Screening report vector for enriching single-base editing cells as well as enriching and screening method and application of screening report vector

Abstract

The invention provides a screening report vector for enriching single base editing cells, which comprises a general sgRNA expression cassette containing guide RNA, an mCherry expression cassette and a GFP gene expression cassette with optimized initiation codons and peripheral sequences of the initiation codons in a transcription area, and target sequences identified by the guide RNA are optimized initiation codons and peripheral sequences of GFP genes. The initiation codon and the surrounding sequence of the optimized GFP gene destroy the original coding frame of GFP, and the correct GFP protein cannot be expressed; after GFP gene expression is successfully edited by a single base editor, an initiation codon is recovered and a correct reading frame of GFP is recovered, so that GFP protein with normal functions is expressed. By co-transfecting the screening report vector and sorting the transfected cell mixing pool by a flow cytometry, the enrichment of the cells subjected to single-base editing on the genome can be realized, so that the screening efficiency of the single-base editing cells is improved, and the screening method can be widely applied to various cells of mammals.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a screening reporter vector for enriching single-base edited cells and an enrichment screening method and application thereof. Background Art

[0002] The discovery of the CRISPR system and its widespread application in the field of gene editing have fundamentally changed life sciences. One of the most promising applications of the CRISPR system is the treatment of genetic diseases through in vivo genome editing. Two-thirds of human genetic diseases are caused by single-base mutations, so the development of a new gene editing tool that can efficiently and accurately correct pathogenic mutant bases will benefit all mankind. Although CRISPR / Cas9-mediated HDR repair can correct point mutations, the efficiency of HDR is extremely low. Although researchers have made many efforts to improve the efficiency of HDR, the efficiency of using HDR to correct point mutations is still low (usually about 0.1%-5%). In addition, since HDR-mediated precise editing first requires the introduction of DSBs near the point mutation site, NHEJ and HDR compete to repair DSBs, often resulting in more Indels than precise point editing. More noteworthy is that for some non-dividing cells, the HDR strategy of correcting point mutations does not work. The limitations of HDR-mediated precise point editing have led to the birth of a new gene editing tool, the base editor (BE). This tool does not need to introduce DSBs near the target site when editing a single base, so it effectively avoids the generation of Indels editing byproducts, and bypasses the dependence of HDR-mediated point editing on the cell cycle, greatly enhancing the base editing ability of non-dividing cells. The composition of the base editor includes a CRISPR-Cas nuclease with impaired catalytic function and a single-stranded DNA deaminase. Depending on the deaminase, BE is divided into two types: cytosine base editors (CBEs) and adenine base editors (ABEs). As an emerging genome editing method, base editors aim to accurately and efficiently correct base mutations, bringing hope to the precision treatment of human genetic diseases caused by pathogenic base mutations.

[0003] At present, base editing technology has been applied to basic scientific research, precision medicine, gene function research, and animal and plant genetic breeding. Although the editing efficiency of base editors is much higher than that of HDR-mediated precise point editing, it is still affected by many factors such as cell type, cell state, and gene sequence, and varies greatly. For some difficult-to-edit gene sites and difficult-to-transfect cell types, it is still a time-consuming and labor-intensive task to identify base editing-positive cells from millions of cell populations. In order to enrich base-edited cells, a vector with a screening marker gene (resistance gene or fluorescent gene) is usually co-transfected, and the purpose of enriching transfected positive cells is achieved through drug screening or flow sorting. However, this method of enriching transfected positive cells is not ideal and cannot truly reflect whether base editing events have occurred in cells. Therefore, it is urgent to develop a reporter system specifically for enriching base editing activity in order to more effectively screen and enrich base editing-positive cells. Summary of the invention

[0004] In order to overcome at least one problem existing in the prior art, the present invention uses GFP as a screening marker to construct a screening reporter vector for enriching single-base edited cells, which reflects the occurrence of base editing events by the expression of GFP.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention is to provide a screening reporter vector (abbreviated as ACBE-FSR) for enriching single-base edited cells, which includes a universal sgRNA expression cassette, an mCherry expression cassette and a GFP gene expression cassette; wherein the start codon and surrounding sequences of the transcription region of the GFP gene expression cassette are optimized so as not to express the correct GFP protein; and the transcription region of the universal sgRNA expression cassette includes a guide RNA, and the target sequence recognized by the guide RNA is the optimized start codon of the GFP gene and its surrounding sequences so that the GFP gene expression is successfully edited by the single-base editor to restore the expression of GFP. Specifically, the start codon of the optimized GFP gene and its surrounding sequences destroy the original coding frame of GFP and cannot express the correct GFP protein; when the GFP gene expression is successfully edited by the single-base editor, the start codon is restored and GFP is restored to the correct reading frame, thereby expressing a functional GFP protein.

[0007] It is understandable that the optimization of the start codon of any suitable GFP gene and its surrounding sequence that can achieve the above purpose is feasible. Preferably, after the start codon of the GFP gene in the screening reporter vector (ACBE-FSR) and its surrounding sequence (about 23bp) are optimized, the original coding frame of GFP is destroyed and the correct GFP protein cannot be expressed; when ACBE-FSR and the single base editor (ABE / CBE) are co-transfected into the cell, if its GFP gene expression is successfully edited by ABE / CBE, the start codon ATG is restored and GFP is restored to the correct reading frame, thereby expressing a functional GFP protein; under the action of ABE / CBE and sgRNA expression vector co-transfected with ACBE-FSR, cells that simultaneously undergo base editing of the target site on the genome can be enriched by flow cytometry sorting. The above-mentioned sorting of co-transfected cells by flow cytometry can accelerate the enrichment of cells with base editing of the genome.

