg, 800μg / kg, 900μg / kg, 1mg / kg,

[0199] 10mg / kg, 100mg / kg, 200mg / kg, 500mg / kg, 1000mg / kg, 1500mg / kg, 2000mg / kg, 2500mg / kg,

[0200] 3000mg / kg, 3500mg / kg, 4000mg / kg, 4500mg / kg or 5000mg / kg.

[0201] Preferably, the administration method includes, but is not limited to, enteral administration or parenteral administration. Preferably, the enteral administration includes oral administration, enteral administration or administration via a catheter; preferably, the parenteral administration includes intravenous, intramuscular, intradermal and subcutaneous administration.

[0202] Preferably, the disease comprises one or more of activated synovial fibroblast-related diseases, inflammatory diseases, infectious diseases or tumors.

[0203] The "effective amount" of the present invention refers to the amount or dosage of the product of the present invention that provides the desired treatment after administration to an individual or an organ in a single or multiple doses.

[0204] The term "prevention" as used in the present invention refers to all actions that suppress symptoms or delay the tension of specific symptoms by administering the product described in the present invention.

[0205] The term "pharmaceutically acceptable" as used herein refers to a substance that neither significantly irritates an organism nor inhibits the biological activity and properties of the active substance of the administered product.

[0206] "Treatment" as used herein means to delay, terminate, block, control, stop, alleviate or reverse the progression or severity of a sign, symptom, disorder, condition or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions or disorders.

[0207] The term "homology" as used in the present invention refers to that in terms of the use of amino acid sequences or nucleotide sequences, those skilled in the art can adjust the sequences according to actual work needs, while ensuring that the structures or functions are similar to those of known sequences, so that the sequences used have (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36% compared to the sequences obtained by the prior art. , 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% identity.

[0208] The "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0209] The term “include” or “comprising” described in the present invention is an open description, which includes the specified components or steps described and other specified components or steps that will not be substantially affected. BRIEF DESCRIPTION OF THE DRAWINGS

[0210] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0211] Figure 1 Flow chart for screening activated synovial fibroblast-specific and cytotoxic aptamers for CSCT-SELEX;

[0212] Figure 2 The ability of the enriched libraries in different screening rounds to bind to target cells and control cells (A) and to induce cell apoptosis (B);

[0213] Figure 3 The ability of SAPT4 and SAPT8 to bind to target cells and control cells and to induce cell apoptosis, wherein A: the ability of SAPT4 and SAPT8 to bind to target cells, B: the ability of SAPT4 and SAPT8 to bind to target control cells, C: the ability of SAPT4 and SAPT8 to bind to target cells at different concentrations at different incubation times, D: the ability of SAPT4 and SAPT8 to bind to target cells, E: the affinity of SAPT4 and SAPT8 to bind to target cells;

[0214] Figure 4 The effects of SAPT4 and SAPT8 on apoptosis of target cells and control cells (A) and the secondary structure diagrams of SAPT4 and SAPT8 (B);

[0215] Figure 5 The ability of SAPT4 derivatives and SAPT8 derivatives to bind to target cells and control cells (A, C) and to induce cell apoptosis (B, D);

[0216] Figure 6 Effects of SAPT4 and SAPT8 on the growth (A), migration (C), invasion (B) and production of inflammatory factors (D) of RA-FLSs;

[0217] Figure 7The binding of SAPT4 and SAPT8 to human synovial sarcoma cells (A) and their effects on apoptosis (B), growth (C), migration (E) and invasion (D);

[0218] Figure 8 The binding of SAPT4 and SAPT8 to activated rat synovial fibroblasts (A) and their effects on apoptosis (B), growth (C), migration (E) and invasion (D);

[0219] Fig. 9 The binding of SAPT4 and SAPT8 to mouse activated synovial fibroblasts (A) and their effects on apoptosis (B), growth (D), migration (F) and invasion (E). Fig. 9 C shows the results of SAPT4 and SAPT8 inducing apoptosis in control cells;

[0220] Fig.10 The tissue distribution of SAPT8 in the CIA mouse model, where A: in vivo imaging results, B: fluorescence detection results of various tissues and organs (heart, liver, spleen, lung, kidney, synovium and hind limbs);

[0221] Fig.11 The therapeutic effects of SAPT8, etanercept and SAPT8+etanercept in the CIA mouse model, where A: experimental design diagram, B: arthritis score, C: micro-CT scan of mouse paws, D: synovitis score, E: bone destruction degree, F: cartilage destruction degree;

[0222] Fig.12 The binding of SAPT8 to OA-FLSs (A) and its effects on apoptosis (B), growth (C), migration (E) and invasion (D);

[0223] Fig.13 The therapeutic effect of SAPT8 in the DMM mouse model, where A: experimental design diagram, B: micro-CT scan of the mouse knee joint, C: synovitis score, OARSI score and cartilage degeneration score;

[0224] Fig.14 The experimental results of SAPT8 targeting NCL, including: A: silver staining experiment, B: mass spectrometry analysis of the interaction band with SAPT8, CD: visualized protein band blot, E: immunoblotting experiment results, F: the binding results of SAPT8 and NC sequences with RA-FLSs treated with shNC or shNCL, G: the effect of silencing NCL on SAPT8 inhibiting the proliferation of RA-FLSs, H: the effect of silencing NCL on SAPT8-induced apoptosis of RA-FLSs;

[0225] Fig.15The experimental results of SAPT8-mediated NCL degradation, including: A: the relative expression level of NCL mRNA after RA-FLSs were treated with NC and SAPT8, B: the expression levels of NCL, Bcl-2 and p53 proteins after RA-FLSs were treated with NC and SAPT8, C: the expression levels of NCL, Bcl-2 and p53 proteins after OA-FLSs were treated with NC and SAPT8, D: confocal microscopy results, E: the effect of MG132 or CQ / Baf A1 treatment on the degradation of NCL induced by SAPT8;

[0226] Fig.16 The binding of SAPT8 sequence to human osteosarcoma cells MNNG / HOS (A) and its effect on their proliferation (B) are shown. Fig.16 C is the effect of SAPT8 on the expression levels of NCL, Bcl-2 and p53 in MNNG / HOS cells. Fig.16 DG is the drug administration strategy and the effect of low or high concentration of SAPT8 on osteosarcoma growth; Fig.16 HI represents the binding of SAPT8 to human non-small cell lung cancer A549 cells and its effect on their proliferation. DETAILED DESCRIPTION

[0227] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and Examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0228] Example 1: CSCT-SELEX screening of specific and lethal aptamers targeting activated synovial fibroblasts

[0229] The process of CSCT-SELEX screening for specific and cytotoxic aptamers targeting activated synovial fibroblasts, such as Figure 1 As shown, the following steps are included:

[0230] (1) Synthesize an initial random single-stranded DNA library, a forward primer and a reverse primer. The forward primer is shown in SEQ ID NO: 4.

[0231] SEQ ID NO: 4: 5'-TGAGAATATGTAGACGATCC-3'; the reverse primer is shown in SEQ ID NO: 5, and SEQ ID NO: 5: 5'-CAGATCATCTTGAAGCTCCG-3'. The initial random single-stranded DNA library includes a random sequence, a forward primer sequence and a reverse complementary sequence of the reverse primer. The sequence of the initial random single-stranded DNA is shown in SEQ ID NO: 3. The initial random single-stranded DNA library, the forward primer and the reverse primer are all synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0232] SEQ ID NO: 3: 5′-TGAGAATATGTAGACGATCC-(35N)-CGGAGCTTCAAGATGATCTG-3′; wherein 35N is 35 random DNA oligonucleotides.

[0233] (2) Determination of target cells and control cells: Activated synovial fibroblasts (RA-FLSs) from patients with rheumatoid arthritis were selected as target cells, and human osteoblast cell line hFOB1.19 and human monocytic cell line THP-1 were selected as control cells.

[0234] (3) Forward screening: 10 nmol of the initial random single-stranded DNA library was dissolved in 400 μL of binding buffer (DPBS, containing 4.5 g / L glucose, 5 mM MgCl2, 0.1 mg / mL tRNA and 1 mg / mL BSA), heated at 95°C for 5 minutes and placed on ice for 10 minutes for forward screening. 6 RA-FLSs were incubated at 37°C for 3 hours. After incubation, the cells were washed three times with 500 μL of washing buffer (DPBS containing 4.5 g / L glucose and 5 mM MgCl2). The cells were resuspended with 400 μL of binding buffer, heated at 95°C for 5 minutes to elute the sequences bound to RA-FLSs and placed on ice for 10 minutes. The supernatant was collected by centrifugation.

[0235] (4) Separation and enrichment of single-stranded sequences by magnetic bead method: PCR amplification was performed on the collected supernatant using the forward primer and the reverse primer labeled with 5' biotin. First, a portion of the supernatant was taken to determine the optimal cycle number for amplification by a cycle number gradient experiment, and then the optimal cycle number was selected to perform PCR amplification on the remaining supernatant. The amplified double-stranded DNA product was incubated with streptavidin magnetic beads at room temperature for 0.5 hours. The biotin on the double-stranded DNA product bound to the streptavidin magnetic beads and was fixed on the surface of the magnetic beads. The magnetic beads were placed on a magnetic stand, and after magnetic liquid separation, the supernatant was removed and the magnetic beads were washed 3 times with DPBS. In order to separate the single-stranded enriched library for the next round of screening, 500 μL of 100 mM NaOH solution was added to the magnetic beads, reacted for 15 minutes, and the magnetic beads were placed on a magnetic stand. After magnetic liquid separation, a single-stranded DNA with biotin remained on the streptavidin magnetic beads, and a single-stranded DNA without biotin remained in the supernatant. The supernatant was collected, neutralized with 1 M acetic acid solution, and added to a desalting column for desalting to obtain a single-stranded sequence.

