Recombinant adenovirus vector and preparation method thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a novel recombinant adenovirus vector and a preparation method thereof. The technical problem to be solved by the invention is to provide a novel recombinant adenovirus vector to overcome the defects of long time consumption, complex screening process and the like of the existing adenovirus vector system. The technical scheme adopted by the invention is to provide a recombinant adenovirus vector. The recombinant adenovirus vector comprises an adenovirus genome, a resistance gene and a replication start site element ori. The recombinant adenovirus vector system is a single plasmid system, contains adenovirus gene information and restriction enzyme sites, is simpler and more convenient compared with a two-plasmid system of AdMax and AdEasy which are widely used at present, and has a very good application prospect in the field of preparation of replication-defective adenoviruses and oncolytic adenoviruses.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a novel recombinant adenovirus vector and a preparation method thereof. Background Art

[0002] Human adenovirus is a non-enveloped double-stranded DNA virus with a diameter of about 90-100nm and a genome length of about 36kb. There is a 100bp inverted terminal repeat sequence (ITR) at each end of the viral genome, which is the start site of replication. There is a packaging signal (ψ) about 300bp long on the 3' side of the ITR at the 5' end (left side of the genome) to mediate the packaging of the adenovirus genome into the viral capsid. In addition to the ITRs and packaging signals (ψ) at both ends, the human adenovirus genome also contains multiple transcription units, such as the early transcribed E1 (including E1A and E1B), E2A, E2B, E3 (12.5k, 6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k), E4 and other genes, as well as late transcribed virus assembly-related L1 (pⅢa), L2 (pV, pⅦ, pXPenton), L3 (pV, Hexon, EP), L4 (p), L5 (Fiber) and other genes.

[0003] People use genetic engineering to delete the E1 region gene (marked as △E1) and most of the E3 region genes (retaining 12.5k, deleting 6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k, marked as △E3 region) to construct a replication-deficient recombinant adenovirus, and can introduce exogenous functional genes into the △E1 and △E3 regions of the replication-deficient recombinant adenovirus genome through gene cloning methods to achieve the expression of the target functional genes in cells and function, thereby using the replication-deficient adenovirus as a gene expression vector. Or further, on the basis of wild-type or replication-deficient recombinant adenovirus, genetic engineering means are used to make the adenovirus E1 protein only expressed in tumor cells to construct the adenovirus into an oncolytic adenovirus, and the oncolytic adenovirus can also introduce exogenous functional genes for expression, while achieving oncolytic effects, expressing other target genes required.

[0004] The replication-deficient recombinant adenovirus is a linear double-stranded DNA virus. Compared with other viruses, it can infect a wide range of objects. It can infect most cell lines, primary cells and tissues with extremely high infection efficiency. In addition, the recombinant adenovirus has a very strong carrying capacity for exogenous genes and can accommodate the insertion of up to 8kb of exogenous functional genes and exert their functions. In addition, the replication-deficient recombinant adenovirus does not integrate into the genome of the cell while infecting most cells, which makes it have good safety in treatment. Therefore, the replication-deficient recombinant adenovirus is recognized as one of the most promising gene therapy delivery tools. Recombinant oncolytic adenovirus also has the above advantages, and recombinant oncolytic adenovirus has also become an effective drug for tumor treatment due to its oncolytic activity.

[0005] Common packaging systems for these two types of recombinant adenoviruses are AdEasy and AdMAX. Both packaging systems are two-plasmid systems, i.e., a backbone plasmid and a shuttle plasmid carrying exogenous genes, and both require HEK293 or HEK293A cells that can express the E1 gene as packaging cells.

[0006] The main difference between AdMax and AdEasy is the different process of viral genome recombination:

[0007] (1) The AdEasy system constructs the therapeutic target gene into a shuttle plasmid through gene cloning to obtain the correct recombinant shuttle plasmid (taking 1 week). The recombinant shuttle plasmid is then linearized with restriction endonucleases and electroporated into competent BJ5183 bacteria (carrying the pAdEasy-1 backbone plasmid) for homologous recombination. The bacterial monoclones are plated and amplified, and the plasmids are extracted for PacI digestion verification (taking 1 week); the verified correct recombinant plasmid is transformed into competent Stbl3 bacteria to obtain a high-purity recombinant plasmid and linearized by PacI digestion, and finally transfected into HEK293 cells to obtain recombinant adenovirus (2 weeks). This method is to directly transfer the linearized adenovirus genome into the HEK293 packaging virus, with a high packaging success rate and low adenovirus false positives. However, since this method homologously recombines the shuttle plasmid and the backbone plasmid into a recombinant adenovirus plasmid in bacteria, it is necessary to screen a large number of bacterial monoclones to obtain the correct clone, resulting in a long cycle and a large amount of labor consumption, and the virus titer is low.

[0008] (2) The AdMax system constructs the target gene into a shuttle plasmid through gene cloning to obtain the correct recombinant shuttle plasmid (takes 1 week). The recombinant shuttle plasmid and backbone plasmid are then prepared and introduced into the packaging cell HEK293 for recombination and packaging to obtain the recombinant adenovirus (takes 2 weeks). Further, a single genome adenovirus is obtained through 2 rounds of monoclonal screening by the plaque method (takes 2-3 months). This method is easy to operate, has a shorter virus packaging cycle than the AdEasy system, and has a relatively higher virus titer. Since the shuttle plasmid and backbone plasmid of this system are packaged into recombinant adenovirus by homologous recombination in HEK293 cells, the E1 gene already present in HEK293 cells will cause the packaging process to have the risk of false positive recombination, and it is necessary to go through multiple rounds of repeated screening of a large number of monoclones to obtain the correct, single genome positive virus monoclonal clone.

[0009] Since the current adenovirus packaging system has the above defects, it is very important to develop a new recombinant adenovirus vector and its construction method. Summary of the invention

[0010] The technical problem solved by the present invention is to provide a novel recombinant adenovirus vector to overcome the defects of the existing adenovirus vector system, such as long time consumption, complicated screening process or high false positive rate.

[0011] The technical solution adopted by the present invention is to provide a recombinant adenovirus vector, which includes an adenovirus genome, a resistance gene and a replication initiation site element ori; the adenovirus genome is an adenovirus genome of serotype 2, serotype 3, serotype 5, serotype 26, serotype 35, and serotype 37.

[0012] Wherein, the adenovirus genome described in the above-mentioned recombinant adenovirus vector is a genome of a replication-defective adenovirus or a genome of an oncolytic adenovirus.

[0013] Wherein, restriction endonuclease cleavage sites are provided at both ends of the adenovirus genome in the above-mentioned recombinant adenovirus vector, so that the adenovirus genome can form a linearized genome after enzyme cleavage. Further, restriction endonuclease cleavage sites are introduced at the 5' end of the 5'ITR (left side) and the 3' end of the 3'ITR (right side). Preferably, restriction endonuclease SwaI cleavage sites are introduced at the 5' end of the 5'ITR and the 3' end of the 5'ITR.

[0014] Wherein, the resistance gene in the above-mentioned recombinant adenovirus vector is at least one of an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene or a tetracycline resistance gene.

[0015] Wherein, the ori element in the above-mentioned recombinant adenovirus vector is pMB1 ori, pUC ori, pBR322 ori, ColE1 ori, R6K ori, p15A ori, pSC101 ori ori.

[0016] Wherein, when the adenovirus genome in the above-mentioned recombinant adenovirus vector is a replication-defective adenovirus genome, it includes the following main element characteristics: 5'ITR, packaging sequence Ψ, △E1, △E3, fiber region, 3'ITR.