[0008] Furthermore, the GFP gene expression cassette is pre-mutated and inactivated, and is optimized to contain a PAM sequence, and to locate the target site to be edited within the activity window of CBE and ABE.

[0009] Furthermore, the universal sgRNA expression cassette shown is composed of a U6 promoter, a universal sgRNA sequence, and a gRNA scaffold sequence from 5' to 3'.

[0010] Furthermore, the mCherry expression cassette is CMV enhancer, CMV promoter, mCherry gene, and BGH polyA sequence in order from 5' to 3'.

[0011] Furthermore, the GFP gene expression cassette is composed of CAG-enhancer, CMV promoter, inactivated GFP gene, and SV40 polyA in order from 5' to 3'.

[0012] Furthermore, the optimized start codon of the GFP gene and its surrounding sequence are (ATAACG)GFP, and its sequence is shown in SEQ ID No.1; the sequence of the guide RNA is shown in SEQ ID No.2.

[0013] Furthermore, the sequence of the universal sgRNA expression cassette is shown in SEQ ID No.3.

[0014] Furthermore, the sequence of the mCherry expression cassette is shown as SEQ ID No.4.

[0015] Furthermore, the sequence of the GFP gene expression cassette is shown in SEQ ID No.5.

[0016] Furthermore, the single-base editor is a cytosine base editor (CBE) or an adenine base editor (ABE).

[0017] Furthermore, the cells are selected from mammalian cells.

[0018] Furthermore, the mCherry is used to evaluate or characterize cell transfection efficiency.

[0019] The design of the above-mentioned screening reporter vector for enriching single-base edited cells has the following excellent functions: First, since the start codon ATG and the surrounding bases of the GFP gene are pre-mutated and optimized, the target site to be edited is just located in the editing activity window of CBE and ABE. Both CBE and ABE can edit the target site to restore the start codon ATG, so the vector can be used for enrichment of CBE and ABE editing-positive cells at the same time; second, the vector itself expresses a guide RNA to guide CBE or ABE to the target site at the front end of the inactivated GFP expression box, and restore the start codon ATG through base editing, so that GFP can be expressed; third, the target site is a universal target site, and it is no longer necessary to modify it when using the reporter vector. The reporter vector can be directly used to achieve the purpose of reporting base editing activity in different cell lines or when editing different gene sites.

[0020] The second aspect of the present invention is to provide a system containing any screening reporter vector for enriching single-base edited cells as described in the first aspect of the present invention, wherein the system also includes a genome-targeting sgRNA expression vector and a single-base editor.

[0021] Furthermore, the above sgRNA expression vector has a suitable multiple cloning site for inserting multiple sgRNAs targeting the genome. During use, it is only necessary to construct the designed target corresponding sgRNA sequence into the sgRNA expression vector.

[0022] Furthermore, the transfection amount of each component in the above system is: 5 μg of single base editor, 5 μg of sgRNA expression vector targeting the genome, and 5 μg of screening reporter vector (ACBE-FSR) per 100 mm cell culture dish.

[0023] The third aspect of the present invention is to provide a method for constructing a screening reporter vector for enriching single-base edited cells as described in any one of the first aspects of the present invention, comprising the following steps:

[0024] S1), using the GFP gene sequence in the template plasmid as a template, using PCR amplification to obtain the transcription region of the optimized GFP gene expression cassette, wherein the transcription region of the optimized GFP gene expression cassette contains the start codon of the optimized GFP gene and its surrounding sequence; replacing the GFP gene expression cassette in the template plasmid with the transcription region of the optimized GFP gene expression cassette to obtain an optimized GFP expression vector;

[0025] S2), using the mCherry gene sequence as a template, amplifying by PCR to obtain the transcription region of the mCherry gene expression cassette; connecting the transcription region of the mCherry gene expression cassette to the optimized GFP expression vector to obtain the mCherry-optimized GFP expression vector;

[0026] S3), constructing a cloning plasmid containing a universal sgRNA expression cassette, wherein the transcription region of the universal sgRNA expression cassette includes a guide RNA, and the target sequence recognized by the guide RNA is the start codon of the optimized GFP gene and its surrounding sequence; using the cloning plasmid containing the universal sgRNA expression cassette as a template, amplifying the universal sgRNA expression cassette;

[0027] S4), connecting the universal sgRNA expression cassette obtained in step S3) to the mCherry-optimized GFP expression vector constructed in step S2) to obtain the screening reporter vector.

[0028] Furthermore, in step S1), the template plasmid is pB-CMV-DsRed-CMV-GFP, and the constructed expression vector with optimized GFP gene expression cassette is pB-CMV-DsRed-CMV-(ATAACG)GFP.

[0029] Furthermore, in the step S2), the step of constructing the mCherry-optimized GFP expression vector comprises:

[0030] S21), removing the DsRed gene expression cassette in pB-CMV-DsRed-CMV-(ATAACG)GFP and introducing the multiple cloning site MCS to obtain the expression vector pB-MCS-CMV-(ATAACG)GFP;

[0031] S22), using the mCherry coding region sequence contained in the YE1-BPNLS-BE3-mCherry plasmid as a template, amplifying by PCR to obtain the transcription region of the mCherry gene expression cassette; connecting the transcription region of the mCherry gene expression cassette to pB-MCS-CMV-(ATAACG)GFP to obtain the pB-CMV-mCherry-CMV-(ATAACG)GFP expression vector.