[0236] (5) Introducing negative screening: Repeat steps (3) and (4) above with the single-stranded sequence obtained in step (4), and adjust the amount of single-stranded sequence added in each round to 200 pmol. After repeating for the third round and beyond, introduce negative screening. In negative screening, take 200 pmol of single-stranded sequence and dissolve it in 400 μL binding buffer, heat it at 95°C for 5 minutes, and then place it on ice for 10 minutes. Mix the single-stranded sequence with 5×10 6 Control cells (hFOB1.19 and THP-1) were incubated at 37°C for 3 hours. After the incubation, the supernatant was collected by centrifugation.

[0237] (6) Multiple rounds of screening for a binding sequence enrichment library that specifically binds to target cells: The supernatant collected in step (5) is used as the initial random single-stranded DNA library to continue the above steps (3) and (4). Then, the steps (5), (3) and (4) are repeated in sequence. During the repeated screening process, the incubation time of the sequence used as the initial random single-stranded DNA library with the target cells is gradually shortened to 1 hour, and the number of washes is gradually increased to 5 times to ensure that the enriched library has a strong binding ability with the target cells. During the screening process, the libraries of different screening rounds are PCR amplified using a forward primer labeled with a Cy3 fluorescent group and a reverse primer labeled with biotin, and the amplified products are subjected to a magnetic bead method to separate the single strands (step (4)) to obtain a binding sequence enrichment library, and the binding ability of the binding sequence enrichment library with the target cell RA-FLSs and the control cells (hFOB1.19 and THP-1) is detected using an ELISA instrument.

[0238] Specifically, the binding sequence enrichment library of different screening rounds (0, 4, 8, 12) was incubated with RA-FLSs, hFOB1.19 or THP-1 at 37°C for 3 hours. Figure 2 As shown in A. The results show that as the number of screening rounds proceeds, the binding ability of the binding sequence enriched library to the target cell RA-FLSs gradually increases and there is no obvious binding to the control cells (hFOB1.19 and THP-1). Repeat multiple rounds of the above screening until the binding ability of the binding sequence enriched library to the target cells no longer increases and there is no obvious binding to the control cells. The above process is the CS-SELEX screening module in CSCT-SELEX. The optimal binding sequence enriched library enriched by the above process is used for the CT-SELEX screening module in the following CSCT-SELEX.

[0239] (7) Screening for enriched induced single-chain library that induces apoptosis of target cells: The optimal binding sequence enriched library enriched by the above process was heated at 95°C for 5 minutes, placed on ice for 10 minutes, and then put into the culture medium and mixed with 5×10 6 The target cells were incubated for 72 hours, and the medium was changed every 24 hours. The final concentration of the binding sequence enrichment library was 1000nM. Apoptotic cells were sorted using magnetic beads based on annexin-V. The apoptotic cells sorted above were resuspended in 400μL binding buffer, heated at 95℃ for 5 minutes to elute the sequences that bound to apoptotic cells and entered apoptotic cells and placed on ice for 10 minutes. Centrifuged to obtain the supernatant.

[0240] (8) Magnetic bead method to separate the enriched induced single-stranded library that induces apoptosis of target cells: Use the above forward primer and the reverse primer labeled with 5' biotin to perform PCR amplification on the collected supernatant. First, take part of the supernatant and use the cycle number gradient experiment to determine the optimal cycle number for amplification, and then select the optimal cycle number to perform PCR amplification on the remaining supernatant. The amplified double-stranded DNA product is incubated with streptavidin magnetic beads at room temperature for 0.5 hours. The biotin on the double-stranded DNA product binds to the streptavidin magnetic beads and is fixed on the surface of the magnetic beads. Place the magnetic beads on a magnetic rack, wait for magnetic liquid separation, remove the supernatant, and wash the magnetic beads 3 times with DPBS. In order to separate the single-stranded DNA enriched library for the next round of screening, add 500μL 100mM NaOH solution to the magnetic beads, react for 15 minutes, place the magnetic beads on a magnetic rack, wait for magnetic liquid separation, a single DNA strand with biotin remains on the streptavidin magnetic beads, and a single DNA strand without biotin remains in the supernatant. The supernatant was collected, neutralized with 1 M acetic acid solution, and added to a desalting column for desalting to obtain an enriched induced single-stranded library.

[0241] (9) Multiple rounds of screening for aptamers that induce apoptosis of target cells: The enriched induced single-chain library was used as the binding sequence enriched library to repeat the above steps (7) and (8) in sequence, and the final concentration of the enriched sequence added in each round was adjusted to 400nM. During the screening process, magnetic bead sorting based on annexin-V was used to detect the ability of the enriched induced single-chain library to induce apoptosis of target cells RA-FLSs and control cells (hFOB1.19 and THP-1). Specifically: 400nM of the enriched induced single-chain library with different screening rounds (1, 3, 6, 9 rounds) was incubated with RA-FLSs, hFOB1.19 or THP-1 at 37°C for 72 hours, and the medium was changed every 24 hours. The replaced culture medium contained 400nM of the above-mentioned library with different screening rounds. The results are as follows: Figure 2 As shown in B. The results show that as the number of screening rounds proceeds, the ability of the enriched induced single-chain library to induce apoptosis of target cells RA-FLSs gradually increases and cannot induce obvious apoptosis of control cells (hFOB1.19 and THP-1). Repeat multiple rounds of the above screening until the enriched library no longer increases its ability to induce apoptosis of target cells and cannot induce obvious apoptosis of control cells. The above (7) to (9) are the CT-SELEX screening modules in CSCT-SELEX. Finally, the obtained enriched induced single-chain library is cloned and sequenced to obtain a killing aptamer that can be used to screen for targeted activation of synovial fibroblasts.

[0242] The obtained aptamers include SEQ ID NO: 1 (SAPT4) and SEQ ID NO: 2 (SAPT8).

[0243] Example 2: Binding of the Optimal Aptamer to Target Cells and Control Cells

[0244] (1) The single-stranded DNA library finally enriched by the above CSCT-SELEX screening was cloned and sequenced, and the sequences with high enrichment (SAPT4 and SAPT8) and the negative control (NC) sequence were selected and labeled with Cy3 fluorescent group at the 5' end. The NC sequence is shown in SEQ ID NO: 6, SEQ ID NO: 6: 5'-GGAATTCCCGGTGCGCCGATCGCCGGATATAACTT-3'. SAPT4, SAPT8 and NC were all synthesized by Shanghai Sangon Biotechnology Co., Ltd. 200nM SAPT4 and SAPT8 or NC sequences were incubated with target cells RA-FLSs or control cells (hFOB1.19, THP-1 and human skin normal fibroblast cell line BJ) at 37°C for 3 hours, and the binding of SAPT4, SAPT8 and NC to RA-FLSs, hFOB1.19, THP-1 or BJ cells was detected by flow cytometry. The results are shown in Figure 2. Figure 3The results show that SAPT4 and SAPT8 have obvious binding to RA-FLSs, but not to hFOB1.19, THP-1 or BJ cells, compared with NC.

[0245] (2) SAPT4 or SAPT8 labeled with 200 nM Cy3 fluorescent group was incubated with RA-FLSs at 37°C, and the binding of SAPT4 or SAPT8 to RA-FLSs was detected by flow cytometry at a time gradient of 0, 1, 3, and 6 hours. The results are shown in Figure 2. Figure 3 C. The results show that as the incubation time increases, the binding ability of SAPT4 or SAPT8 to RA-FLSs gradually becomes stronger.

[0246] (3) SAPT4 or SAPT8 labeled with Cy3 fluorescent group at different concentrations (0, 50, 100, 200, 400 nM) was incubated with RA-FLSs. After incubation for 3 hours, the binding of SAPT4 or SAPT8 to RA-FLSs was detected by flow cytometry. The results are shown in Figure 2. Figure 3 D. The results show that as the concentration increases, the binding ability of SAPT4 or SAPT8 to RA-FLSs gradually becomes stronger.

[0247] (4) SAPT4 or SAPT8 labeled with Cy3 fluorescent group at different concentrations (0, 25, 50, 100, 200, 400, 600, 800, 1000, 1400 nM) was incubated with RA-FLSs. After 3 hours of incubation, the binding of SAPT4 or SAPT8 to RA-FLSs was detected by flow cytometry, and the equilibrium dissociation constant Kd was calculated. The larger the Kd, the smaller the affinity. Conversely, the smaller the Kd, the stronger the affinity. The results are shown in Figure 2. Figure 3 E. The results showed that the Kd value of SAPT4 was 101.7±29.6 nM, and the Kd value of SAPT8 was 71.2±15.0 nM.