[0017] Wherein, when the adenovirus genome described in the above-mentioned recombinant adenovirus vector is an oncolytic adenovirus genome, it includes the following main element characteristics: 5'ITR, packaging sequence Ψ, E1, △E3, fiber region, 3'ITR. The promoter of the E1 region is a tumor-specific promoter. Wherein, the E1 region gene contains at least E1A. Furthermore, the E1 region gene may also contain all or part of E1B.

[0018] Among them, the tumor-specific promoter in the above-mentioned recombinant adenovirus vector is E2F-1, alpha-fetoprotein promoter (FAP), prostate-specific antigen (PSA) promoter, human telomerase reverse transcriptase (hTERT) promoter, survivin promoter or Ki67 protein promoter.

[0019] Wherein, when the adenovirus genome in the above-mentioned recombinant adenovirus vector is a replication-defective adenovirus genome, a restriction endonuclease cleavage site is provided in the ΔE3 and / or ΔE1 region;

[0020] When the adenovirus genome is an oncolytic adenovirus genome, restriction endonuclease cleavage sites are provided in the E1 region and / or the ΔE3 region.

[0021] Wherein, the restriction endonuclease described in the above-mentioned recombinant adenovirus vector is one of BanIII, Bsa29I, BseCI, BshVI, BspDI, BspXI, BsuTUI, ClaI, SgrDI, XbaI and PacI.

[0022] Furthermore, the restriction endonucleases at the ΔE1 and ΔE3 sites are different enzymes.

[0023] Among them, the ΔE1 in the above-mentioned recombinant adenovirus vector is provided with a restriction endonuclease SgrDI cleavage site, and the ΔE3 is provided with a restriction endonuclease PacI cleavage site.

[0024] The fiber region in the recombinant adenovirus vector is also inserted with a coding sequence of RGD sequence, the amino acid sequence of which is CDCRGDCFC (Cys-Asp-Cys-Arg-Gly-Asp-Cys-Phe-Cys).

[0025] Among them, a foreign gene is also inserted into the ΔE3 region of the above-mentioned recombinant adenovirus vector.

[0026] Furthermore, the exogenous gene inserted into the ΔE3 region of the above-mentioned recombinant adenovirus vector is an exogenous gene encoding at least one of a cytokine, an immune checkpoint molecule, an immune checkpoint molecule inhibitor, an immunomodulatory molecule, an antigen molecule, an enzyme molecule or an siRNA molecule.

[0027] Furthermore, the adenoviral genome in the above-mentioned recombinant adenoviral vector is an adenoviral backbone genome derived from adenoviral vector pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10i.

[0028] The present invention also provides a method for preparing the above-mentioned recombinant adenovirus vector. The method comprises the following steps:

[0029] 1) constructing tool carrier A and tool carrier B;

[0030] 2) linearizing tool carrier A and tool carrier B respectively;

[0031] 3) performing homologous recombination on the linearized tool vector A and tool vector B to obtain a recombinant adenovirus vector;

[0032] The main elements of the tool vector A are: 5'ITR, packaging sequence Ψ, △E1, 3'ITR, resistance gene, replication origin ori;

[0033] The elements of the tool vector B mainly include resistance genes, the replication origin ori, and the rest of the adenovirus genome except for the 5'ITR, packaging signal Ψ, 3'ITR, E1 region genes and most of the E3 region genes (6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k);

[0034] The resistance gene can be located upstream or downstream of the replication initiation site; homology arms are provided upstream of the 5' end of the 3'ITR of the tool vector A and downstream of the 3' end of the △E1 region;

[0035] Homology arms are arranged downstream of the 3' end of the Fiber region of the tool carrier B and upstream of the 5' end of the ΔE3 region;

[0036] The homology arm upstream of the 5' end of the 3'ITR of the tool vector A is homologous to the homology arm downstream of the 3' end of the Fiber region of the tool vector B; the homology arm downstream of the 3' end of the △E1 region of the tool vector A is homologous to the homology arm upstream of the 5' end of the △E3 region of the tool vector B.

[0037] Furthermore, the essential elements of the tool vector B are: resistance gene, replication start site ori, △E3, and fiber region.

[0038] Furthermore, in step 3) of the above method, the linearized tool vector A and tool vector B are homologously recombined using the Gibson homologous recombination method.

[0039] Wherein, the △E1 region of the tool vector A in the above method is provided with a restriction endonuclease cleavage site. Further, the △E1 region of the tool vector A is provided with a restriction endonuclease SgrDI cleavage site.

[0040] Wherein, the 5' end of the 5' ITR and the 3' end of the 3' ITR of the tool vector A described in the above method are provided with restriction endonuclease cleavage sites. Linearization can be achieved by double enzyme digestion of these two enzyme cleavage sites. Furthermore, the 5' end of the 5' ITR and the 3' end of the 3' ITR of the tool vector A are provided with restriction endonuclease cleavage sites SwaI.

[0041] Wherein, the restriction endonuclease cleavage site is set in the △E3 region of the tool vector B in the above method. Further, the restriction endonuclease PacI cleavage site is set in the △E3 region of the tool vector B.

[0042] Furthermore, the restriction endonucleases set in the △E1 region of tool vector A and the △E3 region of tool vector B are different enzymes.

[0043] Among them, the tool vector B described in the above method is provided with a restriction endonuclease cutting site at the 3' end of the downstream homologous arm at the 3' end of the Fiber region and the 5' end of the upstream homologous arm at the 5' end of the △E3 region; further, the tool vector B is provided with a restriction endonuclease cutting site SwaI at the 3' end of the downstream homologous arm at the 3' end of the Fiber region and the 5' end of the upstream homologous arm at the 5' end of the △E3 region.

[0044] Furthermore, the adenovirus genome described in the above method is an adenovirus backbone genome derived from adenovirus vectors pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10i. The above-mentioned various elements for constructing adenovirus vectors and foreign genes are operably arranged in the adenovirus vector. The arrangement of the various restriction sites and homology arms should not affect the normal expression of other parts of the adenovirus genome.

[0045] In addition, the present invention also provides the use of the above-mentioned recombinant adenovirus vector in preparing replication-deficient recombinant adenovirus and / or oncolytic adenovirus.

[0046] Wherein, the preparation of the replication-deficient recombinant adenovirus and / or oncolytic adenovirus described in the above use is packaged in tumor cells. Furthermore, the replication-deficient recombinant adenovirus and / or oncolytic adenovirus is amplified in tumor cells.

[0047] Wherein, the tumor cells are A549 cells or Hela cells.

[0048] The beneficial effect of the present invention is that the recombinant adenovirus vector system of the present invention is a single plasmid system, which contains adenovirus gene information and restriction endonuclease sites, which is simpler than the two plasmid systems of AdMax and AdEasy that are currently widely used. Compared with the AdEasy system, the recombinant adenovirus vector of the present invention loads the exogenous target gene outside the cell by homologous recombination, and the positive cloning rate is higher, which takes only about 3 days, and it takes only 1 week to transfect HEK293 cells to obtain the virus, and the virus titer is relatively higher. Compared with the Admax system, the system of the recombinant adenovirus vector of the present invention is a single plasmid system, the cell transfection rate is higher than the two plasmid system of Admax, and the genome is single, which effectively avoids the occurrence of recombinant false positives, and the cycle from construction to obtaining the virus is also shorter. The recombinant oncolytic adenovirus constructed with the recombinant adenovirus vector system of the present invention does not rely on HEK293 or HEK293A cells, and can be packaged and amplified in tumor cells such as A549 and Hela, further increasing safety. The recombinant adenovirus vector system of the present invention has good application prospects in the field of preparation of replication-defective adenovirus and oncolytic adenovirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 : Schematic diagram of pBHGFF-ITR vector;

[0050] Figure 2 : pRedET plasmid map;

[0051] Figure 3:Schematic diagram of pBHGFF-Kan-ori vector construction;

[0052] Figure 4 :Schematic diagram of the construction of pBHGFF-ITR;

[0053] Figure 5 :PCR-verified cloned positive nucleic acid electrophoresis. A.PCR amplification verified pBHGFF-Kan-ori cloned positive nucleic acid electrophoresis; B.PCR amplification verified pBHGFF-ITR cloned positive nucleic acid electrophoresis; C.PCR amplification verified pBHGFF-ITR vector ΔE1 region loaded with mcherry gene expression cassette cloned positive nucleic acid electrophoresis; D.PCR amplification verified AdEasy system ΔE1 region loaded with mcherry gene expression cassette cloned positive nucleic acid electrophoresis; E. Molecular weight diagram of DNA marker used for nucleic acid electrophoresis.

