Recombinant strain for synthesizing vanillin and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a recombinant strain for synthesizing vanillin and application of the recombinant strain. According to the invention, a vanillin non-degradable yeast strain is taken as a chassis, a new way for efficiently synthesizing vanillin by taking glucose as a precursor is designed and constructed, chorismic acid is taken as a key intermediate, chorismic acid lyase UbiC is introduced to convert the chorismic acid into p-hydroxybenzoic acid, and then vanillin is gradually synthesized through carboxylic acid reduction, hydroxylation and methylation; and more efficient de novo synthesis of vanillin and glucose vanillin is realized subsequently through strategies such as optimization of integration sites and removal of glycosylation in-situ products. The constructed engineering strain has the capacity of efficiently converting glucose to synthesize vanillin, the highest value reported at present can be obtained through fermentation in a shake flask, higher yield is obtained through further optimization of a bioreactor, and important reference value is provided for subsequent production and application.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a recombinant strain for synthesizing vanillin and application thereof. Background Art

[0002] Flavors have important applications in industries such as food, daily chemicals, tobacco, and pharmaceuticals, and are widely used as additives. Vanillin (3-methoxy-4-hydroxybenzaldehyde) is an organic compound with multiple functional groups, including aldehydes, ethers, and hydroxyls. It is the main flavor component of vanilla, one of the most popular spices in the world. Natural vanillin can be purified from vanilla extract, which is a mixture of hundreds of different compounds. Due to the limited production of vanilla pods, the cumbersome extraction process, and the low yield, natural vanillin is expensive and in short supply. Considering that chemical synthesis of vanillin is limited in many application areas, microbial conversion has become an important sustainable method for natural vanillin.

[0003] The biosynthesis of vanillin has been achieved in a variety of microorganisms, including Escherichia coli, Saccharomyces cerevisiae, Pseudomonas, Bacillus subtilis, etc. Different pathways have also been designed to convert various substrates into vanillin. However, due to the toxicity of vanillin to microbial cells, it is difficult to achieve high yields by long-term fermentation. Therefore, high-titer vanillin is usually obtained through whole-cell catalysis or resin-mediated in situ product recovery short pathways, and the substrates used are aromatic compounds with similar structures to vanillin, such as ferulic acid and isoeugenol. The supply of these raw materials is affected by many factors, further limiting the production of vanillin. Glucose is an excellent substrate for the industrial production of vanillin because of its mature production process, low cost and easy availability. However, no wild-type microorganisms have been found to be able to convert glucose into vanillin.

[0004] Many microorganisms have been engineered to convert glucose to vanillin by screening and expressing foreign genes to achieve specific catalytic reactions. In Escherichia coli, fission yeast, and Saccharomyces cerevisiae, 3-dehydroshikimate dehydratase (3SDS) can generate protocatechuic acid from 3-dehydroshikimate, which is then methylated to form vanillic acid, which is further reduced to obtain 19.3 mg / L, 65 mg / L, and 45 mg / L of vanillin. The de novo synthesis of vanillin based on tyrosine ammonia lyase converts tyrosine to p-coumaric acid, then generates caffeic acid and ferulic acid, and finally synthesizes vanillin; through different optimization strategies, this pathway can obtain 8.5 mg / L or 29 mg / L of vanillin. Recently, it has been reported that 365.55 mg / L of vanillin was synthesized de novo in Saccharomyces cerevisiae through the coordinated transformation of multiple pathways. In Bacillus subtilis, by rationally designing and modifying the key enzyme methoxytransferase in the pathway based on 3-dehydroshikimate dehydratase, combined with biosensor system screening, the production chassis was further optimized, the supply of S-adenosylmethionine (SAM) and the precursor concentration were increased, and the titer of vanillin was increased to 1mM. By screening highly active carboxylic acid reductases and catechol O-methyltransferases, optimizing the protocatechuate pathway and regulating competitive metabolic pathways, the de novo synthesis of higher concentrations of vanillin was achieved in Escherichia coli K12 MG1655, and 481.2mg / L vanillin was synthesized in a 5L fermenter using glucose as a substrate. However, the long pathway, low enzyme catalytic efficiency and product toxicity still limit the further improvement of vanillin production. Summary of the invention

[0005] In view of this, the present invention provides a recombinant strain for synthesizing vanillin from scratch using glucose and its application.

[0006] The present invention uses Saccharomyces cerevisiae as the base bacteria and provides a new way to synthesize vanillin using glucose as a substrate, and obtains the highest yield by fermentation in a shake flask; further glycosylation is introduced to achieve in-situ removal of the product, and a higher product concentration is obtained in a 5L fermenter, which provides important reference significance for the production and application of vanillin.

[0007] Preparations of para-hydroxybenzoic acid synthesized de novo by yeast include:

[0008] (1) Promote UbiC, AroL, TktA, PpsA, Aro2, and Aro3 K222L 、Aro4 K229L a preparation in which at least one gene or enzyme thereof is expressed; and

[0009] (2) An agent that inhibits, knocks down and / or knocks out the expression of at least one gene or enzyme of PGM1 and Aro7.

[0010] The present invention also provides a preparation for synthesizing vanillin from scratch by yeast, which includes the preparations shown in (1) to (3) below, or includes the preparations shown in (1) to (4):

[0011] (1) Promote UbiC, AroL, TktA, PpsA, Aro2, and Aro3 K222L 、Aro4 K229L a preparation expressing at least one gene or an enzyme thereof; and / or

[0012] (2) agents that inhibit, knock down and / or knock out the expression of at least one gene or enzyme of PGM1 and Aro7;

[0013] (3) an agent that promotes the expression of at least one gene or enzyme selected from the group consisting of CAR, Pcg-1, HpaB, HpaC, NtCOMT, SAH1, MET6, and MET13atsc;

[0014] (4) A preparation that promotes the expression of the UGT72B1 gene or its enzyme.