[0248] Example 3. Ability and secondary structure of the optimal aptamer to induce apoptosis of target cells and control cells

[0249] (5) RA-FLSs, hFOB1.19, THP-1 or BJ cells were incubated with 400 nM of the above-mentioned SAPT4, SAPT8 and NC sequences at 37°C, and the culture medium containing 400 nM of the above-mentioned SAPT4, SAPT8 and NC sequences was replaced every 24 hours. After incubation for 72 hours, the proportion of apoptotic cells was detected by flow cytometry, and the results were as follows: Figure 4As shown in A. The results showed that compared with NC, SAPT4 and SAPT8 can induce apoptosis of RA-FLSs, but have no effect on apoptosis of hFOB1.19, THP-1 and BJ cells. Therefore, SAPT4 and SAPT8 are specific and lethal aptamers targeting activated synovial fibroblasts. The SAPT4 sequence is shown in SEQ ID NO: 1, SEQ ID NO: 1: 5'-TTCGTTTGGCGTAGCTATTCGATCTGGTTACCCAC-3'; the SAPT8 sequence is shown in SEQ ID NO: 2, SEQ ID NO: 2: 5'-CCGGCTGCTGCGGCATCGGGCTAGATATCGAT-3'. The secondary structures of SAPT4 and SAPT8 were predicted using RNAstructure software, as shown in Figure 4 As shown in B.

[0250] Further, those skilled in the art know that the SAPT4 sequence and SAPT8 sequence can be transformed and modified without affecting their basic functions, that is, specifically targeting and killing activated synovial fibroblasts, to obtain corresponding derivatives. For example, the derivatives of the SAPT4 sequence include: derivatives obtained by modifying at least one base of the SAPT4 sequence, sequences with a homology of more than 60% with the SAPT4 sequence, sequences hybridized with the SAPT4 sequence, thiophosphate backbone sequences derived from the backbone of the SAPT4 sequence, and peptide nucleic acids transformed from the SAPT4 sequence; the derivatives of the SAPT8 sequence include: derivatives obtained by modifying at least one base of the SAPT8 sequence, sequences with a homology of more than 60% with the SAPT8 sequence, sequences hybridized with the SAPT8 sequence, thiophosphate backbone sequences derived from the backbone of the SAPT8 sequence, and peptide nucleic acids transformed from the SAPT8 sequence.

[0251] Phosphorothioate modification is the simplest and most widely used chemical modification that can be applied to increase nuclease resistance. Unmodified nucleic acid aptamers can show activity, but they will be rapidly degraded by nucleases, so their effect is limited. On the phosphate backbone of oligonucleotides, the phosphorothioate bond replaces the non-bridging oxygen atom with a sulfur atom, making the internucleotide bond resistant to nuclease degradation and more stable. Peptide nucleic acids (PNA) are a class of DNA analogs that replace the sugar phosphate backbone with a polypeptide backbone. The neutral peptide chain amide 2-aminoethylglycine bond replaces the pentose phosphodiester bond backbone in DNA, and the rest is the same as DNA. PNA can recognize and bind to DNA or RNA sequences through Watson-Crick base pairing to form a stable double helix structure. It has high hybridization stability, excellent specific sequence recognition ability, is not hydrolyzed by nucleases and proteases, and can be linked to ligands and co-transfected into cells.

[0252] Therefore, the derivative of the SAPT4 sequence is preferably a phosphorothioate backbone sequence derived from the backbone of the SAPT4 sequence, or a peptide nucleic acid transformed from the SAPT4 sequence; the derivative of the SAPT8 sequence is preferably a phosphorothioate backbone sequence derived from the backbone of the SAPT8 sequence, or a peptide nucleic acid transformed from the SAPT8 sequence. Those skilled in the art can prepare the aforementioned phosphorothioate backbone sequence and peptide nucleic acid using conventional methods in the art, which will not be described here.

[0253] Preferably, the at least one base is modified to include phosphorylation, methylation, amination, sulfhydrylation or isotopization, or is replaced with locked nucleic acid, non-locked nucleic acid or glycol nucleic acid, morpholino nucleic acid, peptide nucleic acid, threose nucleic acid or bridged nucleic acid. Preferably, a functional group can be connected to the 3' end, 5' end or middle base of the SAPT4 sequence or its derivative or the SAPT8 sequence or its derivative. The functional group includes at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxin, a nanoluminescent material, a nucleic acid substance or an enzyme marker.

[0254] Those skilled in the art can obtain the aforementioned derivatives of the SAPT4 sequence and the derivatives of the SAPT8 sequence based on any known methods and techniques.

[0255] Embodiment 4

[0256] SAPT4 sequence derivatives and SAPT8 sequence derivatives can specifically target and kill activated synovial fibroblasts

[0257] SAPT4 sequence derivatives include but are not limited to the following sequences:

[0258] SAPT4A (SEQ ID NO: 7): TCGTTTGGCGTAGCTATTCGATCTGGTTACCCA

[0259] SAPT4B (SEQ ID NO: 8): TTCGAATGGCGTAGCTAAACGATCTGGTTACCCAC

[0260] SAPT4C (SEQ ID NO: 9): TCGAATGGCGTAGCTAAACGATCTGGTTACCCA

[0261] SAPT4D (SEQ ID NO: 10): TTCGTTTGGCGTAGCTATTCGATCTGGTTACCCACTTTTTT

[0262] SAPT4E (SEQ ID NO: 11): AAAAAATTCGTTTGGCGTAGCTATTCGATCTGGTTACCCAC

[0263] Derivatives of the SAPT8 sequence include, but are not limited to, the following sequences:

[0264] SAPT8A (SEQ ID NO: 12): CCGGCTGCTGCGGCATCGGGCTAGATATC

[0265] SAPT8B (SEQ ID NO: 13): CCGGCTGCTGCGGCATCGGGCTAGA

[0266] SAPT8C (SEQ ID NO: 14): CCGGCTGCTGCGGCATCGGGCT

[0267] SAPT8D (SEQ ID NO: 15): CCGGCTGCTGCGGCATCGG

[0268] SAPT8E (SEQ ID NO: 16): CCGAATGCTGCGGCAACGGGCTAGATATCGAT

[0269] SAPT8F (SEQ ID NO: 17): CCGTTTGCTGCGGCATCGGGCTAGATATCGAT

[0270] SAPT8G (SEQ ID NO: 18): CCCCCCCCGGCTGCTGCGGCATCGGGCTAGATATCGAT

[0271] SAPT8H (SEQ ID NO: 19): CCCCCGGCTGCTGCGGCATCGGGCTAGATATCGAT

[0272] SAPT8I (SEQ ID NO: 20):AAAAAAACCGGCTGCTGCGGCATCGGGCTAGATATCGAT

[0273] SAPT8J (SEQ ID NO: 21): CCGGCTGCTGCGGCATCGGGCTAGATATCGATAAAAAA

[0274] (1) 200 nM of the above SAPT4 derivatives or NC sequences were incubated with target cells RA-FLSs and control cells (hFOB1.19 and THP-1) at 37°C for 3 hours, and the binding of SAPT4 derivatives and NC to RA-FLSs, hFOB1.19, and THP-1 was detected by flow cytometry. The results are as follows: Figure 5 As shown in A. The results show that compared with NC, SAPT4 derivatives have obvious binding to RA-FLSs, but no binding to hFOB1.19 and THP-1 cells.

[0275] (2) 400 nM of the above SAPT4 derivatives and NC sequences were incubated with RA-FLSs, hFOB1.19, and THP-1 at 37°C, and the culture medium containing 400 nM of the above SAPT4 derivatives and NC sequences was replaced every 24 hours. After incubation for 72 hours, the proportion of apoptotic cells was detected by flow cytometry, and the results were as follows: Figure 5 As shown in B. The results showed that, compared with NC, SAPT4 derivatives could induce apoptosis of RA-FLSs, but had no effect on apoptosis of hFOB1.19 and THP-1 cells.

[0276] (3) 200 nM of the above SAPT8 derivatives or NC sequences were incubated with target cells RA-FLSs and control cells (hFOB1.19 and THP-1) at 37°C for 3 h, and the binding of SAPT8 derivatives and NC to RA-FLSs, hFOB1.19, and THP-1 was detected by flow cytometry. The results are as follows: Figure 5 C. The results showed that compared with NC, SAPT8 derivatives had obvious binding to RA-FLSs, but no binding to hFOB1.19 and THP-1 cells.

[0277] (4) 400 nM of the above SAPT8 derivatives and NC sequences were incubated with RA-FLSs, hFOB1.19, and THP-1 at 37°C, and the culture medium containing 400 nM of the above SAPT8 derivatives and NC sequences was replaced every 24 hours. After incubation for 72 hours, the proportion of apoptotic cells was detected by flow cytometry, and the results were as follows: Figure 5 D. The results showed that, compared with NC, SAPT8 derivatives could induce apoptosis of RA-FLSs, but had no effect on apoptosis of hFOB1.19 and THP-1 cells.

[0278] Example 5 Effects of SAPT4 and SAPT8 on the growth, migration, invasion and production of inflammatory factors in RA-FLSs

[0279] (1) RA-FLSs were incubated with 400 nM SAPT4, SAPT8, and NC sequences at 37°C, and a cell counting experiment was performed using CCK-8 (Cell Counting Kit-8). During the experiment, the culture medium containing 400 nM SAPT4, SAPT8, or NC sequence was replaced every day. The absorbance at 450 nm was measured using an ELISA reader every day. The results are shown in Table 1. Figure 6 As shown in A. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the cell growth of RA-FLSs.