[0054] Figure 6 :Schematic diagram of the construction of pBHGFF-ITR-Kana vector;

[0055] Figure 7 :Schematic diagram of the construction of pBHGFF-ITR-RGD;

[0056] Figure 8 : Schematic diagram of the construction of pBHGFF-ITR-RGD-E1A vector;

[0057] Fig. 9 :Schematic diagram of the construction of pBHGFF-ITR-RGD-E1A-mCherry vector;

[0058] Fig.10 :pBHGFF-ITR-RGD-E1A-mCherry linearization and Admax two-plasmid system in HEK293 cells packaging virus map;

[0059] Fig.11 :pBHGFF-ITR-RGD-E1A-mCherry linearization and Admax two-plasmid system for virus packaging in A549 cells;

[0060] Fig.12 :The cell survival rate of U87MG and A549 cells infected with viruses obtained by pBHGFF-ITR-RGD-E1A-mCherry linearization and Admax plasmid systems;

[0061] Fig.13 : mCherry expression after U87MG and A549 were infected by viruses obtained by linearization of pBHGFF-ITR-RGD-E1A-mCherry and Admax plasmid systems. DETAILED DESCRIPTION

[0062] The present invention provides a recombinant adenovirus vector, which is a single plasmid system containing adenovirus gene information and restriction endonuclease sites. By using the recombinant adenovirus vector system of the present invention, an exogenous target gene is loaded outside the cell in a homologous recombination manner, a high positive cloning rate and a high virus titer can be obtained, the time used is also short, and the probability of false positive recombination is also low.

[0063] The recombinant adenovirus vector of the present invention comprises an adenovirus genome, a resistance gene and a replication origin element ori; the adenovirus genome may be an adenovirus genome of serotype 2, serotype 3, serotype 5, serotype 26, serotype 35, or serotype 37. The adenovirus genome portion is used as the main skeleton portion of the recombinant adenovirus vector. It may be derived from the various adenovirus genomes mentioned above, or from the adenovirus skeleton genome in adenovirus vectors such as pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i, or pBHGE10i.

[0064] Restriction endonuclease cleavage sites are arranged at both ends of the adenovirus genome in the above-mentioned recombinant adenovirus vector, so that a linearized genome can be obtained after the recombinant adenovirus vector is cleaved.

[0065] The resistance gene in the above recombinant adenovirus vector is at least one of an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene or a tetracycline resistance gene. The resistance gene is mainly used to screen positive clones during the further use of the vector.

[0066] The ori element in the above recombinant adenovirus vector is pMB1 ori, pUC ori, pBR322 ori, ColE1 ori, R6K ori, p15A ori, pSC101 ori or F1 ori. The ori element is used to achieve replication and amplification of the vector in the target cell in the state of circular double-stranded DNA.

[0067] When the adenovirus genome in the above recombinant adenovirus vector is a replication-deficient adenovirus genome, it includes the following main element characteristics: 5'ITR, packaging sequence Ψ, ΔE1, ΔE3, fiber region, and 3'ITR.

[0068] When the adenovirus genome described in the above-mentioned recombinant adenovirus vector is an oncolytic adenovirus genome, it includes the following main element features: 5'ITR, packaging sequence Ψ, E1, △E3, fiber region, 3'ITR. The promoter of the E1 region is a tumor-specific promoter. Among them, the E1 region gene contains at least E1A. Furthermore, the E1 region gene may also contain all or part of E1B.

[0069] It is understandable that the tumor-specific promoter described in the above-mentioned recombinant adenovirus vector can use various tumor-specific promoters currently commonly used to prepare oncolytic adenovirus.

[0070] When the adenovirus genome in the recombinant adenovirus vector is a replication-deficient adenovirus genome, a restriction endonuclease cleavage site is set in the △E3 and / or △E1 region; and when the adenovirus genome is an oncolytic adenovirus genome, a restriction endonuclease cleavage site is set in the E1 region and / or △E3 region.

[0071] The restriction endonuclease described in the above recombinant adenovirus vector may be a restriction endonuclease commonly used in the art, and may be selected from BanIII, Bsa29I, BseCI, BshVI, BspDI, BspXI, BsuTUI, ClaI, SgrDI, XbaI and PacI.

[0072] It should be noted that the restriction endonucleases set in the △E1 and △E3 regions are not the same enzymes.

[0073] Preferably, the ΔE1 site is provided with a restriction endonuclease SgrDI cleavage site, and the ΔE3 site is provided with a restriction endonuclease PacI cleavage site.

[0074] The recombinant adenovirus vector of the present invention can be inserted with various functional components to construct a recombinant adenovirus with more functions.

[0075] For example, functional sequences such as the coding sequence of the RGD sequence can also be inserted into the Fiber region.

[0076] In addition, since there is a restriction site, foreign genes can be easily inserted into the ΔE3 region of the above-mentioned recombinant adenovirus vector.

[0077] Furthermore, the exogenous gene inserted into the ΔE3 region of the above-mentioned recombinant adenovirus vector is an exogenous gene encoding at least one of a cytokine, an immune checkpoint molecule, an immune checkpoint molecule inhibitor, an immunomodulatory molecule, an antigen molecule, an enzyme molecule or an siRNA molecule.

[0078] Due to the particularity of adenovirus itself, a method for preparing the above-mentioned recombinant adenovirus vector in a simple and quick manner is also provided.

[0079] The method comprises the following steps:

[0080] 1) constructing tool carrier A and tool carrier B;

[0081] 2) linearizing tool carrier A and tool carrier B respectively;

[0082] 3) performing homologous recombination on the linearized tool vector A and tool vector B to obtain a recombinant adenovirus vector;

[0083] The main elements of the tool vector A are: 5'ITR, packaging sequence Ψ, △E1, 3'ITR, resistance gene, replication origin ori;

[0084] The elements of the tool vector B mainly include resistance genes, the replication origin ori, and the rest of the adenovirus genome except for the 5'ITR, packaging signal Ψ, 3'ITR, E1 region genes and most of the E3 region genes (6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k);

[0085] Furthermore, the essential elements of the tool vector B are: resistance gene, replication origin ori, △E3, and fiber region; the resistance gene can be upstream or downstream of the replication origin;

[0086] Homology arms are provided upstream of the 5' end of the 3'ITR of the tool vector A and downstream of the 3' end of the △E1 region;

[0087] Homology arms are arranged downstream of the 3' end of the Fiber region of the tool carrier B and upstream of the 5' end of the ΔE3 region;

[0088] The homology arm upstream of the 5' end of the 3'ITR of the tool vector A is homologous to the homology arm downstream of the 3' end of the Fiber region of the tool vector B; the homology arm downstream of the 3' end of the △E1 region of the tool vector A is homologous to the homology arm upstream of the 5' end of the △E3 region of the tool vector B.

[0089] Furthermore, in step 3) of the above method, the linearized tool vector A and tool vector B are homologously recombined using the Gibson homologous recombination method.

[0090] The ΔE1 region in the tool vector A is provided with a restriction endonuclease cleavage site. Preferably, the ΔE1 region in the tool vector A is provided with a restriction endonuclease SgrDI cleavage site.