[0015] The preparation of the present invention includes any substance that promotes the expression of the gene or inhibits, knocks down and / or knocks out the gene, which may be a gene element, expression module, vector or host containing the relevant gene, or any type of chemical substance that can promote, inhibit, knock down or knock out the gene, all within the protection scope of the present invention. In an embodiment of the present invention, the preparation is a gene element containing the gene and its expression module, vector or host. The present invention has no particular restrictions on the method of inhibition, knockout or knockdown, and can adopt homologous recombination methods, gene editing technology, RNA interference or plasmid-mediated gene knockout methods, as long as the gene can be inhibited, knocked out or knocked down. In an embodiment of the present invention, the relevant gene is knocked out by means of CRISPR-Cas9 technology.

[0016] The present invention also provides application of the preparation in synthesizing p-hydroxybenzoic acid or synthesizing vanillin.

[0017] In the present invention, a new pathway for synthesizing vanillin using glucose as a precursor and chorismic acid as a key intermediate is provided. By introducing the chorismic acid lyase UbiC, chorismic acid is converted into p-hydroxybenzoic acid, and then through carboxylic acid reduction, hydroxylation and methylation, glucose is synthesized into vanillin via the pathway of chorismic acid, p-hydroxybenzoic acid, p-hydroxybenzaldehyde and protocatechuic aldehyde; further, the present invention achieves a more efficient de novo synthesis of vanillin and glucovanillin through strategies such as optimization of integration sites and removal of in-situ glycosylation products.

[0018] The genetic element provided by the present invention specifically includes at least one of the following genetic elements 1 to 11:

[0019] The genetic element 1 includes the UbiC gene;

[0020] The genetic element 2 includes the AroL gene;

[0021] The gene element 3 includes TktA, PpsA, Aro2, Aro3 K222L 、Aro4 K229L At least one of the genes;

[0022] The genetic element 4 includes a homologous fragment for knocking out the PGM1 gene;

[0023] The gene element 5 includes a homologous fragment for knocking out the Aro7 gene;

[0024] The genetic element 6 includes CAR and Pcg-1;

[0025] The genetic element 7 includes HpaB and HpaC genes;

[0026] The genetic element 8 includes NtCOMT, SAH1, MET6 and MET13 atsc At least one of the genes;

[0027] The genetic element 9 includes the UGT72B1 gene;

[0028] The genetic element 10 includes a homologous fragment for knocking out the PDC5 gene;

[0029] The genetic element 11 includes a homologous fragment for knocking out the EXG1 gene.

[0030] In the present invention, the UbiC, AroL, TktA and PpsA UGT72B1 genes are derived from E. coli; the UGT72B1 gene is derived from Arabidopsis thaliana; the NtCOMT gene is derived from Nicotiana tabacum; the CAR is derived from Nocardia genus, and Pcg-1 is derived from Corynebacterium glutamicum; SAH1 (SGD: S000000845) and MET6 (SGD: S000000893) are endogenous yeast genes; the MET13atsc gene is assembled by splicing the MTHFR gene derived from Arabidopsis thaliana and the MET13 (SGD: S000003093) gene hinges from Saccharomyces cerevisiae; HpaB is derived from Pseudomonas aeruginosa; HpaC is derived from Salmonella enterica; the Aro3 K222L 、Aro4 K229LDerived from Saccharomyces cerevisiae.

[0031] In some specific embodiments of the present invention, the UbiC gene has a nucleic acid sequence as shown in any one of 1) to 3):

[0032] 1) the nucleic acid sequence shown in SEQ ID NO: 1;

[0033] 2) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 1), and having the same or similar functions as 1);

[0034] 3) a nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 1) or 2);

[0035] The AroL gene has a nucleic acid sequence as shown in any one of 4) to 6):

[0036] 4) the nucleic acid sequence shown in SEQ ID NO: 2;

[0037] 5) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 4), and having the same or similar function as 4);

[0038] 6) a nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 4) or 5);

[0039] The TktA gene has a nucleic acid sequence as shown in any one of 7) to 9):

[0040] 7) the nucleic acid sequence shown in SEQ ID NO: 3;

[0041] 8) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 7), and having the same or similar functions as 7);

[0042] 9) a nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 7) or 8);

[0043] The PpsA gene has a nucleic acid sequence as shown in any one of 10) to 12):

[0044] 10) the nucleic acid sequence shown in SEQ ID NO: 4;

[0045] 11) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 10), and having the same or similar functions as 10);

[0046] 12) a nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 10) or 11);

[0047] Aro3 K222L The gene has a nucleic acid sequence as shown in any one of 13) to 15):

[0048] 13) the nucleic acid sequence shown in SEQ ID NO: 5;

[0049] 14) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 13), and having the same or similar function as 10);

[0050] 15) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 13) or 14);

[0051] Aro4 K229L The gene has a nucleic acid sequence as shown in any one of 16) to 18):

[0052] 16) the nucleic acid sequence shown in SEQ ID NO: 6;

[0053] 17) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 16), and having the same or similar function as 10);

[0054] 18) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 16) or 17);

[0055] The CAR gene has a nucleic acid sequence as shown in any one of 19) to 21):

[0056] 19) the nucleic acid sequence shown in SEQ ID NO: 7;

[0057] 20) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 19), and having the same or similar function as 1);

[0058] 21) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 19) or 20);

[0059] The Pcg-1 gene has a nucleic acid sequence as shown in any one of 22) to 24):

[0060] 22) the nucleic acid sequence shown in SEQ ID NO: 8;

[0061] 23) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 22), and having the same or similar functions as 22);

[0062] 24) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 22) or 23);

[0063] The HpaC and HpaB genes are expressed in fusion, and the HpaC-HpaB fusion gene has a nucleic acid sequence as shown in any one of 25) to 27):