[0280] (2) 400 nM SAPT4, SAPT8 and NC sequences were incubated with RA-FLSs at 37°C for invasion (Transwell) and migration experiments. When conducting the invasion experiment, the polycarbonate membrane invasion upper chamber used in the experiment was pre-cooled, and the basement membrane matrix (Matrigel) gel was diluted with serum-free culture medium and added to the upper chamber. The laid gel was placed in an incubator to allow it to fully solidify. The cells treated with SAPT4, SAPT8 and NC sequences were diluted with serum-free culture medium and added to the upper chamber. Culture medium containing 20% ​​serum was added to the lower chamber, and the chamber was placed in a 37°C incubator for culture to induce the cells to penetrate the matrix gel. After 48 hours of culture, the matrix gel and cells in the upper chamber were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet dye for 30 minutes, washed three times with PBS, photographed, and the cells were counted using the software Image J. When conducting the migration experiment, there is no need to lay the basement membrane matrix gel in advance. The other steps are the same as above, and the results are as follows. Figure 6 As shown in B-6C. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the cell invasion and migration of RA-FLSs.

[0281] (3) RA-FLSs were incubated with 400 nM SAPT4, SAPT8, and NC sequences at 37°C, and the levels of inflammatory factors (MMP3, IL-1β) were detected by immunoblotting after 24 hours. Figure 6 D. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the production of inflammatory factors in RA-FLSs.

[0282] Similarly, the aforementioned derivatives of the SAPT4 sequence and the derivatives of the SAPT8 sequence can also inhibit the growth of RA-FLSs, the cell invasion and migration of RA-FLSs, and the production of inflammatory factors of RA-FLSs.

[0283] Example 6. Binding of SAPT4 and SAPT8 to human synovial sarcoma and their effects on apoptosis, growth, migration and invasion

[0284] (1) SAPT4, SAPT8 and NC sequences labeled with 200 nM Cy3 fluorescent group were incubated with human synovial sarcoma cells SW982 at 37°C. After 3 hours, flow cytometry was used to detect the binding of SAPT4, SAPT8 and NC sequences to SW982. The results showed that compared with NC, SAPT4 and SAPT8 could bind to SW982. Figure 7 A.

[0285] (2) SW982 was incubated with 400 nM SAPT4, SAPT8 and NC sequences at 37°C, and the culture medium containing 400 nM SAPT4, SAPT8 and NC sequences was replaced every 24 hours. After 72 hours of incubation, the proportion of apoptotic cells was detected by flow cytometry. The results showed that compared with NC, both SAPT4 and SAPT8 could induce apoptosis of SW982. Figure 7 B.

[0286] (3) SW982 cells were incubated with 400 nM SAPT4, SAPT8 and NC sequences at 37°C, and a CCK-8 cell counting experiment was performed. During the experiment, the culture medium containing 400 nM SAPT4, SAPT8 or NC sequence was replaced every day. The absorbance value at 450 nm was measured by a microplate reader every day. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the cell growth of SW982 cells. Figure 7 C.

[0287] (4) 400 nM SAPT4, SAPT8 and NC sequences were incubated with SW982 at 37°C for invasion and migration experiments. When conducting the invasion experiment, the polycarbonate membrane invasion upper chamber used in the experiment was pre-cooled, and the basement membrane matrix gel was diluted with serum-free culture medium and added to the upper chamber. The laid gel was placed in an incubator to allow it to fully solidify. The cells treated with SAPT4, SAPT8 and NC sequences were diluted with serum-free culture medium and added to the upper chamber. Culture medium containing 10% serum was added to the lower chamber and placed in a 37°C incubator for culture to induce the cells to penetrate the matrix gel. After 48 hours of culture, the matrix gel and cells in the upper chamber were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet dye for 30 minutes, washed with PBS three times, photographed, and counted using Image J software. When conducting the migration experiment, basement membrane matrix gel does not need to be laid in advance, and the other steps are the same as above. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the invasion and migration of SW982 cells. Figure 7 D and 7E.

[0288] Similarly, the aforementioned derivatives of the SAPT4 sequence and the derivatives of the SAPT8 sequence can also bind to human synovial sarcoma cells, induce their apoptosis, and inhibit their growth, migration and invasion.

[0289] Example VII. Binding of SAPT4 and SAPT8 to rat activated synovial fibroblasts and their effects on apoptosis, growth, migration and invasion

[0290] (1) The collagen-induced arthritis (CIA) rat model is one of the commonly used animal models to simulate human rheumatoid arthritis. SAPT4, SAPT8 and NC sequences labeled with 200 nM Cy3 fluorescent group were incubated with activated synovial fibroblasts (CIA-RFLSs) from collagen-induced arthritis (CIA) rats at 37°C. After 3 hours, flow cytometry was used to detect the binding of SAPT4, SAPT8 and NC sequences to CIA-RFLSs. The results are shown in Figure 2. Figure 8 As shown in A. This result shows that, in contrast to NC, both SAPT4 and SAPT8 can bind to CIA-RFLSs.

[0291] (2) 400 nM SAPT4, SAPT8, and NC sequences were incubated with CIA-RFLSs at 37°C, and the culture medium containing 400 nM SAPT4, SAPT8, and NC sequences was replaced every 24 hours. After 72 hours of incubation, the proportion of apoptotic cells was detected by flow cytometry. The results are as follows: Figure 8As shown in B. The results showed that compared with NC, both SAPT4 and SAPT8 could induce apoptosis of CIA-RFLSs.

[0292] (3) 400 nM SAPT4, SAPT8 and NC sequences were incubated with CIA-RFLSs at 37°C and the cell counting CCK-8 experiment was performed. During the experiment, the culture medium containing 400 nM SAPT4, SAPT8 or NC sequence was replaced every day. The absorbance value at 450 nm was measured by microplate reader every day. The results are as follows: Figure 8 C. The results showed that both SAPT4 and SAPT8 could inhibit the cell growth of CIA-RFLSs compared with NC.

[0293] (4) 400nM SAPT4, SAPT8 and NC sequences were incubated with CIA-RFLSs at 37°C to perform invasion and migration experiments. When conducting invasion experiments, the polycarbonate membrane invasion upper chamber used in the experiment was pre-cooled, and the basement membrane matrix gel was diluted with serum-free culture medium and added to the upper chamber. The laid gel was placed in an incubator to allow it to fully solidify. The cells treated with SAPT4, SAPT8 and NC sequences were diluted with serum-free culture medium and added to the upper chamber. Culture medium containing 10% serum was added to the lower chamber, and the chamber was placed in a 37°C incubator for culture to induce the cells to penetrate the matrix gel. After 48 hours of culture, the matrix gel and cells in the upper chamber were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet dye for 30 minutes, washed three times with PBS, photographed, and the cells were counted using the software Image J. When conducting migration experiments, there is no need to lay basement membrane matrix gel in advance. The other steps are the same as above, and the results are as follows. Figure 8 D and 8E. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the cell invasion and migration of CIA-RFLSs.

[0294] Similarly, the aforementioned derivatives of the SAPT4 sequence and the derivatives of the SAPT8 sequence can also bind to rat activated synovial fibroblasts, induce their apoptosis, and inhibit their growth, migration, and invasion.

[0295] Example 8. Binding of SAPT4 and SAPT8 to mouse activated synovial fibroblasts and their effects on apoptosis, growth, migration and invasion

[0296] (1) The collagen-induced arthritis (CIA) mouse model is also one of the commonly used animal models to simulate human rheumatoid arthritis. SAPT4, SAPT8 and NC sequences labeled with 200 nM Cy3 fluorescent group were incubated with activated synovial fibroblasts (CIA-MFLSs) from collagen-induced arthritis (CIA) mice, normal synovial fibroblasts (H-MFLSs) from healthy mice, mouse osteoblast cell line MC3T3-E1, and mouse osteoclast cell line RAW264.7 at 37°C. After 3 hours, flow cytometry was used to detect the binding of SAPT4, SAPT8 and NC sequences with CIA-MFLSs, H-MFLSs, MC3T3-E1, and RAW264.7. The results are shown in Figure 2. Fig. 9 As shown in A. The results show that, compared with NC, both SAPT4 and SAPT8 can bind to CIA-MFLSs. SAPT8 and SAPT4 cannot bind to H-MFLSs, MC3T3-E1, and RAW264.7.

[0297] (2) 400 nM SAPT4, SAPT8 and NC sequences were incubated with CIA-MFLSs or H-MFLSs at 37°C, and the culture medium containing 400 nM SAPT4, SAPT8 and NC sequences was replaced every 24 hours. After 72 hours of incubation, the proportion of apoptotic cells was detected by flow cytometry. The results showed that compared with NC, both SAPT4 and SAPT8 could induce apoptosis in CIA-MFLSs, see Fig. 9 B. SAPT8 and SAPT4 cannot induce apoptosis of H-MFLSs, see Fig. 9 C.

[0298] (3) 400 nM SAPT4, SAPT8 and NC sequences were incubated with CIA-MFLSs at 37°C and the cell counting CCK-8 experiment was performed. During the experiment, the culture medium containing 400 nM SAPT4, SAPT8 or NC sequence was replaced every day. The absorbance value at 450 nm was measured by microplate reader every day. The results are as follows: Fig. 9 D. The results showed that both SAPT4 and SAPT8 could inhibit the cell growth of CIA-MFLSs compared with NC.

