Application of arabidopsis atpB gene in improving plant stress resistance

By constructing an overexpression vector of the Arabidopsis atpB gene in plants, the shortcomings of the Arabidopsis atpB gene in stress resistance applications were solved, the plant's tolerance to drought and salt stress was improved, and the plant's stress resistance was enhanced.

CN119331898BActive Publication Date: 2025-10-21NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411703740.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-26
Publication Date
2025-10-21
Estimated Expiration
2044-11-26

AI Technical Summary

Technical Problem

In the prior art, the stress resistance function of the Arabidopsis atpB gene has not been fully studied and applied, and it is difficult to improve the stress resistance of plants, especially their tolerance to drought and salt stress, through transgenic technology.

Method used

By constructing a plant overexpression vector containing the Arabidopsis thaliana atpB gene and transforming it into plants, drought-resistant and/or salt-resistant transgenic plants are cultivated, and the Arabidopsis thaliana atpB gene is used to improve the stress resistance of the plants.

Benefits of technology

The Arabidopsis atpB gene can respond to drought and salt stress, increase the germination rate, green leaf rate and root length elongation of transgenic plants, enhance the plant's drought and salt resistance, reduce oxidative damage, increase chlorophyll content, and enhance the plant's stress resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119331898B_ABST
    Figure CN119331898B_ABST
Patent Text Reader

Abstract

The present application relates to the application of Arabidopsis thaliana atpB gene in improving plant stress resistance, and belongs to the technical field of plant genetic engineering breeding. In order to provide more stress resistance genes applicable to transgenic technology to improve plant stress resistance, the present application provides the application of Arabidopsis thaliana atpB gene in improving plant stress resistance, specifically the application of Arabidopsis thaliana atpB gene in improving plant drought tolerance and / or salt tolerance, including constructing a plant overexpression vector containing Arabidopsis thaliana atpB gene and transforming it into plants to cultivate drought-tolerant and / or salt-tolerant transgenic plants. The present application proves that the Arabidopsis thaliana atpB gene can respond to drought and salt stress, and the seedling stage phenotype of Arabidopsis thaliana atpB overexpression plants after drought and salt stress treatment is observed. The results show that the Arabidopsis thaliana atpB gene can significantly improve the drought tolerance and salt tolerance of transgenic plants, and is an excellent gene for plant drought and / or salt genetic engineering breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering breeding, and in particular relates to the application of Arabidopsis thaliana atpB gene in improving plant stress resistance. Background Art

[0002] Plant stress tolerance refers to a plant's ability to resist, adapt, and endure environmental factors that are detrimental to its growth and survival. This ability allows plants to maintain growth and reproduction despite adverse conditions. In agriculture and forestry, leveraging plant stress tolerance can improve crop yield and quality. Breeding crop varieties with superior stress tolerance can reduce the impact of adverse conditions on crop growth and enhance crop resistance and adaptability.

[0003] Genetic modification is a common method for improving plant stress resistance. This includes screening stress-resistant varieties for cross-breeding and using genetic engineering techniques to introduce stress-resistant genes into plants, thereby enhancing their stress tolerance. For example, introducing saline-alkali tolerance genes into crops through transgenic technology can significantly improve their salt-alkali tolerance. Stress-resistant genes can be derived from naturally stress-resistant plants or microorganisms, or they can be genes for proteins produced by plants to protect their cells in adverse conditions. The large number of stress-resistant genes in plants and their widespread distribution make their screening extremely complex. Different stress-resistant genes may have different functions and mechanisms of action, which increases the difficulty of screening and identifying stress-resistant genes.

[0004] Chloroplast ATP synthase is closely linked to plant energy metabolism and plays a crucial role in plant interactions with the external environment. The α-subunit (atpA) and β-subunit (atpB) of ATP synthase play crucial roles in plant energy metabolism. AtpB plays a central role in regulating ATP synthase activity and its interactions with substrates. Previous studies have shown that the Arabidopsis atpB gene confers resistance to Pseudomonas syringae (Pst. DC3000). However, antimicrobial and stress tolerance in plants are biologically independent, developing distinct adaptive mechanisms in response to different external stresses and challenges. Their targets and mechanisms differ. Therefore, the antimicrobial function of the Arabidopsis atpB gene cannot be used to infer its other functions, and its stress tolerance function has yet to be reported. Summary of the Invention

[0005] In order to provide more stress-resistant genes that can be applied to transgenic technology to improve plant stress resistance, the present invention provides the use of the Arabidopsis thaliana atpB gene in improving plant stress resistance.

[0006] The technical solution of the present invention:

[0007] Application of Arabidopsis atpB gene in improving plant stress resistance.