[0091] The 5' end of the 5' ITR and the 3' end of the 3' ITR of the tool vector A are also provided with restriction endonuclease cleavage sites. Linearization can be achieved by double enzyme digestion of these two enzyme cleavage sites. Preferably, the 5' end of the 5' ITR and the 3' end of the 3' ITR of the tool vector A are provided with restriction endonuclease swaI cleavage sites.

[0092] The restriction endonuclease cleavage site is set in the ΔE3 region of the tool vector B. Preferably, the restriction endonuclease PacI cleavage site is set in the ΔE3 region of the tool vector B.

[0093] It can be understood that the restriction endonuclease sites set in the ΔE1 region of tool vector A and the ΔE3 region of tool vector B are not the same enzymes.

[0094] In addition, the tool vector B described in the method of the present invention is also provided with restriction endonuclease cleavage sites at the 3' end of the downstream homology arm at the 3' end of the Fiber region and at the 5' end of the upstream homology arm at the 5' end of the ΔE3 region. Preferably, the tool vector B is provided with restriction endonuclease SwaI cleavage sites at the 3' end of the downstream homology arm at the 3' end of the Fiber region and at the 5' end of the upstream homology arm at the 5' end of the ΔE3 region.

[0095] Those skilled in the art will appreciate that the various elements and exogenous genes mentioned above for constructing adenoviral vectors are all operably arranged in adenoviral vectors. The arrangement of the various restriction sites and homology arms should not affect the normal expression of other parts of the adenoviral genome.

[0096] In one embodiment of the present invention, the adenovirus vector pBHGfrtdelE13FLP is used as the starting material, and the replication-defective adenovirus genome contained therein is used as the basis to construct the starting tool vector B required for the recombinant adenovirus of the present invention, and then the tool vector A is separately constructed. After the tool vectors A and B are linearized, homologous recombination is performed based on the homologous arms provided therein to construct the recombinant adenovirus vector of the present invention (see Figure 4 ). The specific method is:

[0097] (1) Spread DH10B bacteria onto a culture medium plate, pick a single clone and inoculate it into liquid culture medium at 37°C overnight.

[0098] (2) The DH10B monoclonal bacteria obtained in step (1) are prepared into competent cells, and the adenovirus vector pBHGfrtdelE13FLP (abbreviated as pBHGFF) is transformed into the DH10B competent cells. After recovery culture, the cells are spread onto a culture medium plate containing ampicillin antibiotics, and the positive clone bacteria DH10B (pBHGFF) are picked.

[0099] (3) The positive clone DH10B (pBHGFF) obtained in (2) was inoculated into a liquid culture medium containing ampicillin, and prepared into competent cells after overnight incubation at 37°C. The plasmid pRedET (expressing the recombinase) was transferred into the competent cells containing DH10B (pBHGFF), and after recovery culture, the cells were spread onto a culture medium plate containing both tetracycline and ampicillin, and cultured at 30°C in the dark, and the positive clone DH10B (pBHGFF + pRedET) was picked.

[0100] (4) Add L-arabinose to the positive clone DH10B (pBHGFF+pRedET) obtained in step (3) to induce the expression of homologous recombinase and prepare competent cells, and combine kanamycin (kana) with homology arms and specific endonuclease sequences with ori fragment PCR products (nucleic acid fragment composition: left homology arm 1+specific endonuclease 1+ori-Kana+specific endonuclease 1+right homology arm 1, structure see Figure 3 ) was transferred into it for recombination reaction. After recovery culture, it was spread on a culture medium plate containing kanamycin and cultured overnight at 37°C. The recombinant positive clone DH10B (pBHGFF-Kana-ori) was picked and cultured overnight to extract the recombinant adenovirus vector pBHGFF-Kana-ori (i.e., tool vector B).

[0101] (5) The pBHGFF-Kan-ori plasmid obtained in step (4) is subjected to SwaI restriction enzyme digestion to linearize it. Then, a Gibson recombination reaction is performed in vitro with the target gene fragment with homology arms (i.e., the tool vector A linearized after XbaI and BamHI restriction enzyme digestion, the nucleic acid fragment composition is: left homology arm 2 + ITR fragment + specific endonuclease 2 + AmpR-Ori + specific endonuclease 3 + ITR fragment + Ad5 packaging signal Ψ + specific endonuclease 4 + right homology arm 2), and then the recombinant product is transformed into DH10B competent cells, resuscitated and cultured to obtain a recombinant adenovirus vector containing the present invention (named pBHGFF-ITR, structure see Figure 1 ) positive clone DH10B.

[0102] In another example provided by the present invention, the recombinant adenovirus vector pBHGFF-ITR is used as a vector to demonstrate the specific process of rapidly introducing the RGD sequence into the Fiber region thereof.

[0103] (1) The positive clone DH10B of the recombinant adenovirus vector pBHGFF-ITR prepared previously was inoculated into a liquid culture medium containing ampicillin, and prepared into competent cells after overnight incubation at 37°C. The plasmid pRedET (expressing the recombinase) was transferred into the competent cells containing DH10B (pBHGFF-ITR), and after recovery culture, it was spread on a culture medium plate containing both tetracycline and ampicillin, and cultured at 30°C in the dark, and the positive clone DH10B (pBHGFF-ITR+pRedET) was picked;

[0104] (2) L-arabinose was added to the positive clone DH10B (pBHGFF-ITR+pRedET) obtained in step (1) to induce the expression of homologous recombinase and prepare competent cells, and the kanamycin (kana) resistance fragment PCR product with homology arms and specific endonuclease sequences (the nucleic acid fragment composition was left homology arm 3+specific endonuclease 4+Kana+specific endonuclease 4+right homology arm 3) was transferred thereto for recombination reaction. After recovery culture, it was spread on a culture medium plate containing ampicillin and kanamycin, and cultured at 37°C overnight. The recombinant positive clone DH10B (pBHGFF-ITR-Kana) was picked, cultured overnight, and the recombinant adenovirus vector pBHGFF-ITR-Kana was extracted.

[0105] (3) The pBHGFF-ITR-Kana plasmid obtained in step (2) is digested with enzymes, and a Gibson recombination reaction is carried out in vitro with a target gene fragment with homology arms (the nucleic acid fragment consists of left homology arm 4+RGD+right homology arm 4), and then the recombinant product is transformed into DH10B competent cells and resuscitated to obtain a positive clone bacterium DH10B containing the recombinant adenovirus vector pBHGFF-ITR-RGD.

[0106] In the examples provided by the present invention, the above-mentioned recombinant adenovirus vector pBHGFF-ITR-RGD is used as the starting vector to demonstrate the specific process of rapidly introducing a tumor-specific promoter, an E1A segment, and a portion of an E1B segment (E1B19kDa) into the △E1 region thereof, as well as rapidly introducing an exogenous gene expression cassette sequence into the △E3 region thereof.

[0107] (1) The vector of the positive clone (pBHGFF-ITR-RGD) was extracted, and the adenovirus vector (pBHGFF-ITR-RGD) was linearized using the SgrDI restriction endonuclease. The PCR product with homology arms and mhTERT-E1A-E1B19kDa fragment (the nucleic acid fragment composition was: left homology arm 5+mhTERT-E1A-E1B19kDa+right homology arm 5) was subjected to Gibson recombination reaction with the linearized pBHGFF-ITR-RGD in vitro. The recombinant product was then transformed into DH10B competent cells and resuscitated to obtain the positive clone DH10B (pBHGFF-ITR-RGD-E1A).