[0299] (4) 400nM SAPT4, SAPT8 and NC sequences were incubated with CIA-MFLSs at 37°C for invasion and migration experiments. When conducting invasion experiments, the polycarbonate membrane invasion upper chamber used in the experiment was pre-cooled, and the basement membrane matrix gel was diluted with serum-free culture medium and added to the upper chamber. The laid gel was placed in an incubator to allow it to fully solidify. The cells treated with SAPT4, SAPT8 and NC sequences were diluted with serum-free culture medium and added to the upper chamber. Culture medium containing 10% serum was added to the lower chamber, and the chamber was placed in a 37°C incubator for culture to induce the cells to penetrate the matrix gel. After 48 hours of culture, the matrix gel and cells in the upper chamber were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet dye for 30 minutes, washed three times with PBS, photographed, and the cells were counted using the software Image J. When conducting migration experiments, there is no need to lay basement membrane matrix gel in advance. The other steps are the same as above, and the results are as follows. Fig. 9 E and 9F. The results showed that compared with NC, both SAPT4 and SAPT8 could inhibit the cell invasion and migration of CIA-MFLSs.

[0300] Similarly, the aforementioned derivatives of the SAPT4 sequence and the derivatives of the SAPT8 sequence can also bind to mouse activated synovial fibroblasts, induce their apoptosis, and inhibit their growth, migration, and invasion.

[0301] Example 9: Tissue distribution of SAPT4 and SAPT8 in CIA mouse model

[0302] Bovine type II collagen was used to immunize 6-8 week old male DBA / 1 mice, and the CIA mouse model was established and administered. The method is as follows: Bovine type II collagen (2 mg / mL) was emulsified in an equal volume of complete Freund's adjuvant. Mycobacterium tuberculosis was contained in the emulsifier at a final concentration of 2 mg / kg. 100 μL of emulsifier was taken for a single subcutaneous immunization at the tail heel of the mouse. After 28 days, the mice began to become ill. After another 28 days, 5 mg / kg of SAPT8 or NC sequence labeled with Cy3 fluorescent group was injected into the tail vein. After 24 hours, the mice or dissected tissues were placed in a small animal in vivo imaging system to detect the in vivo fluorescence distribution. The results are shown as follows. Fig.10 As shown in A. The results showed that compared with NC, SAPT8 was significantly enriched in the diseased paws of CIA mice. The heart, liver, spleen, lung, kidney, synovium and hind limbs of mice were removed for fluorescence detection, and the results were shown in Fig.10 As shown in B. The results showed that at the tissue level, compared with NC, SAPT8 had a significant fluorescence distribution in the synovial tissue and diseased paws, and SAPT8 was less distributed in the liver and kidney.

[0303] The same experiment was performed on SAPT4, and the results were similar to those of SAPT8. SAPT4 was also significantly enriched in the paws and synovium of mice. The same experiment was performed on derivatives of SAPT4 and SAPT8, and the results also showed that derivatives of SAPT4 and SAPT8 were also significantly enriched in the paws and synovium of mice.

[0304] Example 10. Therapeutic effects of SAPT4 and SAPT8 in CIA mouse model

[0305] Bovine type II collagen was used to immunize 6-8 week old male DBA / 1 mice, and a CIA mouse model was established and administered. The method is as follows: Bovine type II collagen (2 mg / mL) was emulsified in an equal volume of complete Freund's adjuvant, and the final concentration of Mycobacterium tuberculosis contained in the emulsifier was 2 mg / kg. Take 100 μL of emulsifier for a single subcutaneous immunization at the heel of the mouse tail. After 28 days, the mice began to develop the disease. PBS, SAPT8, NC sequence, TNF monoclonal antibody Etanercept, and a combination of Etanercept and SAPT8 or NC sequence were administered respectively. SAPT8 or NC sequence was administered via the tail vein at a dose of 30 mg / kg, and the administration cycle was twice a week. Etanercept was administered intraperitoneally at a dose of 5 mg / kg, and the administration cycle was twice a week. After 39 days of administration, the mice were killed to evaluate the therapeutic effect of the above-mentioned administration on CIA mice. The experimental design is as follows. Fig.11 As shown in A. The mice were scored for arthritis, and the results were shown in Fig.11 As shown in B; the mouse paw was scanned by micro-CT, and the results are as follows Fig.11 C; The histological analysis of ankle joint sections after hematoxylin-eosin and safranin O-fast green staining included synovitis score, bone destruction score and cartilage destruction score. Fig.11 These results consistently showed that compared with NC, SAPT8 could significantly inhibit the disease progression, synovitis, bone destruction and cartilage destruction in the CIA mouse model, and the therapeutic effect of SAPT8 was similar to that of etanercept. The combined administration of SAPT8 and etanercept could more effectively inhibit the onset of CIA mice.

[0306] The same experiment was performed on SAPT4, and the results were similar to those of SAPT8, that is, SAPT4 could significantly inhibit disease progression, synovitis, bone destruction and cartilage destruction in the CIA mouse model. The therapeutic effect of SAPT4 was similar to that of etanercept. The combined administration of SAPT4 and etanercept could more effectively inhibit the onset of CIA mice.

[0307] The above experiments were also performed on derivatives of SAPT4 and SAPT8, and the results also showed that derivatives of SAPT4 and SAPT8 can also significantly inhibit disease progression, synovitis, bone destruction and cartilage destruction in the CIA mouse model, and their therapeutic effects are similar to those of etanercept. In addition, their combined administration with etanercept can more effectively inhibit the onset of CIA mice.

[0308] In other preferred embodiments of the present invention, other therapeutic drugs for rheumatoid arthritis and / or ankylosing spondylitis are used, such as traditional disease-modulating antirheumatic drugs such as methotrexate, leflunomide, hydroxychloroquine and sulfasalazine, biological disease-modulating antirheumatic drugs such as abatacept, adalimumab, anakinra, becelizumab, etanercept, golimumab, infliximab, rituximab, salilumab and tocilizumab; targeted synthetic disease-modulating antirheumatic drugs such as baricitinib, tofacitinib and upadacitinib, non-steroidal anti-inflammatory drugs such as ibuprofen, diclofenac, indomethacin, meloxicam, celecoxib, etc.; immunosuppressants such as ciproamide, azathioprine, mycophenolate mofetil, cyclosporine, etc.; glucocorticoids such as prednisone, prednisone, triamcinolone acetonide, etc., and a similar method is used to combine with SAPT4 and its derivatives or SAPT8 and its derivatives to effectively inhibit the onset of CIA mice.

[0309] Example 11: Binding of SAPT4 and SAPT8 to OA-FLSs and their effects on apoptosis, growth, migration and invasion

[0310] (1) SAPT8 and NC sequences labeled with 200 nM Cy3 fluorescent group were incubated with activated synovial fibroblasts (OA-FLSs) from osteoarthritis (OA) patients at 37°C. After 3 hours, the binding of SAPT8 and NC sequences to OA-FLSs was detected by flow cytometry. The results are as follows: Fig.12 As shown in A. This result indicates that SAPT8 can bind to OA-FLSs in contrast to NC.

[0311] (2) OA-FLSs were incubated with 400 nM SAPT8 and NC sequence at 37°C, and the culture medium containing 400 nM SAPT8 and NC sequence was replaced every 24 hours. After 96 hours of incubation, the proportion of apoptotic cells was detected by flow cytometry. The results are as follows: Fig.12 As shown in B. The results showed that, compared with NC, SAPT8 could induce apoptosis of OA-FLSs.

[0312] (3) OA-FLSs were incubated with 400 nM SAPT8 and NC sequence at 37°C for cell clone formation experiments. During the experiment, the culture medium containing 400 nM SAPT8 or NC sequence was replaced every day for a total of 14 days. The absorbance at 450 nm was measured by an ELISA reader every day. The results are as follows: Fig.12 C. The results showed that SAPT8 could inhibit the cell growth of OA-FLSs compared with NC.

[0313] (4) OA-FLSs were incubated with 400 nM SAPT8 and NC sequences at 37°C for invasion and migration experiments. When conducting the invasion experiment, the polycarbonate membrane invasion upper chamber used in the experiment was pre-cooled, and the basement membrane matrix gel was diluted with serum-free culture medium and added to the upper chamber. The laid gel was placed in an incubator to allow it to fully solidify. The cells treated with SAPT8 and NC sequences were diluted with serum-free culture medium and added to the upper chamber. Culture medium containing 10% serum was added to the lower chamber, and the chamber was placed in a 37°C incubator for culture to induce the cells to penetrate the matrix gel. After 48 hours of culture, the matrix gel and cells in the upper chamber were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet dye for 30 minutes, washed three times with PBS, photographed, and the cells were counted using the software Image J. When conducting the migration experiment, there is no need to lay the basement membrane matrix gel in advance. The other steps are the same as above, and the results are as follows. Fig.12 D and 12E. The results showed that SAPT8 could inhibit the cell invasion and migration of OA-FLSs compared with NC.

[0314] Similarly, the aforementioned SAPT4 sequence and its derivatives and the derivatives of the SAPT8 sequence can also bind to OA-FLSs, induce their apoptosis, and inhibit their growth, migration, and invasion.