[0032] Furthermore, in step S3), the step of constructing a cloning plasmid containing a universal sgRNA expression cassette includes: connecting the guide RNA to the backbone vector pX330-U6-Chimeric_dBbsI-CBh-hSpCas9 containing the Cas9 expression cassette to obtain a cloning plasmid containing a universal sgRNA expression cassette.

[0033] Furthermore, in the step S4), the universal sgRNA expression cassette is connected to the pB-CMV-mCherry-CMV-(ATAACG)GFP expression vector to obtain the screening reporter vector pB-CMV-mCherry-CMV-(ATAACG)GFP-sgT, which is named ACBE-FSR.

[0034] Further, in a specific embodiment, the method for constructing a screening reporter vector for enriching single-base edited cells specifically comprises the steps of:

[0035] (1) Construction of pB-CMV-DsRed-CMV-(ATAACG)GFP vector: Using pB-CMV-DsRed-CMV-GFP vector as a template, the first primer pair was used to amplify fragment 1; the purified fragment 1 was digested with pB-CMV-DsRed-CMV-GFP and then ligated to transform competent cells, a single clone was picked and the plasmid was extracted, and after sequencing and identification, it was named pB-CMV-DsRed-CMV-(ACG)GFP; using pB-CMV-DsRed-CMV-(ACG)GFP as a template, the second primer pair was used to amplify fragment 2; the purified and recovered fragment 2 was digested with the pB-CMV-DsRed-CMV-GFP backbone vector recovered in the previous step and then transformed into competent cells, the plasmid was extracted and sequenced, and the identified correct vector was named pB-CMV-DsRed-CMV-(ATAACG)GFP;

[0036] (2) Construction of pB-MCS-CMV-(ATAACG)GFP vector: annealing and fitting the primer pairs; digesting the pB-CMV-DsRed-CMV-(ATAACG)GFP vector and recovering the large fragment as the backbone fragment; connecting the fitting product with the recovered backbone fragment and transforming JM109 competent cells; the plasmid extracted from the single clone was first identified by enzyme digestion, and the identified correct vector was named pB-MCS-CMV-(ATAACG)GFP; the purpose of constructing the above vector was to remove the DsRed expression cassette and introduce a multiple cloning site (MCS) for the subsequent insertion of the mCherry expression cassette;

[0037] (3) Construction of pB-CMV-mCherry-CMV-(ATAACG)GFP vector: the mCherry expression cassette was cut out from YE1-BPNLS-BE3-mCherry; the vector pB-MCS-CMV-(ATAACG)GFP obtained in step (2) was digested and recovered as a backbone fragment; the mCherry expression cassette was connected to the backbone fragment and transformed into JM109; the plasmid extracted from the bacterial monoclonal was digested and identified, and the identified correct vector was named pB-CMV-mCherry-CMV-(ATAACG)GFP;

[0038] (4) Construction of pX330-(ATAACG)GFP sgRNA-cas9: The product of primer pair annealing fitting was connected to the backbone of pX330-U6-Chimeric_BB-CBh-hSpCas9 after enzyme digestion, and was named pX330-(ATAACG)GFP sgRNA-cas9 after sequencing and identification;

[0039] (5) Construction of pB-CMV-mCherry-CMV-(ATAACG)GFP-sgT vector: Using the vector pX330-(ATAACG)GFP sgRNA-cas9 obtained in step (4) as a template, the sgRNA expression cassette was amplified with primers; the vector pB-CMV-mCherry-CMV-(ATAACG)GFP was linearized and purified; the sgRNA expression cassette was inserted into the linearized backbone fragment by homologous recombination; the vector was identified by enzyme digestion, and the identified correct vector was named pB-CMV-mCherry-CMV-(ATAACG)GFP-sgT, abbreviated as ACBE-FSR,

[0040] Furthermore, the sequence of the pB-CMV-DsRed-CMV-GFP is shown as SEQ ID No.10.

[0041] Furthermore, the sequence of the YE1-BPNLS-BE3-mCherry is shown as SEQ ID No.11.

[0042] The fourth aspect of the present invention is to provide a method for enriching and screening single-base editing positive cells, which comprises the following steps:

[0043] A) constructing an sgRNA expression vector targeting the base editing site in the cell genome;

[0044] B) co-transfecting cells with the sgRNA expression vector constructed in step A), the single base editor, and the screening reporter vector for enriching single base edited cells according to any one of claims 1 to 4;

[0045] C) The cells transfected in step B) are sorted by flow cytometry to select GFP(+)mCherry(+) double positive cells. (Specifically, 48 to 72 hours after transfection, the cells are digested with trypsin and collected into a mixed pool; the mixed pool of cells is sorted by flow cytometry to enrich and obtain GFP(+)mCherry(+) double positive cells).

[0046] Furthermore, the above-mentioned enrichment and screening method also includes step D): diluting the double positive cells sorted in step C) and culturing the cell monoclones, obtaining the positive cell clones edited by the single base editor by typing identification; expanding the positive cell clones. (Specifically, the cells obtained by enrichment and screening are diluted and added to normal cell complete culture medium for cell monoclonal culture (for example, spread on a 96-well culture plate); extracting the genome from the monoclonal cells, PCR amplifying the gene fragment containing the target and combining it with Sanger sequencing for identification, and expanding the positive edited cell monoclonal clones (for example, transferring to a 24-well plate)).