[0064] 25) the nucleic acid sequence shown in SEQ ID NO: 9;

[0065] 26) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 25), and having the same or similar function as 7);

[0066] 27) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 25) or 26);

[0067] The NtCOMT gene has a nucleic acid sequence as shown in any one of 28) to 30):

[0068] 28) the nucleic acid sequence shown in SEQ ID NO: 10;

[0069] 29) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 28), and having the same or similar functions as 28);

[0070] 30) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 28) or 29);

[0071] The MET13atsc gene has a nucleic acid sequence as shown in any one of 31) to 33):

[0072] 31) the nucleic acid sequence shown in SEQ ID NO: 11;

[0073] 32) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 31), and having the same or similar functions as 31);

[0074] 33) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 31) or 32);

[0075] The UGT72B1 gene has a nucleic acid sequence as shown in any one of 34) to 36):

[0076] 34) the nucleic acid sequence shown in SEQ ID NO: 12;

[0077] 35) A nucleic acid sequence obtained by replacing, deleting or adding one or more bases in the nucleic acid sequence shown in 34), and having the same or similar functions as 34);

[0078] 36) A nucleic acid sequence having at least 80% homology with the nucleic acid sequence shown in 34) or 35).

[0079] The nucleic acid sequences shown in the above SEQ ID NOs: 1 to 12 are all sequences after Saccharomyces cerevisiae codon optimization.

[0080] The present invention also provides an expression module, which includes: a promoter, a terminator and any one of the above-mentioned gene elements 1 to 11. In the expression module, the promoter and the terminator are endogenous promoters or terminators of Saccharomyces cerevisiae. Specifically, the promoter is independently selected from P TEF2 , P ENO2 , P FBA1 , P PGK1 , P PDC1 At least one of, including but not limited to, the terminator is independently selected from T ADH2 , T CYC1 , T PGI1 , T HXT7 , T TDH1 , T TDH3 At least one of, including but not limited to.

[0081] In the present invention, some genes are expressed independently, and some genes are expressed in fusion. In an embodiment of the present invention, HpaC and HpaB are expressed in fusion, and specifically, HpaB and HpaC are connected by a nucleic acid sequence encoding 3 copies of GGGGS linkers. The remaining genes are all expressed independently, specifically monocistronic expression, that is, each gene simultaneously integrates a separate promoter and terminator. In some specific embodiments of the present invention, the expression module specifically includes at least one of the following:

[0082] (1)P TEF2 -UbiC-T ADH2 ;

[0083] (2)P ENO2 -EcAROL-T CYC1 ;

[0084] (3)P FBA1 -ppsA-T PGI1 -P PGK1 -tktA-T HXT7 -T TDH1 -P TEF2 -Aro2-T ADH2 ;

[0085] (4)P ENO2 -Aro3 K222L -T CYC1 -P PDC1 -Aro4 K229L -T TDH3 ;

[0086] (5)P PGK1-SehpaC-(GGGGS)3-PahpaB-T HXT7 ;

[0087] (6)P TEF2 -UGT72B1-T ADH2 .

[0088] The present invention also provides a vector, including an expression vector and a knockout vector; the overexpression vector includes a backbone vector and an expression module containing the overexpressed gene, such as the expression modules shown in (1) to (6). The knockout vector includes a backbone vector and an expression module containing upstream and downstream homologous sequences of the knockout gene, which is used to knock out at least one gene of PGM1 and Aro7. In the present invention, the CRISPR-Cas9 system is used to knock out the PGM1 and Aro7 genes.

[0089] The present invention also provides a recombinant strain for synthesizing a vanillin precursor substance, p-hydroxybenzoic acid, which overexpresses the gene shown in (1), and / or the gene shown in (2) is suppressed, knocked down or knocked out:

[0090] (1)UbiC, AroL, TktA, PpsA, Aro2, Aro3 K222L 、Aro4 K229L At least one gene in

[0091] (2) At least one gene of PGM1 and Aro7.

[0092] The present invention also provides a recombinant strain for synthesizing vanillin, which, based on the above strain, further comprises at least one of the following modifications:

[0093] It overexpresses at least one gene among CAR, Pcg-1, HpaB, HpaC, SAH1, MET6 and MET13atsc;

[0094] and / or its PDC5 gene is replaced by the NtCOMT gene;

[0095] and / or, its EXG1 gene is replaced by the UGT72B1 gene;

[0096] and / or restoration of its PGM1 gene expression.

[0097] In some specific embodiments of the present invention, the NtCOMT gene is present in two copies.

[0098] In the embodiment of the present invention, the recombinant strain for synthesizing vanillin is any one of the strains A to C:

[0099] A. The strain overexpresses the genes shown in (1) and (3), and the gene shown in (2) is suppressed, knocked down or knocked out;

[0100] B. The strain overexpresses the genes shown in (1) and (3), replaces its endogenous EXG1 gene with the gene shown in (4), and the gene shown in (2) is suppressed, knocked down or knocked out;

[0101] C. The strain overexpresses the genes described in (1) and (3), replaces its endogenous EXG1 gene with the gene described in (4), restores the expression of the gene described in (5), and the gene described in (2) is suppressed, knocked down or knocked out.

[0102] (1)UbiC, AroL, TktA, PpsA, Aro2, Aro3 K222L 、Aro4 K229L At least one gene in

[0103] (2) at least one gene among PGM1, Aro7, PDC5, and EXG1;

[0104] (3) at least one gene among CAR, Pcg-1, HpaB, HpaC, NtCOMT, SAH1, MET6, and MET13atsc;

[0105] (4) UGT72B1 gene;

[0106] (5)PGM1 gene.