[0008] Furthermore, the nucleotide sequence of the Arabidopsis thaliana atpB gene is shown in SEQ ID No: 1.

[0009] Furthermore, the application is the application of the Arabidopsis thaliana atpB gene in improving the drought tolerance and / or salt tolerance of plants.

[0010] Furthermore, the application includes constructing a plant overexpression vector containing the Arabidopsis thaliana atpB gene, transforming the constructed plant overexpression vector into plants, and cultivating drought-resistant and / or salt-resistant transgenic plants.

[0011] Furthermore, the plant is a woody plant or a herbaceous plant.

[0012] Furthermore, the woody plant is Arabidopsis thaliana.

[0013] A plant overexpression vector containing the Arabidopsis atpB gene.

[0014] A recombinant genetic engineering bacterium containing the plant overexpression vector.

[0015] Furthermore, a plant overexpression vector containing the Arabidopsis thaliana atpB gene is introduced into Escherichia coli or Agrobacterium to construct the vector.

[0016] Beneficial effects of the present invention:

[0017] The present invention confirms that the Arabidopsis thaliana atpB gene can respond to drought and salt stress. The seedling phenotypes of Col-0, atpB-OE, atpb, and atpBpro:atpB plants after drought and salt stress treatment were observed. Compared with Col-0 and atpBpro:atpB, atpB-OE and atpb had higher germination rates, green leaf rates, and root length and elongation phenotypes. The seedling phenotypes and related physiological indicators were tested, and the results showed that atpB-OE improved the plant's ability to scavenge active oxygen, accumulated higher chlorophyll content and lower MDA content to resist drought and salt stress. This shows that the Arabidopsis thaliana atpB gene can significantly improve the drought and salt tolerance of transgenic plants and is an excellent gene for genetic engineering breeding of plants with drought and / or salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a comparison chart of the expression of the Arabidopsis thaliana atpB gene under different drought stress times in Example 2;

[0019] Figure 2 This is a comparison diagram of the expression of the Arabidopsis thaliana atpB gene under different salt stress times in Example 2;

[0020] Figure 3 Comparative photos of seed germination phenotypes of Col-0, atpB-OE, atpb, and atpBpro:atpB plants grown on culture media with different mannitol concentrations in Example 3;

[0021] Figure 4 and Figure 5 Comparison of germination rate and green leaf rate of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on culture media with different mannitol concentrations for 10 days in Example 3;

[0022] Figure 6 These are photos of the root growth phenotypes of Col-0, atpB-OE, atpb, and atpBpro:atpB plants grown on culture media with different mannitol concentrations in Example 4;

[0023] Figure 7 This is a comparison of the root growth coefficients of Col-0, atpB-OE, atpb, and atpBpro:atpB plants grown on culture media with different mannitol concentrations in Example 4;

[0024] Figure 8 The following are phenotypic photos of the Col-0, atpB-OE, atpb, and atpBpro:atpB plants in Example 5 before and after drought treatment. The value corresponding to each plant in the figure is the soil moisture content value;

[0025] Figure 9 This is a comparison of the chlorophyll a content, chlorophyll b content, and total chlorophyll content of Col-0, atpB-OE, atpb, and atpBpro:atpB plants before and after drought treatment in Example 5;

[0026] Figure 10 This is a comparison of the MDA content of Col-0, atpB-OE, atpb, and atpBpro:atpB plants before and after drought treatment in Example 5;

[0027] Figure 11 Comparative photos of seed germination phenotypes of Col-0, atpB-OE, atpb, and atpBpro:atpB plants grown on culture media with different NaCl concentrations in Example 6;

[0028] Figure 12 and Figure 13 These are comparative graphs of germination rate and green leaf rate of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on culture media with different NaCl concentrations for 10 days in Example 6;

[0029] Figure 14These are photos of the root growth phenotypes of Col-0, atpB-OE, atpb, and atpBpro:atpB plants grown on culture media with different NaCl concentrations in Example 7;

[0030] Figure 15 This is a comparison of the root growth coefficients of Col-0, atpB-OE, atpb, and atpBpro:atpB plants grown on culture media with different NaCl concentrations in Example 7;

[0031] Figure 16 Phenotypic photos of Col-0, atpB-OE, atpb, and atpBpro:atpB plants before and after salt stress treatment in Example 8;

[0032] Figure 17 These are typical images of NBT, DAB, and trypan blue staining of Col-0, atpB-OE, atpb, and atpBpro:atpB plants before and after salt stress treatment in Example 8;

[0033] Figure 18 This is a comparison of the chlorophyll a content, chlorophyll b content and total chlorophyll content of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after salt stress treatment in Example 8;

[0034] Figure 19 This is a comparison of the MDA content of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after salt stress treatment in Example 8. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described below with reference to the embodiments, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be included in the scope of protection of the present invention. The process equipment or devices not specifically noted in the following examples are all conventional equipment or devices in the art. Unless otherwise specified, the raw materials used in the examples of the present invention can be obtained commercially; unless otherwise specified, the technical means used in the examples of the present invention are all conventional means well known to those skilled in the art.