[0047] Further, in a specific embodiment, the sgRNA expression vector uses EMX1 as the target site, and uses four types of CBE-YE1-BE3, BE4max, BE3 and hA3A-BE3 to perform point mutations (C mutates to T) on the target site of the EMX1 site, and uses the ACBE-FSR system to enrich base editing positive cells. Furthermore, the sequence of the EMX1 target site is as shown in SEQ ID No. 6, specifically GAGTCCGAGCAGAAGAAGAAGGG.

[0048] Further, in a specific embodiment, the sgRNA expression vector uses ABE7.10 to perform point mutations (A mutates to G) on three target sequences using three human gene sites (Site1, Site2, Site3) as target sites, and uses the ACBE-FSR system to enrich base editing positive cells. Further, the sequence of the target site Site1 is shown in SEQ ID No.7, specifically GGCCCAGACTGAGCACGTGATGG; the sequence of the target site Site2 is shown in SEQ ID No.8, specifically GAACACAAAGCATAGACTGCGGG; the sequence of the target site Site3 is shown in SEQ ID No.9, specifically GATGAGATAATGATGAGTCAGGG.

[0049] The fifth aspect of the present invention is to provide a screening reporter vector as described in any one of the first aspects of the present invention, a system as described in any one of the second aspects of the present invention, or a construction method as described in any one of the third aspects of the present invention for use in enriching ABE- and CBE-mediated single-base editing cells.

[0050] The above screening reporter vector sequence and the vector sequence used in its construction, as well as the target site sequence in the validation test are shown in the following table:

[0051] Table 1 – Sequence information table

[0052]

[0053]

[0054]

[0055]

[0056]

[0057] Compared with the prior art, the present invention adopts the above technical solution to have the following beneficial effects:

[0058] The enrichment screening reporter vector (ACBE-FSR) proposed in the present invention can be successfully edited by ABE or CBE to restore the expression of GFP. By co-transfecting the vector and performing flow cytometric sorting on the transfected cell pool, the enrichment of cells with single-base editing of the genome can be achieved (the essence of which is to improve the single-base editing efficiency of the cell pool), which significantly improves the screening efficiency of single-base edited cells.

[0059] The enrichment screening reporter vector (ACBE-FSR) described in the present invention is combined with an sgRNA expression vector for targeting the cell genome and a single base editor (ABE or CBE) to form a co-transfection system, which can be used to efficiently enrich base editing-positive cell clones and can be widely used in a variety of mammalian cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0061] Figure 1 Schematic diagram of the operation of the enrichment screening reporter vector (ACBE-FSR) in one embodiment of the present invention.

[0062] Figure 2 Schematic diagram of the ACBE-FSR vector in one embodiment of the present invention.

[0063] Figure 3 This is an agarose gel electrophoresis diagram of the enzyme digestion identification of the ACBE-FSR vector in one embodiment of the present invention.

[0064] Figure 4 This is a diagram showing the sequencing results of the ACBE-FSR vector in one embodiment of the present invention.

[0065] Figure 5 Schematic diagram of the operational process of enriching base-edited cells using the ACBE-FSR-based co-transfection system in one embodiment of the present invention.

[0066] Figure 6 FIG. 1 is a map of the pX330-U6 vector in one embodiment of the present invention.

[0067] Figure 7 This is an agarose gel electrophoresis diagram of the enzyme digestion of the pX330-U6 vector in one embodiment of the present invention.

[0068] Figure 8 This is an agarose gel electrophoresis diagram of the restriction enzyme digestion of the pX330-U6-EMX1 sgRNA vector in one embodiment of the present invention.

[0069] Fig. 9 This is a diagram showing the sequencing results of the pX330-U6-EMX1 sgRNA vector in one embodiment of the present invention.

[0070] Fig.10 This is a schematic diagram showing the statistical results of the editing efficiency of the EMX1 site after four types of CBE in one embodiment of the present invention.

[0071] Fig.11 This is an agarose gel electrophoresis diagram of the restriction enzyme digestion of three vectors pX330-U6-Site1 sgRNA, pX330-U6-Site2 sgRNA, and pX330-U6-Site3 sgRNA in one embodiment of the present invention.

[0072] Fig.12 This is a diagram showing the Sanger sequencing results of the three vectors pX330-U6-Site1 sgRNA, pX330-U6-Site2 sgRNA, and pX330-U6-Site3 sgRNA in one embodiment of the present invention.

[0073] Fig.13 This is a schematic diagram of the results of statistical analysis of the editing efficiency of the three sites Site 1, Site 2, and Site 3 by ABE7.10 in one embodiment of the present invention. DETAILED DESCRIPTION

[0074] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the scope of protection of the present invention. The experimental methods without specific conditions in the following embodiments are usually measured according to national standards. The experimental materials without the source indicated in the following embodiments are all commercially available raw materials. The equipment used in each step in the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standards, conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, all parts are weight parts and all percentages are mass percentages. Unless otherwise defined or specified, all professional and scientific terms used in the present invention have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar or equal to the recorded content can be applied to the method of the present invention.

[0075] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. The present invention is further described below in conjunction with the drawings and specific embodiments, but is not intended to be a limitation of the present invention.

[0076] The present invention proposes a screening reporter vector ACBE-FSR (ABE and CBE mediated Fluorescent Screening Reporter) for enriching ABE and CBE-mediated base editing cells. ACBE-FSR mainly consists of three parts: an mCherry expression cassette, a universal sgRNA expression cassette, and a GFP expression cassette with optimized start codon ATG and surrounding bases (i.e., (ATAACG)GFP). After ACBE-FSR is co-transfected with CBE or ABE into cells, mCherry and universal sgRNA can be expressed; then, ABE or CBE edits ATA or ACG in the (ATAACG)GFP expression cassette under the guidance of universal sgRNA, so that GFP restores the correct coding frame, thereby achieving the expression of the GFP gene under the promoter of CMV, see Figure 1 .