[0315] Example 12: The therapeutic effects of SAPT4 and SAPT8 in a DMM-induced osteoarthritis mouse model

[0316] The destabilization of the medial meniscus (DMM) mouse model is a commonly used animal model to simulate human osteoarthritis. Male C57BL / 6J mice aged 6-8 weeks underwent DMM surgery or sham surgery. On the 8th day after surgery, DMM mice were injected with PBS, NC sequence or SAPT8 into the joint cavity. The drug administration was terminated on the 56th day, and the mice were killed to evaluate the treatment effect. The experimental design was as follows: Fig.13 A. Micro-CT scans were performed on the knee joints of mice to observe the formation of osteophytes. The results are shown in Fig.13B; The histological analysis of the knee joint sections after hematoxylin-eosin staining and safranin O-fast green staining included synovitis score, OARSI score and cartilage degeneration score. Fig.13 C. These results consistently showed that SAPT8 could significantly inhibit osteophyte formation, synovitis, and cartilage degeneration in the DMM mouse model compared with NC.

[0317] The same experiment was performed on SAPT4, and the results were similar to those of SAPT8, which also significantly inhibited osteophyte formation, synovitis, and cartilage degeneration in the DMM mouse model. The same experiment was performed on derivatives of SAPT4 and SAPT8, and the results also showed that derivatives of SAPT4 and SAPT8 also significantly inhibited osteophyte formation, synovitis, and cartilage degeneration in the DMM mouse model.

[0318] In the present invention, there is no need to accurately understand the molecular and structural information on the surface of target cells. The aptamers screened by CSCT-SELEX can be used as specific and lethal aptamers for target cells and directly used in disease treatment to reduce toxic side effects. The screened aptamers can also be used for biomarker discovery, cell recognition and sorting, biosensing, bioimaging, disease diagnosis and targeted drug delivery.

[0319] Based on the above disclosure, those skilled in the art know that the aforementioned specific and lethal aptamers SAPT4 and SAPT8 targeting target cells and their derivatives can be used for the prevention and / or treatment of target cell-related diseases (especially diseases that are beneficial to the treatment of by killing target cells), and can also be used for target cell biomarker discovery, target cell identification and sorting, biosensing, bioimaging, disease diagnosis and targeted drug delivery. Preferably, the target-related diseases include synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis, ankylosing spondylitis or tumors.

[0320] Further, based on the above disclosure, a person skilled in the art can further prepare a drug, comprising the above-mentioned specific and lethal aptamer, and the drug is used for the prevention and / or treatment of target cell-related diseases. The target cell-related diseases include synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis, ankylosing spondylitis or tumors. Further, based on the above disclosure, a person skilled in the art can further prepare a drug for the treatment of target cell-related diseases, comprising the above-mentioned specific and lethal aptamer and other therapeutic drugs, including but not limited to non-steroidal anti-inflammatory drugs, corticosteroid drugs, disease-modifying anti-rheumatic drugs, local joint medications, systemic analgesics, intra-articular injection drugs, disease-modifying drugs, and chondroprotective agents and / or anti-tumor drugs. The specific and lethal aptamer can preferably be administered in combination with etanercept.

[0321] Example 13: Aptamer targeting NCL

[0322] This example takes SAPT8 as an example to verify the targeting relationship between the aptamer of the present invention and NCL.

[0323] (1) 1 μM 5'-end biotin-labeled SAPT8 and NC sequences were incubated with the membrane proteins of RA-FLSs at 4°C, and streptavidin agarose gel beads were added after 6 hours and incubated overnight at 4°C. The biotin-labeled SAPT8 and NC sequences and their interacting proteins bound to the gel beads were washed several times with IP lysis buffer, and then SDS-PAGE protein loading buffer was added and heated to 100°C for 10 minutes. After centrifugation, the supernatant was separated by SDS-PAGE electrophoresis, and the separated protein gel was silver stained according to the steps of the silver staining kit. The results are shown in the figure. Fig.14 A. The results show that SAPT8 specifically interacts with proteins with a molecular weight between 100-130 kDa, while NC does not capture any specific proteins compared to SAPT8. The SAPT8 interacting protein bands were analyzed by mass spectrometry and the candidate protein NCL was identified. Fig.14 As shown in B.

[0324] (2) 1 μM 5'-end biotin-labeled NC and SAPT8 sequences were incubated with RA-FLSs at 37°C for 8 hours. They were then lysed with IP lysis buffer, and streptavidin agarose beads were added and incubated overnight at 4°C. The biotin-labeled SAPT8 and NC sequences and their interacting proteins bound to the gel beads were washed multiple times with IP lysis buffer, and then SDS-PAGE protein loading buffer was added and heated to 100°C for 10 minutes. After centrifugation, the supernatant was taken, which was the pull-down product. The pull-down product was then subjected to immunoblotting (western blot). The immunoblotting experiment steps are as follows: first, the sample was separated by SDS-PAGE electrophoresis, and the separated proteins were transferred to a PVDF membrane. After blocking with TBST buffer containing 5% skim milk at room temperature for 1 hour, the primary antibody was incubated overnight at 4°C, and then washed with TBST. The membrane was incubated with HRP-labeled secondary antibody at room temperature for 1 hour, and the protein bands were visualized using an enhanced chemiluminescence detection kit. The results are shown in Figure 2. Fig.14 As shown in C. This result shows that NC cannot capture NCL, but SAPT8 can capture NCL.

[0325] (3) 20 ng of recombinant human NCL (rhNCL) was fixed on a nitrocellulose membrane, blocked with TBST buffer containing 5% skim milk at room temperature for 1 hour, incubated with 1 μM 5'-end biotin-labeled NC and SAPT8 sequences at 4°C overnight, washed three times with TBST buffer, and incubated with HRP-labeled streptavidin at room temperature for 1 hour. The protein bands were visualized using an enhanced chemiluminescence detection kit. The results are shown in Figure 2. Fig.14 As shown in D. This result shows that NC cannot capture rhNCL, but SAPT8 can capture rhNCL.

[0326] (4) Collect 6×10 6 hFOB 1.19 cells and RA-FLSs were then isolated by following the steps of the cell plasma membrane isolation kit, followed by adding SDS-PAGE protein loading buffer and heating to 100°C for 10 minutes. The protein samples were then subjected to immunoblotting. The results are shown in Figure 2. Fig.14 E. The results showed that NCL was abundantly expressed on the cell membrane of RA-FLSs, but no NCL expression was detected on the surface of hFOB 1.19 cells.

[0327] (5) The lentiviral plasmid expressing shNC or shNCL, psPAX2 plasmid, and pMD2.G plasmid were co-transfected into 293T cells at a ratio of 5:2:3, and the supernatant containing the virus was collected at 48 hours, 72 hours, and 96 hours. 5RA-FLSs were seeded in 6-well plates, and 8 μg / mL polybrene and supernatant containing viruses were added after adhesion. After incubation for 36 hours, the medium was changed, and 2 μg / mL puromycin was added to continue culturing for 6 days to achieve NCL knockdown. Subsequently, RA-FLSs treated with shNC or shNCL were seeded in 6-well plates, and after adhesion, 200 nM Cy3 fluorescent group-labeled SAPT8 and NC sequences were added and incubated at 37°C. After 3 hours, flow cytometry was used to detect the binding of SAPT8 and NC sequences to RA-FLSs treated with shNC or shNCL, respectively. The results are shown in the figure. Fig.14 As shown in F. The results show that the binding ability of SAPT8 to RA-FLSs treated with shNC is basically unchanged, while the binding ability of SAPT8 to RA-FLSs treated with shNCL is significantly weakened, suggesting that the binding of SAPT8 to RA-FLSs depends on the expression of NCL.

[0328] (6) 4×10 5 RA-FLSs were seeded in 6-well plates, transfected with siNCL after adherence, and incubated at 37°C for 8 hours. After changing the medium, 400 nM NC and SAPT8 were added every day and incubated for 3 days. TM The proliferation of RA-FLSs was detected by EdU-488 cell proliferation detection kit, and the results were as follows Fig.14 G. The results showed that after silencing the expression of NCL, SAPT8 lost the ability to inhibit the proliferation of RA-FLSs, suggesting that SAPT8 inhibits the proliferation of RA-FLSs dependent on the expression of NCL.

[0329] (7) 4×10 5 RA-FLSs were seeded in 6-well plates, transfected with siNCL after adherence, and incubated at 37°C for 8 hours. After changing the medium, 400nM NC and SAPT8 were added every day and continued to be incubated. After 3 days, the apoptosis of RA-FLSs was detected by one-step TUNEL cell apoptosis detection kit. The results are shown in the figure. Fig.14 H. The results showed that after silencing the expression of NCL, SAPT8 could not induce apoptosis of RA-FLSs, suggesting that SAPT8-induced apoptosis of RA-FLSs depends on the expression of NCL.

[0330] The above experiment was also performed on SAPT8 derivatives, and the results also showed that SAPT8 derivatives can also target NCL.

[0331] Example 14: Aptamer-mediated NCL degradation

[0332] This example takes SAPT8 as an example to verify whether the aptamer described in this application can mediate NCL degradation.

[0333] (1) RA-FLSs were incubated with 400 nM NC and SAPT8 sequences at 37°C. After 24 hours, the cells were collected and RNA was extracted using the TransZol Up Plus kit. The RNA was then reversed into cDNA using PrimeScript RT Master Mix and amplified by RT-qPCR using SYBR Green qPCR Master Mix to detect the mRNA expression of NCL. The results are shown in Figure 2. Fig.15 As shown in A. This result indicates that SAPT8 does not affect the mRNA expression of NCL compared with NC.