[0036] Example 1

[0037] This example provides a method for preparing atpB-OE Arabidopsis thaliana overexpressing the atpB gene and a method for preparing atpBpro:atpB complemented plants of Arabidopsis thaliana with atpB mutation.

[0038] Plant materials used in this example:

[0039] Wild-type Arabidopsis Col-0 is a Columbia background Arabidopsis (Arabidopsis ihaliana). The Arabidopsis atpB gene T-DNA insertion mutant is numbered SALK 004946C. Arabidopsis mutant seeds were purchased from the ABRC website. The culture conditions were: 23°C, 16 h light, 8 h dark.

[0040] The strains and vectors used in this example are:

[0041] (1) Escherichia coli DH5α and Agrobacterium tumefaciens GV3101 (pSoup-P19) were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0042] (2) The preparation method of the vector pSuper1300-Myc is as follows: a 35S promoter is added before the 5' end of the multiple cloning site sequence of the commercially available pCAMBIA1300 vector, and a Myc tag is added after the 3' end of the multiple cloning site sequence, which is the vector pSuper1300-Myc.

[0043] 1. Method for constructing the Arabidopsis thaliana atpB gene overexpression vector and the recombinant genetically engineered bacteria containing the Arabidopsis thaliana atpB gene in this embodiment:

[0044] 1. Plant RNA extraction method:

[0045] Place 0.5-1 g of Arabidopsis leaves in an RNase-free 1.5 mL microcentrifuge tube and place small steel balls. Quickly freeze in liquid nitrogen and then grind using a tissue disruptor. Add 1 mL of TransZolUP to the tube, vortex to create a homogenate, and shake at room temperature for 5 minutes. Then, add 200 μL of pre-chilled chloroform, vortex to mix thoroughly, incubate at room temperature for 3 minutes, and centrifuge at 10,000 × g at 2-8°C for 15 minutes. After centrifugation, transfer the upper, colorless aqueous phase to a new 1.5 mL microcentrifuge tube. Add 500 mL of pre-chilled isopropanol, invert to mix thoroughly, and let stand for 10 minutes. Centrifuge at 10,000 × g at 2-8°C for 10 minutes, and discard the supernatant. Add 1 mL of 75% ethanol (750 μL of anhydrous ethanol + 250 μL of DEPC water), vortex, and centrifuge at 7,500 × g at 2-8°C for 5 minutes. Remove the supernatant, dry the precipitate at room temperature, add 50-100 μL RNA Dissolving Solution, incubate at 55-60°C for 10 min, and store at -70°C.

[0046] 2. Reverse transcription into cDNA

[0047] Total plant RNA was reverse transcribed into cDNA using the SPARKscript II All-in-one RT SuperMix for qPCR kit. All operations were performed on ice using enzyme-free microcentrifuge tubes and pipette tips. Specifically:

[0048] Add the components listed in Table 1 to the centrifuge tube in sequence, mix well, and centrifuge briefly. Incubate at 50°C for 15 minutes and at 80°C for 5 seconds. Aliquot the product and store at -20°C.

[0049] Table 1

[0050]

[0051]

[0052] 3. Gene cloning

[0053] The Arabidopsis genes used in the experiment were cloned using wild-type Arabidopsis thaliana (Co1-0) cDNA as a template according to the PCR reaction system and reaction procedures shown in Tables 2 and 3.

[0054] Table 2

[0055]

[0056] Table 3

[0057]

[0058] The primer sequences used in this example are as follows:

[0059] Forward Primer: TGCTCTAGAATGAGAACAAATCCTACTACTT

[0060] Reserve Primer: CGGGGTACCTTTCTTCAATTTACTCTCCATTT

[0061] The sequence of the Arabidopsis thaliana atpB gene obtained in this example is as follows:

[0062] Serial number: ATCG00480.1

[0063] CDS Sequence (1497)

[0064]

[0065] 4. PCR product gel recovery (purification)

[0066] This test uses the Kangwei Century Gel Extraction Kit, specifically:

[0067] Excise the DNA band and place it in a microcentrifuge tube. Weigh the DNA band and add an equal volume of Buffer PG. Incubate the tube in a 50°C waterbath, gently inverting the tube every 2-3 minutes. Cool to room temperature, then load the column. Equilibrate the column and add 200 μL of Buffer PS to the column. Incubate at 13,000 rpm for 1 minute, discarding the waste solution. Add the solution from step 2 to the column and let it stand at room temperature for 2 minutes. Incubate at 13,000 rpm for 1 minute, discarding the waste solution. Add 450 μL of Buffer PW (containing anhydrous ethanol) and incubate at 13,000 rpm for 1 minute, discarding the waste solution. Centrifuge at 13,000 rpm for 1 minute, discarding the waste solution, and repeat the centrifugation process once. Place the column in a new 1.5 ml microcentrifuge tube and drip 50-100 μL of ddH2O (preheated in a 50°C waterbath) onto the center of the adsorption membrane. Incubate at room temperature for 2 minutes. Incubate at 12,000 rpm for 2 minutes, and store at -20°C.

[0068] 5. Double enzyme digestion

[0069] The purified product of the target gene was double-digested, and the components listed in Table 4 were added to a microcentrifuge tube in sequence. After gentle mixing, the mixture was incubated at 37°C for 30 minutes. After adding 10× DNA Loading Buffer, the mixture was subjected to agarose gel electrophoresis again to recover the DNA.

[0070] Table 4

[0071]

[0072] The vector double enzyme digestion reaction system is shown in Table 5. After gentle mixing, incubate at 37°C for 30 min, inactivate at 65°C for 20 min, and terminate the reaction.

[0073] Table 5

[0074]

[0075] 6. Recombinant Plasmid Ligation

[0076] Proceed according to the recombinant plasmid ligation system shown in Table 6, at 16°C for 1-3 hours or at 4°C overnight.

[0077] Table 6

[0078]

[0079] 7. Heat shock transformation of E. coli

[0080] Remove the DH5α competent cell from -80°C and thaw on ice. Aspirate 10 μL of the ligation product and add it to the competent cell, gently mix, and incubate on ice for 25 minutes. Heat shock the cell in a 42°C water bath for 45 seconds, remove the competent cell, and incubate on ice for 2 minutes. Add 700 μL of antibiotic-free LB medium and incubate at 37°C at 200 rpm for 1 hour. Centrifuge at 6,000 rpm for 1 minute. Discard the supernatant and mix the remaining 100 μL of the bacterial suspension by pipetting. Apply the mixture to the appropriate culture medium and incubate at 37°C for 12–24 hours.

[0081] 2. Arabidopsis transformation method of this example

[0082] 1. Plasmid mini-prep: This experiment uses the EasyPure HiPure Plasmid MiniPrep Kit. Detailed steps are provided in the instructions.

[0083] 2. Freeze-thaw transformation of Agrobacterium

[0084] Remove the GV3101 (pSoup-P19) competent cell from the ultra-low temperature freezer, thaw at room temperature, and place on ice. Add 0.01-1 μg of the pSuper1300-atpB-MYC plasmid to the thawed Agrobacterium GV3101 (pSoup-P19) competent cell. Incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and finally in an ice bath for 5 minutes. Add 700 μL of antibiotic-free LB medium to a centrifuge tube and incubate at 28°C, 200 rpm, for 2 hours. Centrifuge the tube at 6,000 rpm for 1 minute to collect the cells. Reserve approximately 100 μL of the supernatant and gently pipette to resuspend the cells. Then, spread the cell suspension evenly over the surface of the LB medium containing antibiotics. Incubate the plate upside down at 28°C for 2–3 days. Transfer a single colony from the plate to LB liquid medium containing Rif and Kan resistance. Incubate at 28°C with a shaker at 200 rpm for 2–3 days. Transfer 1 μL of the culture to PCR for identification. Mix the identified culture with glycerol and store in a -80°C freezer.

[0085] 3. Planting of Arabidopsis thaliana

[0086] Select a clean 1.5mL microcentrifuge tube and place the seeds to be sterilized in advance. In a sterile operating table, add 900μL of sterile water, 100μL of sodium hypochlorite, and 1μL of Tween-80 to the centrifuge tube in sequence and shake for 7-8 minutes. In a sterile operating table, rinse the sterilized seeds with sterile water 5-6 times until the foam disappears. Use an inoculating loop to evenly distribute the sterilized seeds on 1 / 2 MS culture medium and culture in a light incubator for 1 week. For Arabidopsis planting: Mix seedling soil and vermiculite in a 1:1 ratio and water until the soil is completely moist. Then, transplant Arabidopsis seedlings grown to four leaves on the culture medium into soil and culture in an Arabidopsis climate chamber (22°C, 16h light / 8h dark) under film for 2 days. Remove the film and continue culturing.