[0108] (2) Extract the vector of the positive clone (pBHGFF-ITR-RGD-E1A), linearize the adenovirus vector (pBHGFF-ITR-RGD-E1A) using PacI restriction endonuclease, and perform Gibson recombination reaction on the target gene expression cassette (composed of: left homology arm 6-promoter-target gene cDNA-SV40 ployA-right homology arm 6) and linearized pBHGFF-ITR-RGD-E1A in vitro. Then, transform the recombinant product into DH10B competent medium and resuscitate to obtain the positive clone DH10B containing the adenovirus vector pBHGFF-ITR-RGD-E1A-target gene.

[0109] (3) Extract the vector of the positive clone (pBHGFF-ITR-RGD-E1A-target gene), linearize the adenovirus vector (pBHGFF-ITR-RGD-E1A-target gene) using SwaI restriction endonuclease, and transfer it into 293A cells or A549, Hela cells to obtain oncolytic adenovirus expressing RGD and the target gene.

[0110] The present invention is further described in detail below through specific descriptions of embodiments.

[0111] Example 1 Structure of the recombinant adenovirus vector of the present invention

[0112] The adenovirus genome is a linear double-stranded DNA. There is a 100bp inverted terminal repeat sequence (ITR) at each end of the viral genome, which is the start site of replication. There is a packaging signal (ψ) of about 300bp on the 3' side of the ITR at the 5' end (left side of the genome) to mediate the packaging of the adenovirus genome into the viral capsid. In addition to the ITRs and packaging signals (ψ) at both ends, the human adenovirus genome also contains multiple transcription units, such as the early transcribed E1 (including E1A and E1B) region, E2A region, E2B region, E3 region (12.5k, 6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k), E4 region and other genes, as well as late transcribed viral assembly-related L1 (pⅢa), L2 (pV, pⅦ, pXPenton), L3 (pV, Hexon, EP), L4 (p), L5 (Fiber) and other genes.

[0113] The E1 gene is an early gene that is activated first and is essential for adenovirus replication. Therefore, adenovirus vectors lacking E1 (indicated by △E1) cannot effectively replicate and produce various viral proteins, and thus cannot complete the viral life cycle. The E3 gene encodes a protein that can destroy the host immune response. Therefore, the lack of E3 protein (indicated by △E3) can reduce the host immune response. Replication-deficient adenovirus is an adenovirus lacking E1 (indicated by △E1) and partially lacking E3 (retaining 12.5k, deleting 6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k, marked as the △E3 region).

[0114] The recombinant replication-deficient adenovirus vector provided in this example is mainly composed of a replication-deficient adenovirus genome, a resistance gene, and ori (see Figure 1 ). The resistance gene is any one of ampicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene and tetracycline resistance gene. The ori element is any one of pMB1 ori, pUC ori, pBR322 ori, ColE1 ori, R6K ori, p15A ori, pSC101 ori and F1 ori.

[0115] There is a restriction endonuclease SgrDI restriction site in △E1, a restriction endonuclease PacI restriction site in △E3, and a restriction endonuclease SwaI restriction site at the 5' end of 5'ITR and the 3' end of 3'ITR. After the vector is digested by SwaI, it can be transfected into HEK293 or HEK293A cells to obtain a replication-deficient adenovirus.

[0116] For example, the adenovirus backbone genome contained in pBHGfrtdelE13FLP is used, with kanamycin resistance gene and pBR322ori as main elements. Through a series of genetic engineering operation methods, a circular recombinant adenovirus vector is obtained, and the vector introduces restriction endonuclease SgrDI restriction site in △E1, restriction endonuclease PacI restriction site in △E3, and restriction endonuclease SwaI restriction site in 5'ITR 5' end and 3'ITR 3' end. That is, a new recombinant restriction virus vector is obtained.

[0117] Example 2 Construction of the recombinant adenovirus vector of the present invention using pBHGFF as raw material

[0118] 1. Spread DH10B bacteria onto a culture medium plate, pick a single clone and inoculate it into liquid culture medium at 37°C overnight;

[0119] 2. Prepare the DH10B monoclonal bacteria obtained in step 1 into competent cells and transfect the adenovirus vector pBHGfrtdelE13FLP (abbreviated as pBHGFF, see schematic diagram) Figure 3 ) was transformed into DH10B competent cells, and after recovery culture, it was spread on a culture medium plate containing ampicillin antibiotics, and the strain containing the pBHGFF plasmid was selected and marked as the positive clone DH10B (pBHGFF) (this marking method was also used in the subsequent steps);

[0120] 3. The positive clone DH10B (pBHGFF) obtained in step 2 was inoculated into a liquid culture medium containing ampicillin antibiotics and prepared into competent cells after overnight at 37°C. The plasmid pRedET (expressing recombinase, see Figure 2 ) was transferred into competent cells containing DH10B (pBHGFF), and after recovery culture, it was spread on a culture medium plate containing both tetracycline and ampicillin antibiotics, cultured at 30°C overnight in the dark, and the positive clone DH10B (pBHGFF + pRedET) was picked;

[0121] 4. PCR amplification of nucleic acid fragment 1

[0122] Nucleic acid fragment 1 is the nucleic acid sequence of kanamycin (kana) with homology arms and specific endonuclease sequences and pBR322ori (composed of: left homology arm 1 + SwaI + ori-Kana + SwaI + right homology arm 1, nucleotide sequence see SEQ ID NO.1, schematic diagram see Figure 3 ).

[0123] (1) Template used: pShuttle CMV

[0124] (2) The primers used are:

[0125] Primer F1 (SEQ ID NO.6):

[0126] AGAAAACTACAATTCCCAACACATACAAGTTACTCCGCCCTAAAACATTTAAATGCGAGCGGTA

[0127] TCAGCTCACTCAAAG

[0128] Primer R1 (SEQ ID NO.7):

[0129] ACCCCCACCTTATATATTCTTTCCCACCCTTAACCACGCCCAGATCATTTAAATGAATTAATTCGA

[0130] TCCTGAATGGCGA

[0131] (3) PCR conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 15 s, 35 cycles; 72°C for 2 min, 4°C, ∞.

[0132] 5. Add L-arabinose to the positive clone DH10B (pBHGFF+pRedET) obtained in step 3 to induce the expression of homologous recombinase and prepare competent cells. Electroporate 200 ng of nucleic acid fragment 1 into the competent cells for recombination reaction (see the schematic diagram of recombination). Figure 3 ), replace the original Flp, AmpR, Ori, frt and other elements on the pBHGFF plasmid, obtain the positive clone DH10B (pBHGFF-Kana-ori, tool vector B), and after recovery culture, spread it on a culture medium plate containing kanamycin and culture it at 37°C overnight. Figure 3 The nucleic acid fragment 1 in the middle and the left homology arm 1 on pBHGFF are nucleic acid fragments with the same sequence, and similarly, the right homology arm 1 is also a homologous sequence.

[0133] Results (see Figure 5 A), 24 single clones were picked in this step, and 23 positive clones were found through PCR verification, with a success rate of 95.8%.

[0134] 6. Culture the recombinant positive clone DH10B (pBHGFF-Kana-ori) overnight and extract the recombinant adenovirus vector pBHGFF-Kana-ori.

[0135] 7. Obtaining Nucleic Acid Fragment 2

[0136] Nucleic acid fragment 2 is a nucleic acid sequence with homology arms, ITR sequences, adenovirus packaging signal (Ψ), SgrDI restriction site (located in ΔE1 region) and other elements (composed of: XbaI-left homology arm 2+3'ITR fragment+SwaI+AmpR-pBR322 Ori+SwaI+5'ITR fragment+Ψ+SwaI+SgrDI+right homology arm 2+BamHI, nucleotide sequence see SEQ ID NO.2).

[0137] (1) Nucleic acid fragment 2 is 3085 bp in size. There is an XbaI restriction site at the 5' end of the left homology arm 2 and a BamHI restriction site at the 3' end of the right homology arm 2. The nucleic acid fragment is expressed in a circular plasmid (p-nucleic acid fragment 2, i.e., tool vector A, see schematic diagram). Figure 4 ) form, with 16 random bases between the BamHI and XbaI restriction sites to facilitate the restriction enzyme cleavage of the two enzymes.