[0107] In the present invention, the insertion site and integration site of the overexpressed gene in the yeast genome include:

[0108] The integration site of the UbiC gene includes the YNRCdelta9 site;

[0109] The integration site of the AroL gene includes the TKL2-TEF2 site;

[0110] TktA, PpsA, Aro2, Aro3 K222L and Aro4 K229L Integration sites of the gene include the DAK2-ZNF1 site;

[0111] The integration sites of HpaB and HpaC genes include the YPRCdelta15 site;

[0112] Integration sites of CAR and Pcg-1 genes include the YORWdelta22 site;

[0113] The insertion site of the NtCOMT gene is the position of the original PDC5 gene;

[0114] The integration sites of the SAH1, MET6 and MET13atsc genes include the HO site;

[0115] The insertion site of the UGT72B1 gene is the position of the original EXG1 gene.

[0116] In some specific embodiments of the present invention, the source and specific sequence of the gene are as described above and will not be repeated here.

[0117] In the present invention, the base bacteria of the recombinant strain is Saccharomyces cerevisiae. In some specific embodiments of the present invention, the base bacteria is Saccharomyces cerevisiae strain BY4742 in which ADH6, ADH7, BDH1, BDH2, Ari1, GRE2 and HFD1 are knocked out.

[0118] The present invention also provides a method for constructing the recombinant strain, comprising:

[0119] The expression module or the vector is introduced into the chassis strain to obtain the recombinant strain.

[0120] The present invention also provides the use of at least one of the following a to d in the production of vanillin:

[0121] a, the expression module;

[0122] b, the carrier;

[0123] c. the recombinant strain;

[0124] d. The recombinant strain obtained by the construction method.

[0125] The present invention also provides a method for producing vanillin, which comprises: culturing the strain or the recombinant strain obtained by the construction method, and fermenting to obtain vanillin;

[0126] The carbon source of the fermentation medium includes glucose.

[0127] In the present invention, the fermentation medium is YPD medium, and the fermentation is a glucose fermentation in YPD medium.

[0128] The present invention uses strain ZR05 (strain number SyBE_Sc05220018) in patent CN 113201465 A as the base bacteria, reduces the loss of glucose-6-phosphate G6P by knocking out PGM1; knocks out gene Aro7 to block the conversion of chorismate CHA into prephenic acid PPA, and integrates UbiC gene at the YNRCdelta9 site to obtain recombinant strain yScXIN329, thereby realizing the synthesis of p-hydroxybenzoic acid using glucose as substrate.

[0129] Further, based on yScXIN329, the present invention introduces a carboxylic acid reduction process to convert p-hydroxybenzoic acid into p-hydroxybenzaldehyde, which is then hydroxylated to generate protocatechuic aldehyde, and further methylated to achieve the final synthesis of vanillin. The specific method includes: integrating SehpaC-(GGGGS)3-PahpaB at the YPRCdelta15 site of strain yScXIN329, integrating Pcg-1 and CAR genes at the YORWdelta22 site, replacing the endogenous PDC5 gene (SGD: S000004124) with the NtCOMT gene, integrating SAH1, MET6 and MET13atsc at the HO site, and finally obtaining strain yScXIN392. Experiments show that the strain finally achieves 533.0 mg / L vanillin synthesis after 144 hours of enhanced shake flask fermentation.

[0130] Furthermore, the present invention removes vanillin in situ by glycosylation to relieve product inhibition, further strengthens vanillin synthesis, and increases the yield of vanillin. Specifically, the present invention introduces the glycosyltransferase UGT72B1 from Arabidopsis thaliana into the strain yScXIN392, that is, replaces the endogenous glycoside hydrolase encoding gene EXG1 (SGD: S000004291) with the UGT72B1 gene, and then complements the expression of the PGM1 gene knocked out in the early stage, and the resulting strain is named yScXIN427. Experiments show that the strain yScXIN427 can convert and synthesize 1339.5 mg / L of glucovanillin after 120h shake flask fermentation, which is equivalent to 648.5 mg / L of vanillin, and the yield is still on the rise. The yScXIN427 strain was fermented in a 5-L fermenter and the concentration continued to increase after 132 h of fermentation, reaching 7476.5 mg / L, equivalent to 3619.4 mg / L of vanillin.

[0131] The present invention provides a recombinant strain for synthesizing vanillin and its application, which has at least one of the following advantages:

[0132] (1) Compared with the existing de novo synthesis pathway of vanillin, the pathway designed by the present invention has higher conversion efficiency and no highly restrictive bottleneck step.

[0133] (2) Compared with the existing method of synthesizing vanillin by converting aromatic monomers as substrates, the present invention uses cheap and readily available glucose as a substrate. The synthesis is not limited by the cost and supply source of raw materials and is easier to scale up industrially.

[0134] (3) Compared with the existing method of synthesizing vanillin by converting aromatic monomers as substrates, the present invention uses glucose as a substrate, which has strong water solubility and a large structural difference with the product vanillin, which is easier to remove the inhibition of the subsequent product and the final separation and purification process.

[0135] (4) As a recognized safe strain, Saccharomyces cerevisiae has better biosafety than other non-model bacteria and is easier to implement in the subsequent optimization process.

[0136] (5) The vanillin yield obtained in the present invention is the highest yield of vanillin synthesized de novo by all microorganisms reported so far, reaching 3619.4 mg / L, which is much higher than the synthetic yield of the prior art.