[0087] 4. Arabidopsis Transformation

[0088] Using the inflorescence dip method:

[0089] Pick pSuper1300-atpB-MYC positive colonies and expand them in 50 mL LB liquid medium containing 50 mg / L Kan and 25 mg / L R-Lif. Incubate overnight at 28°C in a shaker until OD 600 =1.8-2.0, centrifuge at 4,000 rpm, 4°C, for 10 min to collect the bacteria. Resuspend the bacteria in sucrose solution (5 g sucrose per 100 mL distilled water + 25 μL Sliweet-77) and dilute the bacterial solution to OD 600 = 0.6-0.8. Carefully place the flower buds of the Arabidopsis plants in the bacterial solution and soak for approximately 20 seconds. After infection, bag the plants and incubate them in the dark for 24 hours. After 24 hours, punch holes in the bag. Remove the bag after 2 days and incubate the plants in a normal Arabidopsis climate chamber. One week later, infect again using the same method.

[0090] 3. Preparation Method of atpBpro:atpB Complemented Plants of Arabidopsis thaliana atpb Mutation in This Example

[0091] pSuper1300-atpB-Myc was transformed into atpb using the inflorescence dip method to obtain T0 generation atpB complemented seeds. The T0 generation seeds were then screened in a screening medium (1 / 2MS + 50 mg / L hygromycin). The T1 generation positive plants obtained from the screening were identified at the DNA level using hygromycin primers. The total RNA from atpb and the leaves of 8 positive plants was then extracted using the TRIzol method. The RNA concentration of each sample was adjusted to be consistent. The corresponding cDNA was obtained by reverse transcription and used as a template for transcriptional identification. The expression level of the atpB gene in the positive plants was detected. After individual transgenic plants with high expression levels were harvested, T2 generation seeds were sown on the screening medium, and the T2 plants were then tested for DNA level. The seeds of each positive plant were collected, and more than 30 seeds of the same number of positive plants were inoculated on the screening medium. Plants with green cotyledons and all surviving were homozygous transgenic plants. Two independent homozygous transgenic positive atpBpro:atpB plants were selected for the experiment.

[0092] Example 2

[0093] This example demonstrates that the Arabidopsis atpB gene can respond to drought and salt stress.

[0094] In this example, wild-type Arabidopsis thaliana Col-0, which grew uniformly in the soil, was transferred to a nutrient solution containing 1 / 2 Hoagland and cultured for 2 days. The culture was then continued in a 1 / 2 Hoagland + 200 mM mannitol nutrient solution and a 1 / 2 Hoagland + 125 mM NaCl nutrient solution, and samples were taken at 0 h, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h.

[0095] Arabidopsis RNA was extracted using the TRIzol method, and cDNA was obtained by reverse transcription. RT-qPCR was then used to detect the expression of the Arabidopsis atpB gene under drought and salt stress at different times. Figure 1 and Figure 2 As shown in the figure, the expression of Arabidopsis atpB gene increased, indicating that it can respond to drought and salt stress.

[0096] Example 3

[0097] This example investigates the seedling phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpBpro:atpB under drought stress.

[0098] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated onto 1 / 2MS, 1 / 2MS+150mM mannitol and 1 / 2MS+175mM mannitol culture media for germination tests, and photos were taken to record the germination of seeds of the four strains at 3d, 7d and 11d. The germination rate and green leaf rate of each strain after 10d of growth on 1 / 2MS plus different concentrations of mannitol culture medium were investigated and counted.

[0099] Seed germination of the four strains is as follows Figure 3-Figure 5 As shown, 6 days after sowing on 1 / 2MS medium, the seeds of the four lines were able to germinate, and the germination rate and green leaf rate of atpB-OE and atpb were not significantly different from those of Col-0 and atpBpro:atpB.

[0100] After sowing on 1 / 2MS + 150mM mannitol medium, the germination rates of atpb, atpB-OE, Col-0, and atpBpro:atpB reached 95% on day 5, 81% germination, 92% germination, and 90% germination. Green leaves were found in 80% and 70% of atpb and atpB-OE, respectively, compared to 57% and 56% of Col-0 and atpBpro:atpB, respectively. Compared to Col-0 and atpBpro:atpB, atpb and atpB-OE exhibited more luxuriant cotyledon growth.

[0101] After sowing on 1 / 2MS+175mM mannitol medium, it was found that on the 8th day, atpB-OE and atpb all germinated, and the germination rates of Col-0 and atpBpro:atpB were both 94%; the green leaf rate of atpb was 56%, the green leaf rate of atpB-OE was 42%, while the green leaf rate of Col-0 was 35%, and the green leaf rate of atpBpro:atpB was 37%. The green leaf rate of atpb was significantly different from that of Col-0, and the overall growth of the cotyledons of Col-0 showed a wilting state.