[0138] (2) The plasmid was double-digested with XbaI and BamHI, and the linearized enzyme-digested fragment 2 was obtained by gel recovery (Omega kit).

[0139] 8. The pBHGFF-Kan-ori plasmid obtained in step 5 was digested with SwaI to obtain linearized pBHGFF-Kan-ori, and then subjected to Gibson recombination reaction in vitro with the linearized nucleic acid fragment 2 (see schematic diagram). Figure 4 , Figure 4 The nucleic acid fragment 2 in the middle and the left homology arm 2 on the pBHGFF-Kan-ori plasmid are nucleic acid fragments with the same sequence. The left homology arm 2 and the left homology arm 1 may be the same or different in base length, and the same is true for the right homology arm 2).

[0140] The Gibson recombination reaction system in this step is as follows:

[0141] name Dosage pBHGFF-kana-ori-SwaI digestion 0.0125 pmol Nucleic acid fragment 2 0.025 pmol 2×NEBuilder HiFi DNA Assembly Master Mix 5μL <![CDATA[Deionized H2O]]> Make up to 10 μL

[0142] Then the recombinant product was transformed into DH10B competent cells, revived and cultured to obtain DH10B. The obtained recombinant adenovirus vector was named pBHGFF-ITR.

[0143] In this step, 18 single clones were selected and verified by PCR amplification. The results showed that there were 17 pBHGFF-ITR positive clones, and the success rate reached 94.4% (see Figure 5 B). A positive clone was randomly selected for culture, plasmid extraction and plasmid sequencing. The sequencing results were consistent with the theoretical results, indicating that the recombinant adenovirus vector pBHGFF-ITR was successfully constructed.

[0144] Furthermore, taking the construction of a replication-deficient recombinant adenovirus loaded with an mcherry gene expression cassette in the ΔE1 region as an example, the construction time and success rate of the recombinant adenovirus vector pBHGFF-ITR single plasmid system of the present invention and the AdEasy two plasmid system were compared. (1) The pBHGFF-ITR vector was digested with SgrDI and subjected to Gibson recombination reaction with the mcherry gene expression cassette in vitro. The recombinant product was then transformed into DH10B competent cells and revived and cultured. It took 4 days to obtain a positive recombinant adenovirus vector with correct sequencing. The success rate of the Gibson recombination reaction was as high as 100% (9 single clones were selected, and there were 9 positive clones, see Figure 5 C); (2) In the two plasmids of AdEasy, the shuttle vector was digested with enzymes and then homologously recombined with the mcherry gene expression cassette in vitro. The recombinant product was then transformed into the DH5α competent medium and revived and cultured. It took 4 days to obtain a positive shuttle vector with correct sequencing. The positive shuttle vector was then linearized with restriction endonucleases and electroporated into competent BJ5183 bacteria (carrying the pAdEasy-1 backbone plasmid) for homologous recombination. The bacterial monoclonal clones were plated and cultured. This step took 1 week to obtain a positive recombinant adenovirus vector with correct sequencing. The success rate of obtaining a positive recombinant adenovirus vector by homologous recombination in bacteria in this step was only 12.5% ​​(8 monoclonal clones were picked, and there was 1 positive clone, see Figure 5 D). Figure 5 E is a molecular weight diagram of DNA marker used for nucleic acid electrophoresis. It shows that compared with the AdEasy system, the recombinant adenovirus vector of the present invention loads the exogenous target gene outside the cell by homologous recombination, has a higher positive cloning rate, takes less time, and saves a lot of labor.

[0145] Example 3: Further preparation of functional adenovirus using pBHGFF-ITR as a universal vector

[0146] 1. RGD modified pBHGFF-ITR vector to obtain pBHGFF-RGD

[0147] The RGD sequence (Arg-Gly-Asp) is a short peptide sequence composed of arginine, glycine and aspartic acid. The RGD peptide and its derivatives containing the RGD sequence can specifically recognize and bind to integrin receptor proteins (such as αvβ3, α5β1, etc.) on the cell surface. Inserting an integrin-specific RGD peptide (CDCRGDCFC) into the HI loop of the adenovirus fiber protein knob region can improve the efficiency of adenovirus infection of tumor cells, especially tumor cells lacking coxsackievirus-adenovirus receptors. The present invention also constructs an RGD-modified pBHGFF-ITR vector. The specific modification position of RGD modification is in the fiber region.

[0148] Here’s how:

[0149] (1) The positive clone DH10B (pBHGFF-ITR) was inoculated into a liquid culture medium containing ampicillin, and prepared into competent cells after overnight culture at 37°C. The plasmid pRedET was transferred into the competent cells containing DH10B (pBHGFF-ITR), and after recovery culture, it was spread on a culture medium plate containing both tetracycline and ampicillin, and cultured at 30°C in the dark, and the positive clone DH10B (pBHGFF-ITR + pRedET) was picked;

[0150] (2) Amplification of nucleic acid fragment 3

[0151] Nucleic acid fragment 3 is a kanamycin resistance nucleic acid sequence with homology arms and specific endonuclease sequences (composed of left homology arm 3+XbaI+Kana+XbaI+right homology arm 3, see SEQ ID NO.3, schematic diagram see Figure 6 ).

[0152] ① Template used: pShuttle CMV

[0153] ②The primers used are:

[0154] Primer F2 (SEQ ID NO.8):

[0155] TAACACTAACCATTACACTAAACGGTACACAGGAAACAGGAGACACAACTTCTA

[0156] GAGTTGCCATTGCTGCAGCCAT

[0157] Primer R2 (SEQ ID NO.9):

[0158] TAGTTTGTGGCCAGACCAGTCCCATGAAAATGACATAGAGTATGCACTTGGTCTAGATTTCAGAA

[0159] GAACTCGTCAAGAAG

[0160] ③PCR conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 10 s, 35 cycles; 72°C for 2 min, 4°C, ∞.

[0161] (3) Add L-arabinose to the positive clone DH10B (pBHGFF-ITR+pRedET) obtained in step (1) to induce the expression of homologous recombinase and prepare competent cells, into which nucleic acid fragment 3 is transferred for recombination reaction (see schematic diagram) Figure 6), after recovery culture, spread it on a culture medium plate containing kanamycin, culture it overnight at 37°C, pick the recombinant positive clone DH10B (pBHGFF-ITR-Kana), culture it overnight, and extract the recombinant adenovirus vector pBHGFF-ITR-Kana.

[0162] (4) Amplification of nucleic acid fragment 4

[0163] Nucleic acid fragment 4 is a nucleic acid sequence encoding homology arms and RGD (composed of left homology arm 4 + RGD + right homology arm 4, nucleotide sequence see SEQ ID NO.4, structural diagram see Figure 7 ).

[0164] ① The template used is: a plasmid carrying left homology arm 4+RGD+right homology arm 4

[0165] ②The primers used are:

[0166] Primer F3 (SEQ ID NO.10): AAGTAACATTGTCAGTCAAGTTT

[0167] Primer R3 (SEQ ID NO.11): GGGCAATGTATGAAAAAGTGTA

[0168] ③PCR conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 5 s, 35 cycles; 72°C for 2 min, 4°C, ∞.

[0169] (5) The pBHGFF-ITR-Kana plasmid obtained in step (3) was digested with enzymes and subjected to Gibson recombination reaction in vitro with nucleic acid fragment 4 (see schematic diagram). Figure 7 ), and then transform the recombinant product into DH10B competent cells, and resuscitate and culture to obtain positive clone DH10B (pBHGFF-ITR-RGD). Figure 6 The nucleic acid fragment 3 in the middle and the left homology arm 3 on the pBHGFF-ITR plasmid are nucleic acid fragments with the same sequence. The left homology arm 3 and the left homology arm 4 may be the same or different, and the same is true for the right homology arm 3.