[0077] Example 1 - Construction of enrichment screening reporter vector ACBE-FSR

[0078] This embodiment relates to a preferred method for constructing an enrichment screening reporter vector ACBE-FSR, which comprises the steps of:

[0079] (1)pB-CMV-DsRed-CMV-(ATAACG)GFP

[0080] Using pB-CMV-DsRed-CMV-GFP (preserved in this laboratory, the sequence is shown in SEQ ID No.10) vector as a template, primers ATG-F without shift and GFP-R XhoI were used to amplify fragment 1; the purified fragment 1 and pB-CMV-DsRed-CMV-GFP were digested with AgeI and XhoI and then connected to transform competent cells, a single clone was picked and the plasmid was extracted, and after sequencing and identification, it was named pB-CMV-DsRed-CMV-(ACG)GFP. Using pB-CMV-DsRed-CMV-(ACG)GFP as a template, primers ATAACG-F without shift and GFP-R XhoI were used to amplify the fragment 2; the purified and recovered fragment 2 was digested with AgeI and XhoI and then connected with the pB-CMV-DsRed-CMV-GFP backbone vector recovered in the previous step and transformed into competent cells, the plasmid was extracted and sequenced, and the identified correct vector was named pB-CMV-DsRed-CMV-(ATAACG)GFP. The above PCR reaction system, restriction digestion reaction system, and ligation reaction system are shown in Table 1, Table 2, and Table 3, respectively.

[0081] Table 1. PCR reaction system for amplification of fragment 1 (50 μL)

[0082]

[0083]

[0084] Table 2. Enzyme digestion reaction system (50 μL)

[0085]

[0086] Table 3. Ligation reaction system (10 μL)

[0087]

[0088] (2) pB-MCS-CMV-(ATAACG)GFP

[0089] The purpose of constructing this vector is to remove the DsRed expression cassette and introduce a multiple cloning site (MCS) for the insertion of the mCherry expression cassette. Take 5uL of each of the primers EcoRI-SpeI anneling-F and EcoRI-SpeI anneling-R for annealing and fitting. The annealing and fitting procedures and systems are shown in Table 4; the pB-CMV-DsRed-CMV-(ATAACG)GFP vector is digested with EcoRV and HindIII to recover the large fragment as the backbone fragment; take 1uL of the fitting product and connect it with the recovered backbone fragment to transform JM109 competent cells. The plasmid extracted from the monoclonal clone is first identified by enzyme digestion, and the identified correct vector is named pB-MCS-CMV-(ATAACG)GFP.

[0090] Table 4. Annealing fitting system and procedure

[0091]

[0092] (3)pB-CMV-mCherry-CMV-(ATAACG)GFP

[0093] The mCherry expression cassette was cut out from YE1-BPNLS-BE3-mCherry (gifted by Yang Hui's laboratory, detailed sequence information is shown in SEQ ID No. 11) using MfeI and SpeI; the vector pB-MCS-CMV-(ATAACG)GFP obtained in the previous step was digested with EcoRI and SpeI and recovered as a backbone fragment; the mCherry expression cassette was connected to the backbone fragment and transformed into JM109; the plasmid extracted from the bacterial monoclonal clone was digested and identified with EcoRV and HindIII, and the identified correct vector was named pB-CMV-mCherry-CMV-(ATAACG)GFP.

[0094] (4)pX330-(ATAACG)GFP sgRNA-cas9

[0095] The annealing and fitting products of (ATAACG)sgRNA-F and (ATAACG)sgRNA-R were connected to the backbone of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene#42230) after BsaI digestion. After sequencing and identification, it was named pX330-(ATAACG)GFP sgRNA-cas9. The backbone digestion system of the targeting vector is shown in Table 5.

[0096] Table 5. Targeting vector backbone enzyme digestion system

[0097]

[0098] (5)pB-CMV-mCherry-CMV-(ATAACG)GFP-sgT

[0099] The vector pX330-(ATAACG)GFP sgRNA-cas9 obtained in the previous step was used as a template to amplify the sgRNA expression cassette with primers CZ-U6-F and CZ-U6-R; the vector pB-CMV-mCherry-CMV-(ATAACG)GFP was linearized with XhoI and then purified by running agarose gel; the sgRNA expression cassette was then inserted into the linearized backbone fragment by homologous recombination; the vector was identified by EcoRI and BamHI restriction enzymes, and the vector was submitted to a sequencing company for sequencing verification. The identified correct vector was named pB-CMV-mCherry-CMV-(ATAACG)GFP-sgT. For ease of description, we referred to this vector as ACBE-FSR, and the plasmid map can be found in Figure 2 The ACBE-FSR vector was identified by digestion with BamHI and EcoRI. The vector containing the sgT expression cassette can be cut out into two bands with a size of 7654bp+435bp (see Figure 3 ). Sanger sequencing results can be found at Figure 4 .

[0100] The primer sequences used in the above construction process are shown in the following table:

[0101]

[0102]

[0103] The working principle and process of the ACBE-FSR prepared above as an enrichment reporter vector are as follows:

[0104] Working principle: ACBE-FSR itself can be successfully edited by ABE or CBE to express functional GFP protein, and the purpose of enriching base-edited cells can be achieved by flow cytometry sorting.