[0102] The above results indicate that atpb and atpB-OE improve the tolerance of plants to drought stress.

[0103] Example 4

[0104] This example investigates the root length and elongation phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpBpro:atpB under drought stress.

[0105] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated on 1 / 2MS medium respectively. Some one-week-old plants with consistent germination were selected and inoculated on 1 / 2MS+175mM mannitol medium for root length detection test. The roots were observed and photographed every day.

[0106] like Figure 6 As shown, the root length growth of the four lines was basically the same in 1 / 2MS medium without mannitol. In 1 / 2MS medium containing 175 mM mannitol, the root length of Col-0 and atpBpro:atpB was shorter than that of atpB-OE and atpb, and the root length growth was inhibited.

[0107] like Figure 7 As shown in the figure, by statistical analysis of the elongation of the main root, compared with Col-0 and atpBpro:atpB, as the treatment days increased, the root elongation rate of atpB-OE was significantly lower than that of Col-0 and atpBpro:atpB, and the root elongation rate of atpb was significantly higher than that of Col-0 and atpBpro:atpB. This generally indicates that the mutation of the atpB gene improves the tolerance of Arabidopsis to drought stress.

[0108] Example 5

[0109] This example investigates the phenotypic and physiological index detection of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpb atpBpro:atpB under drought stress.

[0110] Col-0, atpB-OE, atpb and atpBpro:atpB plants grown normally at 22°C for 4 weeks were subjected to drought and water deprivation treatments. The morphological changes of the seedlings during the stress period were observed and photographed.

[0111] The chlorophyll content determination method of the present invention is as follows:

[0112] (1) The following steps were performed under low light. 0.2 g of fresh plant leaves were weighed, the surface was wiped clean, and the leaves were chopped into small pieces.

[0113] (2) Place in a microcentrifuge tube, shake and crush, then add a small amount of 95% ethanol to wash in batches into a 50 mL centrifuge tube, and dilute to 50 mL and mix thoroughly;

[0114] (3) Using 95% ethanol as a blank, aspirate 1 mL of the extract and measure the absorbance at wavelengths of 470 nm, 665 nm, and 649 nm.

[0115] Ca=13.95A665 -6.88A 649

[0116] Cb=24.96A 649 -7.32A 665

[0117] Total chlorophyll concentration = Ca + Cb

[0118] Chlorophyll content = (chlorophyll concentration × extract volume × dilution factor) / sample fresh weight

[0119] like Figure 8 As shown in the figure, at 20 days, compared with the control group, Col-0 and atpBpro:atpB lost water and wilted, and large areas of leaves turned yellow and fell over. The same was true for atpB-OE. However, atpb plants remained strong and the leaves showed less chlorosis.

[0120] Chlorophyll content is closely related to photosynthesis, so the chlorophyll a, chlorophyll b and total chlorophyll contents of Col-0, atpB-OE, atpb and atpBpro:atpB plants subjected to drought and water deprivation treatments for 0 and 20 days were measured.

[0121] like Figure 9 As shown in the results, statistical analysis revealed that compared with Col-0 and atpBpro:atpB, the chlorophyll a, chlorophyll b, and total chlorophyll contents of atpb and atpB-OE plants were higher than those of Col-0 and atpBpro:atpB, with atpb being even more significant, reaching up to 1.6 times that of Col-0, indicating that atpb has a stronger ability to resist drought stress.

[0122] At the same time, the MDA of Col-0, atpB-OE, atpb and atpBpro:atpB plants were measured at 0d and 20d after drought and water deprivation treatment.

[0123] like Figure 10 As shown, compared with Col-0, the MDA content of atpB-OE was slightly lower than that of Col-0, and the MDA content of atpB was significantly lower than that of Col-0 and atpBpro:atpB, which was 4.7 times lower than that of Col-0.

[0124] The above results indicate that atpb and atpB-OE reduce the degree of oxidative damage in Arabidopsis thaliana under drought stress and improve the plant's tolerance to drought stress.

[0125] Example 6

[0126] This example investigates the seedling phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpBpro:atpB under salt stress.

[0127] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated onto 1 / 2MS, 1 / 2MS+100mMNaCl and 1 / 2MS+125mMNaCl culture media for germination tests, and photos were taken to record the germination of seeds of the four strains at 3d, 7d and 11d. The germination rate and green leaf rate of each strain after 10d of growth on 1 / 2MS plus different concentrations of NaCl culture medium were investigated and counted.