[0170] The Gibson recombination reaction system in this step is as follows:

[0171] name Dosage pBHGFF-ITR-kana-XbaI digestion 0.0125 pmol Nucleic acid fragment 4 0.025 pmol 2×NEBuilder HiFi DNA Assembly Master Mix 5μL Deionized H2O Make up to 10 μL

[0172] 2. Using pBHGFF-ITR-RGD as a vector to construct an exogenous gene-modified oncolytic adenovirus

[0173] The above-mentioned pBHGFF-ITR or pBHGFF-ITR-RGD vector can be used not only to construct adenovirus therapeutic products expressing exogenous genes, but also to construct oncolytic adenovirus therapeutic products expressing exogenous genes. For example, inserting a tumor-specific promoter and E1 gene in the ΔE1 region is used for oncolytic virus construction. In this embodiment, tumor promoters mhTERT and E1A-E1B19kD are used as examples to construct oncolytic adenovirus, and red fluorescent protein mcherry is inserted into the ΔE3 region as an example as an exogenous gene to construct an RGD-modified oncolytic adenovirus expressing mcherry.

[0174] 2.1pBHGFF-ITR-RGD-E1A construction method is as follows:

[0175] (1) Amplification of nucleic acid fragment 5

[0176] Nucleic acid fragment 5 is a nucleic acid sequence with homology arms, mhTERT-E1A-E1B19kDa (composed of: left homology arm 5+mhTERT-E1A-E1B19kDa+right homology arm 5, see SEQ ID NO.5, schematic diagram see Figure 8 .

[0177] ① The template used is: a plasmid containing the mhTERT-E1A-E1B19kDa fragment

[0178] ②The primers used are:

[0179] Primer F4 (SEQ ID NO.12):

[0180] GTGTTTTCCGCGTTCCGGGTCAAAGTTGGCGTTTTATTATTATAGTCAGC TGGCCCCTCCCTCGGG

[0181] TTACCC

[0182] Primer R4 (SEQ ID NO.13):

[0183] TAAGACCCCCACCTTATATATTCTTTCCCACCCTTAACCACGCCCAGATCTCATTCCCGAGGGTCC

[0184] AGGCCG

[0185] ③PCR conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 15 s, 35 cycles; 72°C for 2 min, 4°C, ∞.

[0186] (2) Extract the vector of the positive clone (pBHGFF-ITR-RGD), linearize the adenovirus vector (pBHGFF-ITR-RGD) using SgrDI restriction endonuclease, perform Gibson recombination reaction on nucleic acid fragment 5 and linearized pBHGFF-ITR-RGD in vitro, and then transform the recombinant product into DH10B competent medium and resuscitate to obtain the positive clone DH10B (pBHGFF-ITR-RGD-E1A). See the schematic diagram. Figure 8 .

[0187] The Gibson recombination reaction system in this step is as follows:

[0188] name Dosage pBHGFF-ITR-RGD-SgrDI digestion 0.0125 pmol Nucleic acid fragment 5 0.025 pmol 2×NEBuilder HiFi DNA Assembly Master Mix 5μL <![CDATA[Deionized H2O]]> Make up to 10 μL

[0189] 2.2 Construction of pBHGFF-ITR-RGD-E1A-mcherry vector

[0190] (1) Amplification of the mCherry gene expression cassette

[0191] The mcherry gene expression cassette consists of left homology arm 6-CMV promoter-mcherry cDNA-SV40 ployA-right homology arm 6, see the schematic diagram Fig. 9 .

[0192] ① The template used is: a plasmid containing the mCherry gene expression cassette

[0193] ②The primers used are:

[0194] Primer F5 (SEQ ID NO.14):

[0195] CACTGTGATTTGCAACTGTCCTAACCCTGGATTACATCAAGATCCTCTAGCGTTACATAACTTAC

[0196] GGTAAAT

[0197] Primer R5 (SEQ ID NO.15):

[0198] AGTGATGCTTTATTATTTTTTTTTTAGTTAAAGGGAATAAGATCCCCGGGTACTCTAGTAAGAT

[0199] ACATTGATGAGTTTGGA

[0200] ③PCR conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 5 s, 35 cycles; 72°C for 2 min, 4°C, ∞.

[0201] (2) Extract the vector of the positive clone (pBHGFF-ITR-RGD-E1A), linearize the adenovirus vector (pBHGFF-ITR-RGD-E1A) using PacI restriction enzyme, perform Gibson recombination reaction between the mcherry gene expression cassette and the linearized pBHGFF-ITR-RGD-E1A in vitro, and then transform the recombinant product into DH10B competent medium and resuscitate to obtain the positive clone DH10B (pBHGFF-ITR-RGD-E1A-mcherry). The recombination process is described in detail in the literature. Fig. 9 .

[0202] 2.3 Packaging of oncolytic adenovirus expressing red fluorescent protein mcherry and RGD modification

[0203] In this step, the pBHGFF-ITR-RGD-E1A-mcherry single plasmid vector (hereinafter referred to as the linearized packaging method, marked as linearized in the figure) and the AdMax two-plasmid system were compared in terms of virus packaging time, taking the packaging of an oncolytic adenovirus modified with the tumor promoter mhTERT and E1A-E1B19kD inserted in the ΔE1 region, and the red fluorescent protein mcherry and RGD inserted in the ΔE3 region as an example.

[0204] The pBHGFF-ITR-RGD-E1A-mcherry vector is an oncolytic adenovirus vector with tumor promoter mhTERT and E1A-E1B19kD inserted into the ΔE1 region, red fluorescent protein mcherry inserted into the ΔE3 region, and modified with RGD. The AdMax system inserts tumor promoter mhTERT and E1A-E1B19kD into the ΔE1 region of the shuttle vector, and the backbone vector pBHGFF inserts red fluorescent protein mcherry into the ΔE3 region and is modified with RGD. 2.3.1 Transfection of HEK293 cells with virus packaging

[0205] (1) In the pBHGFF-ITR-RGD-E1A-mcherry single plasmid vector system, the vector of the positive clone (pBHGFF-ITR-RGD-E1A-mcherry) was extracted, and the adenovirus vector (pBHGFF-ITR-RGD-E1A-mcherry) was linearized using the SwaI restriction endonuclease (25°C, 3h). The linearized pBHGFF-ITR-RGD-E1A-mcherry was transferred into HEK293 cells using Lipo3000 and the virus plaque formation was observed.

[0206] (2) In the AdMax system, the shuttle vector and backbone vector were extracted, and the two plasmids were co-transfected into HEK293 cells using lipo3000 to observe the formation of viral plaques.

[0207] Results Fig.10 , viral plaques can be seen on the 4th day after the linearized genome transfection, indicating successful packaging; while the two-plasmid system can only observe red fluorescence expression in the cells 7-10 days after transfection, and no viral plaques can be observed. The cells and supernatant are harvested and re-infected with HEK293 cells, and viral plaques are observed within about 3-7 days, indicating successful packaging. This shows that the single-plasmid system of the present invention saves more time than the two-plasmid system in packaging viruses.

[0208] 2.3.2 Transfection of A549 cells with virus packaging

[0209] (1) In the pBHGFF-ITR-RGD-E1A-mcherry single plasmid vector system, the vector of the positive clone (pBHGFF-ITR-RGD-E1A-mcherry) was extracted, and the adenovirus vector (pBHGFF-ITR-RGD-E1A-mcherry) was linearized using the SwaI restriction endonuclease (25°C, 3h). The linearized pBHGFF-ITR-RGD-E1A-mcherry was transferred into A549 cells using Lipo3000 and the virus plaque formation was observed.