[0105] Specific enrichment test process:

[0106] 1) Design sgRNA expression vectors for target editing sites in the cell genome;

[0107] 2) The constructed sgRNA expression vector, ABE / CBE and ACBE-FSR were co-transfected into cells. The transfection system and dosage were as follows: 100 mm cell culture dish transfection experimental components and dosage - ABE / CBE 5 μg, sgRNA 5 μg, ACBE-FSR 5 μg.

[0108] 3) 48 hours after transfection, cells were collected by trypsin digestion and sorted by flow cytometry to obtain GFP(+)mCherry(+) double positive cells;

[0109] 4) The genome of the cells harvested by flow cytometry enrichment is extracted, and the target fragment containing the target is obtained by PCR amplification, which is then sent to a sequencing company for Sanger sequencing to identify the editing efficiency of the ACBE-FSR enriched screening cells.

[0110] See also Figure 5 In the above steps 2)-4), DMEM medium containing 10% fetal bovine serum and 100 μg / mL penicillin / streptomycin was used as the cell culture medium, and culture was carried out in a cell culture incubator at 37° C. and a CO 2 concentration of 5%.

[0111] Example 2 - Application of ACBE-FSR as a reporter vector to enrich ABE-mediated base editing at different sites

[0112] In this example, the human EMX1 site is taken as an example, and four types of CBEs, namely, YE1-BE3, BE4max, BE3 and hA3A-BE3, are used to perform point mutations (C is mutated to T) on the target site of the EMX1 site, and the ACBE-FSR constructed in Example 1 is used to enrich base editing positive cells, which includes the steps of:

[0113] 1. Construct pX330-U6. First, the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector was digested with XbaI and EcoRI (the digestion system is shown in Table 6), and the fragment without the Cas9 expression cassette was recovered as the backbone fragment; two annealing primers XbaI-HS-EcoRI-F and XbaI-HS-EcoRI-R were designed, 5 μL of each was mixed evenly in a PCR tube, and placed in a PCR instrument for fitting according to the program to obtain a double-stranded product with XbaI and EcoRI sticky ends at both ends (see Table 7 for the fitting system and program); the fitting product and the backbone fragment were connected with T4 ligase (see Table 8 for the ligation reaction system), and the competent cells were transformed; a single clone was picked and the plasmid was extracted for enzyme digestion identification, and the identified correct vector was named pX330-U6, and the plasmid map was referred to Figure 6 pX330-U6 was digested with EcoRI for single restriction enzyme identification. The positive clone vector showed a band of 3449 bp after EcoRI digestion, while the original backbone vector pX330-U6-Chimeric_BB-CBh-hSpCas9 was cut into a single band of 8534 bp. For the enzyme digestion identification diagram, see Figure 7 The primer sequences used are as follows:

[0114]

[0115]

[0116] Table 6. pX330-U6-Chimeric_BB-CBh-hSpCas9 backbone vector restriction enzyme digestion system

[0117]

[0118] Table 7. Insertion target fragment fitting system and procedure

[0119]

[0120] Table 8. Ligation reaction system

[0121]

[0122] 2. Construction of sgRNA expression vector pX330-U6-ESM1 sgRNA targeting human ESM1 locus

[0123] (1) Select the EMX1 target site (GAGTCCGAGCAGAAGAAGAAGGG) and design primers to match the target site. The primer sequences are as follows:

[0124]

[0125] (2) Primers sgRNA-EMX1-F and sgRNA-EMX1-R were diluted to 10 pmol, 5 μL of each was pipetted, mixed, and placed in a PCR instrument for denaturation at 95°C for 10 min. The primers were naturally cooled to room temperature for annealing to obtain double-stranded DNA with BbsI sticky ends.

[0126] (3) The pX330-U6 backbone vector was digested with BsaI (see Table 9 for the digestion reaction system of the pX330-U6 backbone vector), recovered by gel, and the obtained backbone fragment was ligated with the fitting product of the previous step using ligase, and then transformed into competent cells.

[0127] Table 9. pX330-U6 backbone vector restriction enzyme digestion reaction system

[0128]

[0129]

[0130] (4) The selected single clones were first digested with EcoRV and NotI for identification. After digestion of the positive vector, only a 3449 bp band was found (the digestion identification system is shown in Table 10, and the digestion identification diagram is shown in Figure 8 ), the correct vector was initially identified and sent to a sequencing company for verification. The vectors finally obtained were named pX330-U6-EMX1 sgRNA, and the sequencing maps are shown in Fig. 9 .

[0131] Table 10. Double enzyme digestion identification system (10 μL)

[0132]

[0133] 3. Co-transfect HEK293T cells with pX330-U6-EMS1 sgRNA and ACBE-FSR vectors and four types of CBE (YE1-BE3, BE4max, BE3, hA3A-BE3), respectively. Transfection experimental components and dosages per 100mm cell culture dish: YE1-BE3 / BE4max / BE3 / hA3A-BE3 5μg, pX330-U6-EMS1 5μg, ACBE-FSR 5μg. Three replicates were set for each group.

[0134] 4. Collect cells 72 hours after transfection, wash once with PBS to remove residual cell culture medium, and add an equal volume of complete culture medium to terminate digestion after trypsin digestion for 3 minutes. Collect cells by centrifugation at 1000rpm / min for 5 minutes, and resuspend cells in 600μL PBS. Filter cells with 200-mesh gauze before flow cytometry, and then collect mCherry(+)GFP(-) cells (RoT group) and mCherry(+)GFP(+) cells (ACBE-FSR group) by flow cytometry.