[0128] Seed germination of the four strains is as follows Figure 11-13 As shown, 6 days after sowing on 1 / 2MS medium, the seeds of the four lines were able to germinate, and the germination rate and green leaf rate of atpB-OE and atpb were not significantly different from those of Col-0 and atpBpro:atpB.

[0129] After sowing on 1 / 2MS + 100mM NaCl medium, the germination rates of atpb, atpB-OE, atpBpro:atpB, and atpBpro:atpB on day 5 were 97%, 94%, 81%, and 84% respectively. On day 7, 95% of atpb plants had green leaves, while Col-0 and atpBpro:atpB plants had green leaves of 81%, and only 61% of atpB-OE plants. Compared to Col-0, atpb plants exhibited more lush cotyledon growth, while atpB-OE plants were more wilted.

[0130] After sowing on 1 / 2MS+125mMNaCl medium, it was found that the overall germination rate of the four strains was about 10% lower than that on 1 / 2MS+100mMNaCl medium; at 6 days, the green leaf rate of atpb was 8%, while the green leaf rates of the other three strains were all 0, indicating that the atpb mutant caused Arabidopsis to increase its tolerance after NaCl treatment.

[0131] Example 7

[0132] This example investigates the root length and elongation phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpBpro:atpB under salt stress.

[0133] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated on 1 / 2MS medium respectively. Some one-week-old plants with consistent germination were selected and inoculated on 1 / 2MS+100mMNaCl medium for root length detection test. The roots were observed and photographed every day.

[0134] like Figure 14 As shown, the root length growth of the four lines was basically the same in 1 / 2MS medium without NaCl. In 1 / 2MS medium containing 100mMNaCl, the root length of Col-0 and atpBpro:atpB was shorter than that of atpB-OE and atpb, and the root length growth was inhibited.

[0135] like Figure 15 As shown in the data, by statistically analyzing the elongation of the main root, compared with Col-0 and atpBpro:atpB, as the treatment days increased, the root elongation rate of atpB-OE was slightly higher than that of Col-0 and atpBpro:atpB, and the root elongation rate of atpb was significantly higher than that of Col-0 and atpBpro:atpB. This generally shows that atpB-OE and atpb can improve the tolerance of plants to salt stress.

[0136] Example 8

[0137] This example investigates the phenotypic and physiological index detection of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpb atpBpro:atpB under salt stress.

[0138] Col-0, atpB-OE, atpb and atpBpro:atpB potted seedlings grown normally at 22°C for 4 weeks were watered with 150 mM NaCl for five days, and the morphological differences of the four strains were recorded by photographing.

[0139] like Figure 16 As shown, compared with the control group at 0d, on the 5th day, Col-0 and atpBpro:atpB turned yellow and wilted, and the plants fell over, and the same was true for atpB-OE; while atpb plants remained strong and the leaf chlorosis was less severe.

[0140] To verify whether atpB-OE and atpb eliminate hydrogen peroxide (H2O2) and superoxide anions (O2-·) in the body through the ROS pathway, untreated and treated Arabidopsis thaliana were stained with tetrazolium blue chloride (NBT), DAB and trypan blue to observe the H2O2 accumulation in leaf cells and the severity of cell death.

[0141] The NBT dyeing method is as follows:

[0142] Prepare nitro blue tetrazolium (NBT) staining solution, wash fresh leaves with distilled water, dry the surface moisture, soak them in the staining solution, and store them in the dark at room temperature for more than 8 hours; then use anhydrous ethanol to decolorize the leaves, and observe and photograph the staining results using a stereo microscope (IMAGEVIEW).

[0143] The DAB staining method of the present invention is:

[0144] Prepare a 1mg / mL DAB solution (50mM Tris-AcOH, pH 5.0). Cut a leaf and place it in a centrifuge tube. Add the DAB solution until the sample is submerged. Soak in the dark at room temperature for 8-12 hours. Afterward, pour off the staining solution and place the leaf in a decolorizing solution (acetic acid: glycerol: ethanol) in a 1:1:3 volume ratio. Decolorize in a waterbath until the green color disappears. Fix the decolorized leaf with 60% glycerol, observe and photograph under a microscope. Cells with hydrogen peroxide accumulation will appear as brown spots.

[0145] The trypan blue staining method of the present invention is:

[0146] Prepare trypan blue staining solution. Prepare the solution immediately before use. Cut the leaf into a centrifuge tube and add trypan blue staining solution until the sample is submerged. Boil in boiling water for 2 minutes and let stand overnight at room temperature. Pour off the staining solution and decolorize with 2.5g / mL chloral hydrate. After decolorization, mount the leaf with 60% glycerol. Dead cells will be stained blue under a microscope.