[0137] (6) The yield of glucovanillin obtained in the present invention is the highest yield of glucovanillin synthesized de novo by all microorganisms reported so far, reaching 7476.5 mg / L, and there is almost no accumulation of by-products and intermediates in the system, which is beneficial to the subsequent separation and purification process. BRIEF DESCRIPTION OF THE DRAWINGS

[0138] Figure 1 Example 1 shows the synthesis of p-hydroxybenzoic acid using glucose as a substrate, wherein: a: schematic diagram of the design and enhancement of the transformation pathway; b: schematic diagram of the knockout or integration sites of exogenous and endogenous genes; c: the concentration of p-hydroxybenzoic acid synthesized by each strain in the 2-mLYPD fermentation system;

[0139] Figure 2 The results of synthesizing p-hydroxybenzoic acid using glucose as a substrate in a shake flask in Example 1 are shown;

[0140] Figure 3 A reaction diagram showing the designed pathway for converting p-hydroxybenzoic acid into vanillin in Example 2;

[0141] Figure 4 Schematic diagram showing the integration of the downstream pathway of p-hydroxybenzoic acid in Example 2: a, before optimization; b, after optimization;

[0142] Figure 5 The fermentation results of the strain yScXIN392 in Example 2 using glucose as a substrate to synthesize vanillin are shown; a: fermentation in YPD medium; b: fed-batch fermentation in YPD medium;

[0143] Figure 6 The screening of glycosyltransferases in Example 2 (a) and the screening of key genes for endogenous glycosidic bond hydrolysis in Saccharomyces cerevisiae (b) are shown;

[0144] Figure 7 The fermentation results of the strain yScXIN427 in Example 2 synthesizing glucovanillin using glucose as a substrate are shown; a, schematic diagram of the glycosylation process; b, fermentation in a shake flask with YPD medium supplemented with glucose; c, fermentation in a 5-L fermentor with YPD medium supplemented with glucose. DETAILED DESCRIPTION

[0145] The present invention provides a recombinant strain for synthesizing vanillin and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0146] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0147] The sequence of the chorismate lyase encoding gene UbiC (after codon optimization) is SEQ ID NO: 1:

[0148] ATGTCTCATCCAGCTTTGACTCAATTAAGAGCTTTGAGATATTTCAAGGAAATCCCAGCTTTGGACCCTCAATTGTTAGATTGGTTGTTGTTGGAAGATTCTATGACTAAAAGATTCGAACAACAAGGTAAAACAGTTTCTGTTACAATGATTAGAGAGGGTTTTGTTGAACAAAATGAAATTCCAGAAGAGTTACCATTGTTGCCAAAAGAATCTAGGTATTGGTTGAGAGAAATTTTATTGTGTGCT GATGGTGAACCTTGGTTGGCTGGTAGAACTGTTGTTCCAGTTTCTACTTTATCTGGTCCAGAATTAGCTTTGCAAAAATTGGGTAAAACACCATTGGGTAGATATTTGTTTACATCTTCTACTTT GACCAGAGATTTTATTGAAATCGGTAGAGATGCTGGTTTGGTGGGGTAGAAGATCAAGATTAAGATTATCTGGTAAACCATTGTTGTTGACAGAATTGTTTTTGCCAGCTTCTCCATTGTATTAA.

[0149] The sequence of the shikimate kinase encoding gene EcAroL (after codon optimization) is SEQ ID NO: 2:

[0150] ATGACACAACCTCTTTTTCTGATCGGGCCTCGGGGCTGTGGTAAAACAACGGTCGGAATGGCCCTTGCCGATTCGCTTAACCGTCGGTTTGTCGATACCGATCAGTGGTTGCAATCACAGCTCAATATGACGGTCGCGGAGATCGTCGAAAGGGAAGAGTGGGCGGGATTTCGCGCCAGAGAAACGGCGGCGCTGGAAGCGGTAACTGCGCCATCCACCGTTATCGCTACAGGCGGCGGCATTATTCTGACGGAATTTAATCGTCACTTCATGCAAAATAACGGGATCGTGGTTTATTTGTGTGCGCCAGTATCAGTCCTGGTTAACCGACTGCAAGCTGCACCGGAAGAAGATTTACGGCCAACCTTAACGGGAAAACCGCTGAGCGAAGAAGTTCAGGAAGTGCTGGAAGAACGCGATGCGCTATATCGCGAAGTTGCGCATATTATCATCGACGCAACAAACGAACCCAGCCAGGTGATTTCTGAAATTCGCAGCGCCCTGGCACAGACGATCAATTGTTGA。

[0151] The sequence of the transketolase-encoding gene TktA (after codon optimization), SEQ ID NO: 3, is as follows:

[0152]

[0153] The sequence of the phosphoenolpyruvate synthase encoding gene PpsA (after codon optimization) is SEQ ID NO: 4:

[0154]

[0155] Endogenous mutant Aro3 K222L The sequence of SEQ ID NO: 5 is:

[0156] ATGTTCATTAAAAACGATCACGCCGGTGACAGGAAACGCTTGGAAGACTGGAGAATCAAAGGTTATGATCCATTAACCCCTCCAGATCTGCTTCAACATGAATTTCCAATTTCAGCCAAAGGTGAGGAAAACATTATCAAGGCAAGAGACTCCGTCTGTGATATTTTGAATGGTAAAGATGATCGTTTAGTTATCGTGATCGGGCCATGTTCCCTACATGACCCCAAAGCCGCTTACGATTACGCTGACAGATTGGCTAAAATTTCAGAAAAGTTGTCAAAAGACTTATTGATTATTATGAGAGCGTATTTAGAAAAACCAAGGACTACTGTTGGCTGGAAAGGGTTGATTAACGACCCTGATATGAATAACTCTTTTCAAATCAATAAAGGTCTACGGATTTCGAGAGAAATGTTCATAAAACTGGTTGAAAAATTACCCATTGCTGGTGAGATGTTGGATACCATTTCTCCGCAGTTTTTGAGTGATTGTTTCTCCTTGGGTGCCATCGGCGCCAGAACTACTGAATCCCAACTGCACAGAGAATTAGCATCCGGTCTATCTTTCCCTATTGGATTTAAGAACGGTACTGATGGTGGTTTGCAAGTCGCCATCGACGCTATGAGAGCCGCTGCACATGAACATTACTTCCTTTCTGTCACATTGCCAGGTGTCACTGCTATCGTGGGCACTGAAGGTAACAAGGATACCTTCCTGATCTTGAGAGGTGGTAAGAACGGTACTAACTTTGACAAAGAAAGTGTTCAAAATACTAAGAAACAGTTAGAAAAGGCCGGTTTGACTGATGATTCCCAGAAAAGAATTATGATCGATTGTTCCCACGGCAACAGTAATAAAGATTTCAAGAACCAACCAAAGGTTGCCAAATGTATTTATGACCAGCTGACGGAGGGTGAGAATAGTCTCTGTGGTGTTATGATTGAGTCCAACATAAATGAAGGTAGACAAGATATTCCCAAAGAAGGTGGCAGAGAGGGATTGAAGTATGGTTGTTCTGTTACGGATGCTTGTATTGGCTGGGAGTCCACCGAACAGGTATTGGAGCTATTGGCAGAAGGTGTTAGAAACAGAAGAAAGGCCTTGAAAAAATAG。