[0135] 5. The RoT group cells and ACBE-FSR group cells were collected by flow cytometry sorting, and genomic DNA was extracted respectively. The target fragment containing the target site was amplified from the genome using the detection primers EMX1 detect-F and EMX1 detect-R of the EMX1 locus. The PCR product was purified by agarose gel and sent to a sequencing company for Sanger sequencing.

[0136]

[0137] 6. The sequencing results were analyzed by online analysis software to calculate the editing efficiency of the ESM1 target site. The base editing results of the RoT group cells and the ACBE-FSR group cells were statistically analyzed. The results showed that at the ESM1 site, regardless of the type of CBE-mediated CT base editing, the base editing efficiency of the ACBE-FSR group cells (mCherry+ / GFP+) was significantly higher than that of the RoT group cells (mCherry+ / GFP-), see Fig.10 .

[0138] Example 3 - Application of ACBE-FSR as a reporter vector to enrich CBE-mediated base editing at different sites

[0139] This example takes three human gene sites (Site 1, Site 2, Site 3) as an example, uses ABE7.10 to perform point mutations on the three target sequences (A mutates to G), and uses the ACBE-FSR prepared in Example 1 to enrich base editing positive cells, which includes the steps of:

[0140] 1. Construct pX330-U6, the steps are the same as those in Example 2.

[0141] 2. Construction of sgRNA expression vectors for three human sequence sites: pX330-U6-Site1 sgRNA, pX330-U6-Site2sgRNA, and pX330-U6-Site3 sgRNA

[0142] (1) First, select three target sites Site1 (GGCCCAGACTGAGCACGTGATGG), Site2 (GAACACAAAGCATAGACTGCGGG), and Site3 (GATGAGATAATGATGAGTCAGGG), and design primers for the target sites. The primer sequences are as follows:

[0143]

[0144] (2) Primers sgRNA-Site1-F and sgRNA-Site1-R, sgRNA-Site2-F and sgRNA-Site2-R, sgRNA-Site3-F and sgRNA-Site3-R were diluted to 10 pmol, 5 μL of each was pipetted, mixed, and placed in a PCR instrument for denaturation at 95°C for 10 min. The primers were naturally cooled to room temperature for annealing and fitting to obtain double-stranded products with BbsI sticky ends.

[0145] (3) The pX330-U6 backbone vector was digested with BbsI, recovered from the gel, and the obtained backbone fragment was ligated with the fitting product from the previous step using ligase, and then transformed into competent cells.

[0146] (4) The selected single clone was first digested with EcoRV and NotⅠ for digestion identification. After digestion of the positive vector, only a 3449 bp band was found (see the digestion identification diagram). Fig.11 ), the vectors identified by preliminary enzyme digestion were sent to a sequencing company for verification, and the vectors finally obtained were named pX330-U6-Site1 sgRNA, pX330-U6-Site2sgRNA, and pX330-U6-Site3 sgRNA, respectively. The sequencing maps can be found in Fig.12 .

[0147] 3. Co-transfect HEK293T cells with ABE7.10 and ACBE-FSR vectors and sgRNA expression vectors of three human sequence sites (pX330-U6-Site1 sgRNA, pX330-U6-Site2 sgRNA, pX330-U6-Site3 sgRNA). Transfection experimental components and dosage per 100 mm cell culture dish: ABE7.10 5μg, pX330-U6-Site1sgRNA / pX330-U6-Site2 sgRNA / pX330-U6-Site3 sgRNA 5μg, ACBE-FSR 5μg. Three replicates were set for each group.

[0148] 4. Collect cells 72 hours after transfection, wash once with PBS to remove residual cell culture medium, and add an equal volume of complete culture medium to terminate digestion after trypsin digestion for 3 minutes. Collect cells by centrifugation at 1000rpm / min for 5 minutes, and resuspend cells in 600μL PBS. Filter cells with 200-mesh gauze before flow cytometry, and then collect mCherry(+)GFP(-) cells (RoT group) and mCherry(+)GFP(+) cells (ACBE-FSR group) by flow cytometry.

[0149] 5. The RoT group cells and ACBE-FSR group cells were collected by flow cytometry sorting, and genomic DNA was extracted respectively. The target fragments containing the target sites were amplified from the genome using the detection primers corresponding to the three sites. The PCR products were purified by agarose gel and sent to the sequencing company for Sanger sequencing. The identification primer sequences are as follows:

[0150]

[0151] 6. The sequencing results were analyzed by online analysis software, and the editing efficiency of the three target sites Site1, Site2, and Site3 by ABE7.10 was counted. The base editing results of RoT group cells and ACBE-FSR group cells were statistically analyzed. The results showed that at the three target sequence sites, the base editing efficiency of ABE7.10-mediated AG base editing in ACBE-FSR group cells (mCherry+ / GFP+) was significantly higher than that in RoT group cells (mCherry+ / GFP-). The average base editing efficiency was 1.5 times, 1.3 times, and 2.2 times that of the base editing efficiency of RoT enrichment strategy, respectively. See Fig.13 .

[0152] As can be seen from the above embodiments, the present invention constructs an enrichment screening reporter vector (ACBE-FSR), which can indicate whether a base editing event has successfully occurred in the cell by the expression of GFP, and enrich the editing-positive cells by flow cytometry, which greatly improves the efficiency of obtaining base editing-positive cells; and the above-mentioned enrichment screening reporter vector is universal and suitable for various types of ABE and CBE. The subsequent use process is also quite simple. It only needs to construct sgRNA expression vectors for different target sequences by annealing and connecting, and the ACBE-FSR, sgRNA expression vector and single base editor form a co-transfection system, which can be used for efficient enrichment of base editing-positive cell clones, and can be widely used in various mammalian cells.