[0334] (2) 400 nM NC and SAPT8 sequences were incubated with RA-FLSs at 37°C. After 24 hours, the cells were collected, lysed with RIPA lysis buffer, added with SDS-PAGE protein loading buffer, and heated to 100°C for 10 minutes. The protein samples were then subjected to immunoblotting. The results are shown in Figure 2. Fig.15 As shown in B. The results showed that compared with NC, SAPT8 reduced the protein expression of NCL in RA-FLSs, and SAPT8 could also downregulate the protein expression of Bcl-2 and increase the protein expression of p53.

[0335] (3) 400 nM NC and SAPT8 sequences were incubated with OA-FLSs at 37°C. After 24 hours, the cells were collected, lysed with RIPA lysis buffer, added with SDS-PAGE protein loading buffer, and heated to 100°C for 10 minutes. The protein samples were then subjected to immunoblotting. The results are shown in Figure 2. Fig.15 C. The results showed that compared with NC, SAPT8 decreased the protein expression of NCL and Bcl-2 and increased the protein expression of p53 in OA-FLSs.

[0336] (4) 200 nM Cy3 fluorescent group labeled NC and SAPT8 sequences were incubated with RA-FLSs at 37°C, and 50 nM lysosomal green fluorescent probe was added after 6 hours and incubated for another 2 hours. The slides were fixed with 4% paraformaldehyde for 15 minutes, DAPI was added and sealed, and the slides were photographed with a confocal microscope. The results are shown in Figure 2. Fig.15 D. This result shows that SAPT8 colocalizes with lysosomes in RA-FLSs compared with NC.

[0337] (5) 400 nM NC or SAPT8 sequence was incubated with RA-FLSs at 37°C, and the proteasome inhibitor MG132 or lysosome inhibitors chloroquine (CQ) and Baf A1 (CQ / Baf A1) were added. After 24 hours, the cells were collected, lysed with RIPA lysis buffer, and SDS-PAGE protein loading buffer was added. The cells were heated to 100°C for 10 minutes. The protein samples were then subjected to immunoblotting experiments. The results are shown in Figure 2. Fig.15 E. The results showed that MG132 could not block the degradation of NCL by SAPT8, while CQ / Baf A1 blocked the degradation of NCL in RA-FLSs induced by SAPT8, proving that SAPT8 targeting NCL does not simply inhibit NCL activation, but rather degrades NCL by pulling NCL into lysosomes, thereby reducing the background expression of NCL.

[0338] The above experiment was also performed on SAPT8 derivatives, and the results also showed that SAPT8 derivatives can also mediate the degradation of NCL.

[0339] Example 15: Aptamers can treat NCL-related diseases

[0340] This example takes SAPT8 as an example to verify whether the aptamer described in this application can treat NCL-related diseases.

[0341] (1) NCL is a multifunctional shuttle protein that is closely related to the occurrence and progression of inflammatory diseases, viral infections, tumors, etc. The expression level of NCL is increased in various disease cells (such as tumor cells (for example, osteosarcoma cells or non-small cell lung cancer cells), immune cells, and vascular endothelial cells, etc.), and is specifically distributed on the cell membrane, affecting multiple processes such as cell proliferation, apoptosis, metastasis, inflammation, and immune response. There is no expression of NCL on the surface of normal cells. Therefore, NCL is a potential molecular marker and therapeutic target for many diseases. NC and SAPT8 sequences labeled with 200nM Cy3 fluorescent group were incubated with human osteosarcoma cells MNNG / HOS at 37°C, and the binding of NC and SAPT8 sequences to MNNG / HOS was detected by flow cytometry after 3 hours. The results are shown in the figure. Fig.16 As shown in A. The results show that SAPT8 can significantly bind to MNNG / HOS compared with NC.

[0342] (2) SAPT8 at different concentrations (0, 100 nM, 500 nM, 1 μM, 2 μM) was incubated with MNNG / HOS cells at 37°C, and the medium was changed every day. After 8 days, the cells were fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet for 30 minutes, washed with PBS three times, photographed, and counted using Image J software. The results are shown in Figure 2. Fig.16 As shown in B. The results show that SAPT8 can inhibit the proliferation of MNNG / HOS cells.

[0343] (3) SAPT8 sequences of different concentrations (0, 100nM, 500nM, 1μM, 2μM, 5μM) were incubated with MNNG / HOS cells at 37°C. After 24 hours, the cells were collected, lysed with RIPA lysis buffer, added with SDS-PAGE protein loading buffer, and heated to 100°C for 10 minutes. The protein samples were then subjected to immunoblotting experiments. The results are shown in Figure 2. Fig.16 C. The results showed that SAPT8 could reduce the protein levels of NCL and Bcl-2 and increase the protein level of p53 in MNNG / HOS cells.

[0344] (4) MNNG / HOS cells were subcutaneously inoculated into BALB / c nude mice at a cell volume of 3×10 6 / mouse, and the tumor growth was observed every day. After 4 days, the solvent (Veh), NC (18μmol / kg), low-dose SAPT8 (SAPT8-L, 6μmol / kg), and high-dose SAPT8 (SAPT8-H, 18μmol / kg) were administered through the tail vein, and the administration cycle was once every 2 days. After administration on the 14th day, the mice were killed on the 16th day, and the tumor volume and weight were measured. The results are shown in Fig.16 D-16G. These results show that compared with NC, low concentration of SAPT8 can inhibit the growth of osteosarcoma, and high concentration of SAPT8 can inhibit the growth of osteosarcoma more significantly.

[0345] (5) 200 nM Cy3 fluorescent group-labeled NC and SAPT8 sequences were incubated with human non-small cell lung cancer cells A549 at 37°C. After 3 hours, flow cytometry was used to detect the binding of NC and SAPT8 sequences to A549 cells. The results are as follows: Fig.16 As shown in H. The results show that SAPT8 can significantly bind to A549 cells compared with NC.

[0346] (6) SAPT8 at different concentrations (0, 100 nM, 500 nM) was incubated with A549 cells at 37°C, and the medium was changed every day. After 7 days, the cells were fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% crystal violet for 30 minutes, washed with PBS three times, photographed, and counted using Image J software. The results are shown in Figure 2. Fig.16 As shown in I. The results showed that SAPT8 can inhibit the proliferation of A549 cells.

[0347] The above experiment was also performed on derivatives of SAPT8, and the results also showed that derivatives of SAPT8 can also treat NCL-related diseases.

[0348] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for screening aptamers, characterized in that: The aptamer binds to and / or kills target cells; The screening method comprises: CS-SELEX: random sequences are co-incubated with target cells to obtain a binding sequence enrichment library with peak binding ability to target cells; CT-SELEX: The binding sequence enrichment library obtained by CS-SELEX is co-incubated with target cells, apoptotic cells are separated after incubation, and sequences that bind to and enter the apoptotic cells are eluted.

2. The screening method according to claim 1, characterized in that The CT-SELEX further comprises amplifying and separating the obtained sequences that bind to and enter the apoptotic cells to obtain an enriched induced single-stranded library; Preferably, the CT-SELEX comprises: i) co-incubating the binding sequence enriched library obtained by CS-SELEX with target cells, separating apoptotic cells after incubation, and eluting the sequences that bind to and enter the apoptotic cells; ii) amplifying and separating the obtained sequences that bind to and enter the apoptotic cells to obtain an enriched induced single-stranded library; iii) using the enriched induced single-strand library as a binding sequence enriched library to repeat steps i) and ii) for at least one round, preferably 2-20 rounds; until the sequence screened out with a peak in the ability to induce cell apoptosis is the aptamer.

3. The screening method according to any one of claims 1-2, characterized in that: The separation of apoptotic cells comprises sorting apoptotic cells using magnetic beads, preferably using magnetic beads based on Annexin-V.

4. The screening method according to any one of claims 1 to 3, characterized in that: The elution sequence that binds to and enters the apoptotic cells comprises resuspending the apoptotic cells, then heating them and placing them on ice, and taking the supernatant; Preferably, the mixture is heated at 80-100°C for 3-10 minutes, placed on ice for 5-20 minutes, and the supernatant is collected.

5. The screening method according to any one of claims 1 to 4, characterized in that: The CS-SELEX comprises co-incubating random sequences with target cells, and obtaining sequences binding to target cells through positive screening. Preferably, the positive screening is repeated for 1-20 rounds; Preferably, the CS-SELEX further comprises subjecting the sequences binding to the target cells to negative screening to remove the sequences binding to non-target cells. Preferably, the negative screening is repeated for 1-20 rounds; More preferably, negative screening is performed after 1-20 rounds of positive screening, and then this step is repeated at least once.

6. The screening method according to any one of claims 1 to 5, characterized in that: The random sequence includes 20 to 60, preferably 30 to 40 random oligonucleotides, and the oligonucleotides are any one of A, T, C, G or U.