[0157] Endogenous mutant Aro4 K229L The sequence of SEQ ID NO: 6 is:

[0158]

[0159] The sequence of CAR (after codon optimization) is SEQ ID NO: 7:

[0160]

[0161] The sequence of Pcg-1 (after codon optimization) SEQ ID NO: 8 is:.

[0162] The sequence of SehpaC-(GGGGS)3-PahpaB (after codon optimization) is SEQ ID NO:9:

[0163]

[0164] Note: In the sequence shown in SEQ ID NO: 9, the italicized and underlined bases are the coding sequence of (GGGGS)3.

[0165] The sequence of NtCOMT (after codon optimization) is SEQ ID NO: 10:

[0166]

[0167] The sequence of MET13atsc (after codon optimization) is SEQ ID NO: 11:

[0168]

[0169] The sequence of UGT72B1 (after codon optimization) is SEQ ID NO: 12:

[0170]

[0171] The above sequences are all sequences optimized according to the codons of Saccharomyces cerevisiae.

[0172] The present invention will be further described below in conjunction with embodiments:

[0173] Example 1

[0174] (1) Obtaining a Saccharomyces cerevisiae strain capable of stably accumulating vanillin

[0175] Provided by Yuan Yingjin's research group, strain number SyBE_Sc05220018 (strain ZR05 in patent CN 113201465A)

[0176] (2) Construction and optimization of strains capable of synthesizing p-hydroxybenzoic acid using glucose as a substrate

[0177] like Figure 1 As shown in a, the endogenous phosphoglycerate mutase encoding gene PGM1 (SGD: S000001610) of Saccharomyces cerevisiae was knocked out in strain SyBE_Sc05220018 to reduce the loss of glucose-6-phosphate G6P; the chorismate mutase encoding gene Aro7 (SGD: S000006264) was knocked out to block the conversion of chorismate CHA into prephenate PPA, and then the chorismate lyase encoding gene UbiC from Escherichia coli was introduced, that is, the expression module P was integrated at the YNRCdelta9 site (SGD: S000007145) of the genome. TEF2 -UbiC-T ADH2 , and obtained strain yScXIN329, which was able to synthesize 103.0 mg / L and 195.5 mg / L p-hydroxybenzoic acid ( Figure 1 b and 1c).

[0178] In order to further strengthen the supply of shikimate pathway precursors and relieve the feedback inhibition of DAHP (3-deoxy-D-arabino-2-heptulosonic acid 7-phosphate) synthases Aro3 and Aro4 by tyrosine or phenylalanine, we further introduced shikimate kinase EcAroL, transketolase TktA and phosphoenolpyruvate synthase PpsA from the large intestine into strain yScXIN329, and overexpressed endogenous chorismate synthase Aro2 and DAHP synthase anti-feedback inhibition mutant Aro3. K222L and Aro4 K229L The specific integration method and the synthesis of p-hydroxybenzoic acid by the obtained strain are as follows Figure 1b and 1c: The expression module P was integrated into the TKL2-TEF2 locus (SGD: S000000321; SGD: S000000322). ENO2 -EcAROL-T CYC1 The strain yScXIN332 was obtained, which could synthesize 160.0 mg / L and 255.5 mg / L p-hydroxybenzoic acid in a 2-mL YPD fermentation system after 24 h and 48 h, respectively; the expression module P was integrated at the DAK2-ZNF1 site (SGD:S000001841; SGD:S000001842). FBA1 -ppsA-T PGI1 -P PGK1 -tktA-T HXT7 -T TDH1 -P TEF2 -Aro2-T ADH2 The strain yScXIN348 was obtained, which could synthesize 170.0 mg / L and 267.0 mg / L p-hydroxybenzoic acid in the 2-mLYPD fermentation system after 24 h and 48 h, respectively; the expression module P was further integrated at the DAK2-ZNF1 site. ENO2 -Aro3 K222L -T CYC1 -P PDC1 -Aro4 K229L -T TDH3 , and obtained strain yScXIN349, which was able to synthesize 291.5 mg / L and 351.5 mg / L p-hydroxybenzoic acid in the 2-mLYPD fermentation system after 24 h and 48 h, respectively.

[0179] In order to further explore the amount of precursors that the above-mentioned construction pathway can provide for vanillin synthesis, strain yScXIN349 was fermented in a 250-mL shake flask with a 50 mL YPD system. After 96 h, 528.0 mg / L p-hydroxybenzoic acid ( Figure 2 a); By adding about 10 g / L glucose substrate into the system every 24 h, after 120 h of fermentation, 1059.5 mg / L of p-hydroxybenzoic acid can be detected to be synthesized in the system. It can be seen that this pathway has the potential to efficiently synthesize vanillin.