[0153] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the present invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A screening reporter vector for enriching single-base edited cells, characterized in that: It includes a universal sgRNA expression cassette, an mCherry expression cassette and a GFP gene expression cassette; wherein the start codon and the surrounding sequence of the transcription region of the GFP gene expression cassette are optimized so as not to express the correct GFP protein; and the transcription region of the universal sgRNA expression cassette includes a guide RNA, and the target sequence recognized by the guide RNA is the optimized start codon and the surrounding sequence of the GFP gene so as to restore the expression of GFP after the GFP gene expression is successfully edited by the single-base editor.

2. The screening reporter vector according to claim 1, characterized in that The optimized start codon of the GFP gene and its surrounding sequence are (ATAACG)GFP, and its sequence is shown in SEQ ID No.1; the sequence of the guide RNA is shown in SEQ ID No.

2.

3. The screening reporter vector according to claim 1, characterized in that The sequence of the universal sgRNA expression cassette is shown as SEQ ID No.3; and / or, the sequence of the mCherry expression cassette is shown as SEQ ID No.4; and / or, the sequence of the GFP gene expression cassette is shown as SEQ ID No.

5.

4. The screening reporter vector according to claim 1, characterized in that The single base editor is a cytosine base editor or an adenine base editor; and / or, the cell is selected from mammalian cells.

5. A system comprising a screening reporter vector for enriching single-base edited cells according to any one of claims 1 to 4, characterized in that: The system also includes a genome-targeted sgRNA expression vector and a single base editor.

6. A method for constructing a screening reporter vector for enriching single-base edited cells according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1), using the GFP gene sequence in the template plasmid as a template, using PCR amplification to obtain the transcription region of the optimized GFP gene expression cassette, wherein the transcription region of the optimized GFP gene expression cassette contains the start codon of the optimized GFP gene and its surrounding sequence; replacing the GFP gene expression cassette in the template plasmid with the transcription region of the optimized GFP gene expression cassette to obtain an optimized GFP expression vector; S2), using the mCherry gene sequence as a template, amplifying by PCR to obtain the transcription region of the mCherry gene expression cassette; connecting the transcription region of the mCherry gene expression cassette to the optimized GFP expression vector to obtain the mCherry-optimized GFP expression vector; S3), constructing a cloning plasmid containing a universal sgRNA expression cassette, wherein the transcription region of the universal sgRNA expression cassette includes a guide RNA, and the target sequence recognized by the guide RNA is the start codon of the optimized GFP gene and its surrounding sequence; using the cloning plasmid containing the universal sgRNA expression cassette as a template, amplifying the universal sgRNA expression cassette; S4), connecting the universal sgRNA expression cassette obtained in step S3) to the mCherry-optimized GFP expression vector constructed in step S2) to obtain the screening reporter vector.

7. The construction method according to claim 6, characterized in that: In the step S1), the template plasmid is pB-CMV-DsRed-CMV-GFP, and the constructed expression vector with optimized GFP gene expression cassette is pB-CMV-DsRed-CMV-(ATAACG)GFP; And / or, in step S2), the step of constructing the mCherry-optimized GFP expression vector comprises: S21), removing the DsRed gene expression cassette in pB-CMV-DsRed-CMV-(ATAACG)GFP and introducing the multiple cloning site MCS to obtain the expression vector pB-MCS-CMV-(ATAACG)GFP; S22), using the mCherry coding region sequence contained in the YE1-BPNLS-BE3-mCherry plasmid as a template, amplifying by PCR to obtain the transcription region of the mCherry gene expression cassette; connecting the transcription region of the mCherry gene expression cassette to the pB-MCS-CMV-(ATAACG)GFP to obtain the pB-CMV-mCherry-CMV-(ATAACG)GFP expression vector; And / or, in step S3), the step of constructing a cloning plasmid containing a universal sgRNA expression cassette comprises: connecting the guide RNA to the backbone vector pX330-U6-Chimeric_dBbsI-CBh-hSpCas9 containing the Cas9 expression cassette to obtain a cloning plasmid containing the universal sgRNA expression cassette; And / or, in step S4), the universal sgRNA expression cassette is connected to the pB-CMV-mCherry-CMV-(ATAACG)GFP expression vector to obtain the screening reporter vector pB-CMV-mCherry-CMV-(ATAACG)GFP-sgT.

8. A method for enriching and screening single-base editing positive cells, characterized in that: The following steps are involved: A) Construction of sgRNA expression vector targeting base editing site in cell genome; B) co-transfecting cells with the sgRNA expression vector and the single-base editor constructed in step A) and the screening reporter vector for enriching single-base edited cells according to any one of claims 1 to 4; C) The cells transfected in step B) were sorted using a flow cytometer to select GFP(+)mCherry(+) double positive cells.

9. The enrichment screening method according to claim 8, characterized in that: The step also includes step D): diluting the double positive cells sorted in step C) and culturing cell monoclones, obtaining positive cell clones edited by the single base editor through typing and identification; and expanding the culture of the positive cell clones.

10. Use of a screening reporter vector as described in any one of claims 1 to 4, a system as described in claim 5, or a construction method as described in any one of claims 6 to 7 in enriching ABE- and CBE-mediated single-base editing cells.

Images