7. The screening method according to any one of claims 1 to 6, characterized in that: The target cells include activated synovial fibroblasts, immune cells or tumor cells; Preferably, the immune cells include one or more of lymphocytes, dendritic cells, monocytes / macrophages, granulocytes or mast cells, and the lymphocytes preferably include T cells, B cells and / or NK cells; Preferably, the tumor includes lymphoma (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as one or more of lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer , gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

8. The screening method according to any one of claims 1 to 7, characterized in that: The screening method comprises: S1, synthesizing an initial random single-stranded DNA library, a forward primer and a reverse primer, wherein the forward primer comprises the sequence shown in SEQ ID NO: 4, and the reverse primer comprises the sequence shown in SEQ ID NO: 5; S2, determine target cells and non-target cells; Preferably, activated synovial fibroblasts are selected as target cells, and non-synovial fibroblasts are selected as non-target cells; Preferably, tumor cells are selected as target cells, and non-tumor cells are selected as non-target cells; Preferably, immune cells are selected as target cells, and non-immune cells are selected as non-target cells; S3, incubating the initial random single-stranded DNA library and the target cells, washing, resuspending, eluting the sequences bound to the target cells and taking the supernatant; S4, amplifying the supernatant obtained in step S3 with the forward primer and the reverse primer to separate the single-stranded sequence; S5, further repeating steps S3 and S4 for at least 2-5 rounds using the single-stranded sequences obtained in step S4 as the initial random single-stranded DNA library; S6, incubating the obtained single-stranded sequence with non-target cells and taking the supernatant; S7, using the supernatant obtained in step S6 as an initial random single-stranded DNA library for sequentially executing steps S3 and S4, and then repeating the steps S6, S3, and S4 in order; until a binding sequence enrichment library whose binding ability to the target cells reaches a peak and has no binding to the non-target cells is selected; S8, incubating the binding sequence enrichment library obtained in step S7 with the target cells to separate the apoptotic cells, eluting the sequences that bind to the apoptotic cells and enter the apoptotic cells, and taking the supernatant; S9, amplifying the supernatant obtained in step S8 with the forward primer and the reverse primer and then separating to obtain an enriched induced single-stranded library; S10, using the enriched induced single-stranded library as the binding sequence enriched library to repeat steps S8-S9 until the sequence screened out with the ability to induce cell apoptosis reaching a peak is the aptamer.

9. The screening method according to any one of claims 1 to 8, characterized in that: The aptamer comprises SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence having more than 60% homology with SEQ ID NO: 25 or 26; or, comprises a sequence having no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide difference with SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence with one or more nucleotides substituted, deleted or inserted with respect to SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence with 1-30 nucleotides extended at the 5' end and / or 3' end of SEQ ID NO: 25 or 26, respectively; preferably, the extended nucleotide is selected from any one of A, T, C, G or U; TCGX1X2TGGCGTAGCTAX3X4CGATCTGGTTACCCA (SEQ ID NO: 25); CCGX5X6TGCTGCGGCAX7CGG (SEQ ID NO: 26); Wherein, X1, X2, X3, X4, X5, X6 or X7 are independently selected from any one of A, T, C, G or U.

10. The screening method according to any one of claims 1 to 9, characterized in that: The aptamer comprises one or more of SEQ ID NOs: 1, 2, 7-21; 11. A screening kit for aptamers, characterized in that: It includes a CS-SELEX module for screening sequences binding to target cells, and a CT-SELEX module connected in series with the CS-SELEX module and further screening sequences having target cell cytotoxicity based on the sequences binding to target cells screened by the CS-SELEX module; Preferably, the CT-SELEX module is used to co-incubate the binding sequence enrichment library obtained by CS-SELEX with target cells, separate apoptotic cells after incubation, and elute sequences that bind to and enter the apoptotic cells.

12. An aptamer, characterized in that The sequence of the aptamer comprises SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence having more than 60% homology with SEQ ID NO: 25 or 26; or, comprises a sequence having no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide difference with SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence in which one or more nucleotides are substituted, deleted or inserted with respect to SEQ ID NO: 25 or 26; or, comprises a nucleotide sequence in which the 5' end and / or the 3' end of SEQ ID NO: 25 or 26 are extended by 1-30 nucleotides respectively; preferably, the extended nucleotide is selected from any one of A, T, C, G or U; TCGX1X2TGGCGTAGCTAX3X4CGATCTGGTTACCCA (SEQ ID NO: 25); CCGX5X6TGCTGCGGCAX7CGG (SEQ ID NO: 26); Wherein, X1, X2, X3, X4, X5, X6 or X7 are independently selected from any one of A, T, C, G or U; Preferably, X1, X2, X3 or X4 are independently selected from A or T; Preferably, X5 is selected from A or G or T; Preferably, X6 is selected from A or C or T; Preferably, X7 is selected from A or T.

13. The aptamer according to claim 12, characterized in that The sequence of the aptamer includes one or more of SEQ ID NOs: 1, 2, or 7-21, or includes a nucleotide sequence having more than 60% homology with one or more of SEQ ID NOs: 1, 2, 7-21.

14. The aptamer according to any one of claims 12 to 13, characterized in that: The sequence of the aptamer further comprises modifications, wherein the modifications preferably comprise base modifications, backbone modifications, transformation into nucleic acid analogs or linking functional groups; Preferably, the base modification includes one or more of phosphorylation, methylation, hydroxymethylation, acetylation, amination, glycosylation, sulfhydrylation or isotope modification; Preferably, the backbone modification comprises a phosphate backbone modification, preferably a thiophosphate backbone modification; Preferably, the nucleic acid analogs include one or more of peptide nucleic acid, morpholino nucleic acid, bridge nucleic acid, locked nucleic acid, glycol nucleic acid or threose nucleic acid; Preferably, the functional groups include one or more of fluorescent groups, radioactive groups, therapeutic drugs, biotin, digoxin, nanoluminescent materials, nucleic acids or enzyme markers.

15. A drug, characterized in that The drug comprises the aptamer according to any one of claims 12-14; Preferably, the drug further comprises a pharmaceutically acceptable excipient; Preferably, the drug further comprises other active ingredients, such as one or more of methotrexate, leflunomide, hydroxychloroquine or sulfasalazine, abatacept, adalimumab, anakinra, becelizumab, etanercept, golimumab, infliximab, rituximab, salilumab, tocilizumab, baricitinib, tofacitinib, upadacitinib, ibuprofen, diclofenac, indomethacin, meloxicam, celecoxib, ciproamide, azathioprine, mycophenolate mofetil, cyclosporine, prednisone, prednisone or triamcinolone acetonide.

16. Use of the screening method according to any one of claims 1 to 10, the screening kit according to claim 11, the aptamer according to any one of claims 12 to 14, or the drug according to claim 15, characterized in that: The applications described include: 1) Use in the preparation of products for the prevention and / or treatment of diseases; or, 2) Applications in biomarker discovery, cell recognition and sorting, biosensing, bioimaging, or targeted drug delivery.

17. The use according to claim 16, characterized in that The diseases include diseases where killing target cells is beneficial for treatment; Preferably, the target cells include activated synovial fibroblasts, immune cells or tumor cells; Preferably, the disease includes activated synovial fibroblast-related diseases, autoimmune diseases or tumors; Preferably, the activated synovial fibroblast-related diseases include one or more of synovitis, synovial hyperplasia, synovial sarcoma, rheumatoid arthritis, osteoarthritis or ankylosing spondylitis; Preferably, the autoimmune disease includes one or more of systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, dermatomyositis, ankylosing spondylitis, hyperthyroidism, idiopathic thrombocytic purpura, autoimmune hemolytic anemia, inflammatory bowel disease, atopic dermatitis, vasculitis or psoriasis; Preferably, the tumor includes lymphoma (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as one or more of lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer , gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

18. The use according to claim 16 or 17, characterized in that: The treatment and / or prevention of diseases comprises targeting and / or degrading NCL by aptamers; Preferably, the treatment and / or prevention of the disease comprises reducing the expression level of Bcl-2, and / or increasing the expression level of p53; Preferably, the treatment and / or prevention of the disease comprises targeting and / or degrading NCL by an aptamer, thereby reducing the expression level of Bcl-2 and / or increasing the expression level of p53.

19. The use according to claim 18, characterized in that The diseases include inflammatory diseases, infectious diseases, autoimmune diseases or tumors; Preferably, the inflammatory diseases include degenerative inflammation, exudative inflammation (such as one or more of serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation or specific inflammation (such as one or more of tuberculosis, syphilis, leprosy or lymphogranuloma); Preferably, the autoimmune disease includes one or more of systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, dermatomyositis, ankylosing spondylitis, hyperthyroidism, idiopathic thrombocytic purpura, autoimmune hemolytic anemia, inflammatory bowel disease, atopic dermatitis, vasculitis or psoriasis; Preferably, the infectious diseases include diseases caused by one or more of bacteria, fungi or viruses; Further preferably, the virus includes one or more of cytomegalovirus (CMV), Epstein-Barr virus (EBV), hepatitis virus, Kaposi's sarcoma-associated herpes virus (KSHV), human papilloma virus (HPV), molluscum contagiosum virus (MCV), human T-cell leukemia virus 1 (HTLV-1) or HIV (human immunodeficiency virus); More preferably, the bacteria include one or more of Escherichia coli, Mycobacterium tuberculosis, Staphylococcus, Streptococcus, Pneumococcus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Staphylococcus epidermidis, Listeria, Brucella, Campylobacter, Vibrio cholerae, Serratia, Pseudomonas, Salmonella, Shigella, Bacillus anthracis, Clostridium difficile or Corynebacterium diphtheriae; Further preferably, the fungus includes one or more of Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides, Cryptococcus, Histoplasma, Mucor or Sporothrix; Preferably, the tumor includes lymphoma (such as Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell lymphoma and Waldenstrom's macroglobulinemia), lung cancer (such as non-small cell lung cancer), leukemia (such as one or more of lymphocytic leukemia, myeloid leukemia, multiple myeloma or plasma cell leukemia), ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer , gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, or chondrosarcoma).

Images