[0180] Example 2 Construction and verification of a strain synthesizing vanillin

[0181] (1) Construction and verification of a strain capable of converting p-hydroxybenzoic acid into vanillin

[0182] The strain yScXIN349 obtained by the above construction can synthesize p-hydroxybenzoic acid from glucose. Subsequently, a carboxylic acid reduction process needs to be introduced to convert p-hydroxybenzoic acid into p-hydroxybenzaldehyde, which is then hydroxylated to generate protocatechuic aldehyde, and further methylated to achieve the final synthesis of vanillin. Figure 3 shown.

[0183] By screening the enzymes of the downstream pathway and optimizing the integration sites, the construction scheme of the downstream pathway is as follows: Figure 4 As shown in a, the expression of SehpaC-(GGGGS)3-PahpaB and two copies of NtCOMT were integrated at the YPRCdelta15 site (SGD: S000007201), the expression module Pcg-1 and CAR gene were integrated at the YORWdelta22 site, and the expression of SAH1, MET6 and MET13atsc genes were integrated at the HO site (SGD: S000002386). The resulting strain was yScXIN361; after optimization, Figure 4 b shows: the expression module P is integrated at the YPRCdelta15 site (SGD:S000007201). PGK1 -SehpaC-(GGGGS)3-PahpaB-T HXT7 , integrating expression module P at YORWdelta22 locus PGK1 -Pcg-1-T HXT7 -P TDH3 -CAR-T TDH1 , the PDC5 gene (SGD:S000004124) was replaced by expression module T GPD1 -NtCOMT-P TDH3 -P TDH3 -NtCOMT-T GPD1 , integrating expression module P at the HO locus (SGD:S000002386) TDH3 -SAH1-T PGI1 -P GPM1 -MET6-T TEF1 -T CYC1 -P PDC1 -MET13atsc-T TDH3 , and finally obtained strain yScXIN392.

[0184] Among the above integrated genes, CAR can encode carboxylic acid reductase, and the activation of its catalytic activity requires post-translational modification by phosphopantetheinyltransferase encoded by Pcg-1. Therefore, co-expression of the two can reduce p-hydroxybenzoic acid to p-hydroxybenzaldehyde; SehpaC-(GGGGS)3-PahpaB is a coding module of HpaB and HpaC expressed by fusion of three copies of GGGGS linker, which can realize the hydroxylation of p-hydroxybenzaldehyde to generate protocatechuic aldehyde. The fusion expression can enhance the cofactor supply of this process; NtCOMT is an O-methyltransferase derived from tobacco. In order to enhance the methylation process, two copies of the coding gene NtCOMT were introduced in this study; in addition, overexpression of S-adenosylmethionine cycle-related coding genes SAH1 (SGD: S000000845), MET6 (SGD: S000000893) and MET13atsc further enhanced the methyl supply of the methylation process.

[0185] The obtained strain yScXIN361 was able to synthesize 22.0 mg / L vanillin in a 250-mL shake flask with 50 mL YPD medium as the fermentation system after 96 h of fermentation; and the strain yScXIN392 obtained after the integration site optimization of the present invention was able to synthesize 363.0 mg / L vanillin in a 250-mL shake flask with 50 mL YPD medium as the fermentation system after 96 h of fermentation ( Figure 5 a). About 10 g / L of glucose substrate was added every 24 h, and after 144 h of enhanced fermentation, 533.0 mg / L of vanillin was finally synthesized ( Figure 5 b), this concentration is the highest yield of vanillin synthesized de novo by microorganisms.

[0186] (2) Glycosylation to remove vanillin in situ relieves product inhibition

[0187] The toxic effect of vanillin on cells is one of the main reasons for the limited concentration of its biosynthesis. Glycosylation can convert vanillin into glucovanillin, which has better water solubility and less cytotoxicity. In the initial base strain SyBE_Sc05220018, three Arabidopsis thaliana-derived glycosyltransferases UGT72B1, UGT71C2 and UGT72E2 were constructed, such as Figure 6 As shown in a, UGT72B1 showed the highest catalytic efficiency; at the same time, based on the strain SyBE_Sc05220018, the genes EXG1 and / or SPR1 characterizing the endogenous glycosidic bond hydrolysis of Saccharomyces cerevisiae were knocked out, and the concentrations of glucovanillin and vanillin were measured after fermentation culture with glucovanillin as the substrate. The results are shown in Figure 6 As shown in b, the results showed that the knockout of EXG1 could significantly block the hydrolysis of glucovanillin and achieve its stable accumulation.

[0188] Therefore, in order to further enhance the synthesis of vanillin, the Arabidopsis thaliana-derived glycosyltransferase UGT72B1 was introduced into strain yScXIN392 to glycosylate vanillin. TEF2 -UGT72B1-T ADH2 The endogenous glycoside hydrolase encoding gene EXG1 (SGD: S000004291) of Saccharomyces cerevisiae was integrated and replaced, and then the knocked-out PGM1 gene was complemented to promote the conversion of G6P to glucose-1-phosphate G1P, thereby increasing the supply of UDP-glucose ( Figure 7 a), and the resulting strain was named yScXIN427.

[0189] like Figure 7 As shown in b, the strain yScXIN427 was fermented in a shake flask using YPD medium and supplemented with about 10 g / L of glucose substrate every 24 hours. After 120 hours, it was able to convert and synthesize 1339.5 mg / L of glucose vanillin, equivalent to 648.5 mg / L of vanillin, and the yield was still on the rise. The yScXIN427 strain was fermented in a 5-L fermenter, with the initial sugar set at 15 g / L and the pH automatically controlled at 5.9. Starting 15 hours after the start of fermentation, 200 g / L yeast extract mother liquor was added at a flow rate of 5 to 7 mL / min to supplement the nitrogen source. Samples were taken to monitor bacterial growth, ethanol accumulation concentration, and glucose residual, and fine-tuned parameters such as stirring speed, aeration rate, and substrate and nitrogen source flow acceleration rate. Figure 7 As shown in Fig. c, the initial glucose was consumed within 12 h, and there was basically no glucose residual in the subsequent feeding process. It accumulated slightly in the later stage of fermentation, but the concentration was always maintained at a low level; the ethanol concentration reached a maximum value of 6.9 g / L at 20 h and was gradually consumed in the subsequent fermentation process; the strain growth was slower than that of the previous batch, with a maximum OD600 of 32.6; the concentration of glucose vanillin continued to rise after 132 h of fermentation, reaching 7476.5 mg / L, equivalent to 3619.4 mg / L of vanillin, and basically no by-products were detected in the system.