[0147] The MDA content determination method of the present invention is:

[0148] Weigh 0.2 g of plant tissue, chop it into pieces and place it in a centrifuge tube, quickly freeze it in liquid nitrogen, and grind the sample in a tissue shaker; add 1.6 mL of 10% TCA (prepared with 1 g powder and 10 mL of deionized water) to the centrifuge tube and vortex for 1 min; 12,000 rpm for 10 min; aspirate 700 μL of supernatant and add 700 μL of 0.67% TBA (dissolved in 0.67 g of thiobarbituric acid and 1 mol / L of NaOH, and dilute to 100 mL with 10% TCA), mix well, and place in a boiling water bath for 15 min; use 700 μL of deionized water and 700 μL of 0.67% TBA as a blank control, and after cooling, measure the absorbance at wavelengths of 450 nm, 532 nm, and 600 nm.

[0149] MDA concentration C (umol / L) = 6.45 (A 532 -A 600 )-0.56A 450

[0150] MDA content (umol / g Fw) = C × V / W

[0151] V: Extraction volume, 1.6 mL W: Sample fresh weight, 0.2 g

[0152] like Figure 17 As shown, compared with Col-0 and atpBpro:atpB, atpb has fewer dark blue and dark brown areas, indicating that it accumulates fewer dead cells and ROS and has a stronger reactive oxygen species scavenging ability. atpB-OE contains more dark blue and dark brown areas and has a lower antioxidant capacity, indicating that the atpb mutant reduces the degree of oxidative damage in Arabidopsis and improves the plant's tolerance to salt.

[0153] The chlorophyll a, chlorophyll b and total chlorophyll contents of Col-0, atpB-OE, atpb and atpBpro:atpB plants were measured at 0 and 5 days after NaCl stress treatment.

[0154] like Figure 18 As shown in the results, statistical analysis revealed that compared with Col-0 and atpBpro:atpB, the chlorophyll a, chlorophyll b, and total chlorophyll contents of atpb and atpB-OE plants were higher than those of Col-0 and atpBpro:atpB, with atpb being even more significant, reaching up to 1.4 times that of Col-0. This suggests that the atpb mutant significantly improves the tolerance of Arabidopsis to NaCl treatment.

[0155] At the same time, the MDA of Col-0, atpB-OE, atpb and atpBpro:atpB plants were measured at 0d and 5d after NaCl stress treatment.

[0156] like Figure 19 As shown, compared with Col-0 and atpBpro:atpB, the MDA content of atpB-OE was slightly lower than that of Col-0 and atpBpro:atpB, and the MDA content of atpB was significantly lower than that of Col-0, which was 1.8 times lower than that of Col-0.

[0157] The above results indicate that both overexpression and mutants of atpB can enhance the salt tolerance of Arabidopsis thaliana, but the atpB mutant has a stronger ability to resist salt stress.

[0158] The reasons why both atpb mutants and atpB-OE can resist adverse stress:

[0159] atpB-OE is resistant to salt and drought because the atpB gene positively regulates the plant's resistance to adverse stress. The higher the atpB expression level, the stronger the plant's resistance.

[0160] The atpb mutant's resistance to salt and drought is due to the tight coupling between the synthesis of several ATP synthase subunits. Earlier, transcriptional analysis following PstDC000 spraying revealed increased expression of atpB in the atpa mutant and increased expression of atpA in the atpb mutant. Secondly, yeast, LCI, and BiFC assays demonstrated that atpA and atpB proteins interact both in vivo and in vitro. Thirdly, the atpa atpb double mutant lacked the ability to resist adverse stress. Therefore, it was concluded that atpA and atpB have a complementary relationship; if either atpA or atpB is lost, the other gene produces a compensatory effect, thereby enhancing the plant's resistance to drought and salt. Therefore, the mutant also possesses the ability to resist drought and salt stress.

Claims

1. Application of the Arabidopsis thaliana atpB gene in improving plant drought tolerance, characterized in that: The plant is Arabidopsis thaliana.

2. The use of the Arabidopsis thaliana atpB gene in improving plant drought tolerance according to claim 1, wherein The nucleotide sequence of the Arabidopsis thaliana atpB gene is shown in SEQ ID No:

1.

3. The use of the Arabidopsis thaliana atpB gene in improving plant drought tolerance according to claim 2, wherein: The application comprises constructing a plant overexpression vector containing the Arabidopsis thaliana atpB gene, transforming the constructed plant overexpression vector into plants, and cultivating drought-resistant transgenic plants.