[0190] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A preparation of p-hydroxybenzoic acid or synthetic vanillin synthesized from scratch, characterized in that: include: (1) Promote UbiC, AroL, TktA, PpsA, Aro2, Aro3 K222L 、Aro4 K229L a preparation in which at least one gene or enzyme thereof is expressed; and (2) An agent that inhibits, knocks down and / or knocks out the expression of at least one gene or enzyme of PGM1 and Aro7.

2. The preparation according to claim 1, characterized in that Also included is the preparation shown in (3), or also includes the preparations shown in (3) and (4): (3) a preparation that promotes the expression of at least one gene or enzyme thereof selected from CAR, Pcg-1, HpaB, HpaC, NtCOMT, SAH1, MET6 and MET13atsc; (4) Preparations that promote the expression of UGT72B1 gene or its enzyme.

3. Use of the preparation according to claim 1 or 2 in the synthesis of p-hydroxybenzoic acid or vanillin.

4. A genetic element, characterized in that Includes at least one of the following genetic elements 1 to 11: The genetic element 1 includes the UbiC gene; The genetic element 2 includes the AroL gene; The gene element 3 includes TktA, PpsA, Aro2, Aro3 K222L 、Aro4 K229L At least one of the genes; The genetic element 4 includes a homologous fragment for knocking out the PGM1 gene; The gene element 5 includes a homologous fragment for knocking out the Aro7 gene; The genetic element 6 includes CAR and Pcg-1; The genetic element 7 includes HpaB and HpaC genes; The genetic element 8 includes NtCOMT, SAH1, MET6 and MET13 atsc At least one of the genes; The genetic element 9 includes the UGT72B1 gene; The genetic element 10 includes a homologous fragment for knocking out the PDC5 gene; The genetic element 11 includes a homologous fragment for knocking out the EXG1 gene.

5. The genetic element according to claim 4, characterized in that The UbiC, AroL, TktA and PpsA genes are derived from E. coli; the UGT72B1 gene is derived from Arabidopsis thaliana; the NtCOMT gene is derived from Nicotiana tabacum; the CAR is derived from Nocardia genus, and Pcg-1 is derived from Corynebacterium glutamicum; SAH1 and MET6 are endogenous genes of yeast; the MET13atsc gene is assembled by splicing the MTHFR gene derived from Arabidopsis thaliana and the MET13 gene derived from Saccharomyces cerevisiae; HpaB is derived from Pseudomonas aeruginosa; HpaC is derived from Salmonella enterica; the Aro3 K222L 、Aro4 K229L Derived from Saccharomyces cerevisiae.

6. An expression module, characterized in that It includes: A promoter, a terminator and the genetic element according to any one of claims 4 to 5.

7. A carrier, characterized in that It comprises a backbone vector and the expression module as claimed in claim 6.

8. A recombinant strain, characterized in that The gene as shown in (1) is overexpressed, and / or the gene as shown in (2) is suppressed, knocked down or knocked out: (1)UbiC, AroL, TktA, PpsA, Aro2, Aro3 K222L 、Aro4 K229L At least one gene in (2) At least one gene of PGM1 and Aro7.

9. The recombinant strain according to claim 8, characterized in that The recombinant strain also includes at least one of the following modifications: It overexpresses at least one gene among CAR, Pcg-1, HpaB, HpaC, SAH1, MET6 and MET13atsc; and / or its PDC5 gene is replaced by the NtCOMT gene; and / or, its EXG1 gene is replaced by the UGT72B1 gene; and / or restoration of its PGM1 gene expression.

10. The recombinant strain according to claim 8 or 9, characterized in that: The insertion site and integration site of the overexpressed gene in the yeast genome include: The integration site of the UbiC gene includes the YNRCdelta9 site; The integration site of the AroL gene includes the TKL2-TEF2 site; TktA, PpsA, Aro2, Aro3 K222L and Aro4 K229L Integration sites of the gene include the DAK2-ZNF1 site; The integration sites of HpaB and HpaC genes include the YPRCdelta15 site; Integration sites of CAR and Pcg-1 genes include the YORWdelta22 site; The insertion site of the NtCOMT gene is the position of the original PDC5 gene; The integration sites of the SAH1, MET6 and MET13 genes include the HO site; The insertion site of the UGT72B1 gene is the position of the original EXG1 gene.

11. The recombinant strain according to any one of claims 8 to 10, characterized in that: The chassis bacteria is the Saccharomyces cerevisiae strain BY4742 in which ADH6, ADH7, BDH1, BDH2, Ari1, GRE2, and HFD1 are knocked out.

12. The method for constructing the recombinant strain according to claim 9, characterized in that: include: The expression module as claimed in claim 6 or the vector as claimed in claim 8 is introduced into the chassis strain to obtain the recombinant strain.

13. Use of at least one of the following a to d in the production of vanillin: a. The expression module according to claim 6; b. The vector according to claim 7; c. The recombinant strain according to any one of claims 8 to 11; d. The recombinant strain obtained by the construction method according to claim 12.

14. A method for producing vanillin, characterized in that: Cultivating the strains according to claims 8 to 11 or the recombinant strain obtained by the construction method according to claim 12, and fermenting to obtain vanillin; The carbon source of the fermentation medium includes glucose.

Images