[0210] (2) In the AdMax system, the shuttle vector and backbone vector were extracted, and the two plasmids were co-transfected into A549 cells using lipo3000 to observe the formation of viral plaques.

[0211] Results Fig.11 , viral plaques were observed on the 6th day after the linearized genome was transfected, indicating successful packaging; however, in the two-plasmid system, only red fluorescence expression was observed in the cells 15 days after transfection, and no viral plaques were observed. The cells and supernatant were harvested and reinfected in A549 cells, but no viral plaques were observed after 15 days. This may indicate that the packaging efficiency in A549 is very low or that packaging is unsuccessful.

[0212] 2.4 Effect detection of oncolytic adenovirus expressing red fluorescent protein mcherry and RGD modification

[0213] In this experiment, the effects of packaging the same virus using the linearized vector system pBHGFF-ITR-RGD-E1A-mcherry of the present invention (hereinafter referred to as the linearized packaging method, marked as linearized in the figures) and the traditional Admax two-plasmid system were compared, including virus titer, oncolytic effect and mcherry expression.

[0214] 2.4.1 Virus titer

[0215] The same oncolytic adenovirus expressing the red fluorescent protein mcherry and modified with RGD obtained by the linearization packaging method and the traditional Admax packaging method was used to infect HEK293 cells with the same MOI for the same amount of amplification, CsCl purification, and finally TCID50 titer determination.

[0216] Under the same conditions, the total viral mass of oncolytic virus purified by linear packaging method was 8.52×10 11 IU, TCID50 titer is 1.42×10 11 IU / ml; the total viral amount of oncolytic virus purified by the two plasmid system was 7.87×10 11 IU, TCID50 titer is 1.29×10 11 IU / ml. The results showed that the total amount and titer of the virus obtained by the linear packaging method were basically the same as those obtained by the traditional Admax packaging method.

[0217] 2. Oncolytic effect

[0218] The two oncolytic adenoviruses obtained by the linearized packaging method for completing TCID50 titer determination and the Admax traditional packaging method were used to infect tumor cells U87MG and A549, and the oncolytic effects of the viruses obtained by the two packaging methods were detected by CCK8 killing experiments.

[0219] The experimental results are shown in Fig.12 In tumor cells U87MG and A549, both the linearized and two-plasmid system-derived oncolytic adenoviruses could effectively kill tumor cells, and there was no statistical difference between the two.

[0220] 3. mCherry expression detection

[0221] The two oncolytic adenoviruses obtained by the linearized packaging method for TCID50 titer determination and the Admax traditional packaging method were used to infect tumor cells U87MG and A549, and the expression level of mCherry was detected by flow cytometry.

[0222] The experimental results are shown in Fig.13 In tumor cells U87MG and A549, the oncolytic adenovirus obtained by linearization and two plasmid systems infected the cells for 48 hours, and the expression of mcherry was detected by flow cytometry. The results showed that both of them could express mcherry, and there was no statistical difference between the two. SEQ ID NO.1 (nucleic acid fragment 1):

[0223] agaaaactacaattcccaacacatacaagttactccgccctaaaacatttaaatgcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg

[0224] gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgag

[0225] catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgac

[0226] cctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctg

[0227] ggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagc

[0228] cactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgct

[0229] ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcag

[0230] aaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatctt

[0231] cacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgat

[0232] ctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccac

[0233] gctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccg

[0234] ggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctgcagccatgagattatcaaaaaggatcttcacctagatccttttcacgtagaaa

[0235] gccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgg

[0236] gcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaact

[0237] ggatggctttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgca

[0238] ggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcc

[0239] cggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtg

[0240] ctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatg

[0241] gctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtc

[0242] ttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtga

[0243] cccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgtt

[0244] ggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttc

[0245] ttgacgagttcttctgaattttgttaaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggt

[0246] tgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccat

[0247] caccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggc

[0248] gagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgcc

[0249] gctacagggcgcgtccattcgccattcaggatcgaattaattcatttaaat

[0250] SEQ ID NO.2 (p-Nucleic acid fragment 2, vector A):

[0251] TCTAGACacttcccattttaagaaaactacaattcccaacacatacaagttactccgccctaaaacctacgtcacccgccccgttcccacgccccgcgccacgtc

[0252] acaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattgatgatgATTTAAATatcctcgaggagctcatgagcgcttgtttcggcgtg

[0253] ggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggctg

[0254] cttcctaatgcaggagtcgcataagggagagcgtcgaaaatttcgaacgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgcctatt

[0255] tttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatcc

[0256] gctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcct

[0257] gtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgaga

[0258] gttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcata

[0259] cactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataa

[0260] cactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccgga

[0261] gctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc

[0262] ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagc

[0263] gtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaataga

[0264] cagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggt

[0265] gaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctg

[0266] cgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagag

[0267] cgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctg

[0268] ctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccag

[0269] cttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcg

[0270] gcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgt

[0271] gatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatccc

[0272] ctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagc

[0273] gcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtaatcgaattca

[0274] agcttgtcgactcgaagatcATTTAAATCAtcatcaataatataccttattttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggg

[0275] gcgtgggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttggtg

[0276] tgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagtaagatttggccattttcgcgggaaaactgaat

[0277] aagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaatatttgtctagggccgcggggactttgaccgtttacgtggagactcgcccaggtgtttttctcag

[0278] gtgttttccgcgttccgggtcaaagttggcgttttattattatagtcagcCGTCGACGgatctgggcgtggttaagggtgggaaagaatatataaggtgggggtctt

[0279] atgtagttttgtatctgttttggatcc

[0280] SEQ ID NO.3 (Nucleic acid fragment 3):

[0281] taacactaaccattacactaaacggtacacaggaaacaggagacacaactTCTAGAgttgccattgctgcagccatgagattatcaaaaaggatcttcacctagat

[0282] ccttttcacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagca

[0283] ggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaag

[0284] ccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaa

[0285] gatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtca

[0286] gcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttc

[0287] cttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgaga

[0288] aagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcgg

[0289] atggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcga

[0290] ggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctat

[0291] caggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatc

[0292] gccttctatcgccttcttgacgagttcttctgaaaTCTAGAccaagtgcatactctatgtcattttcatgggactggtctggccacaactaSEQ ID NO.4 (Nucleic acid fragment 4):

[0293] aagtaacattgtcagtcaagtttacttaaacggagacaaaactaaacctgtaacactaaccattacactaaacggtacacaggaaacaggagacacaactTGTGA

[0294] CTGCCGCGGAGACTGTTTCTGCccaagtgcatactctatgtcattttcatgggactggtctggccacaactacattaatgaaatatttgccacatcctc

[0295] ttacactttttcatacattgccc

[0296] SEQ ID NO.5 (Nucleic acid fragment 5):

[0297] gtgttttccgcgttccgggtcaaagttggcgttttattattatagtcagcTGGCCCCTCCCTCGGGTTACCCCACAGCCTAGGCCGATT

[0298] CGACCTCTCTCCGCTGGGGCCCTCGCTGGCGTCCCTGCACCCTGGGAGCGCGAGCGGCGCGCGGGCG

[0299] GGGAAGCGCGGCCCAGACCCCCGGGTCCGCCCGGAGCAGCTGCGCTGTCGGGGCCAGGCCGGGCTC

[0300] CCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCC

[0301] GGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACC

[0302] CCTTCCGGGTCCCCGGCCCAGCCCCTTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCG

[0303] CCCTCTCCTCGGCGGCTCGTGGCTCTTTCGCGGCAAAAAGGATTTGGCGCGTAAAAGTGGCGGCGCG

[0304] AGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAAGCCCTGGCCCCGGCCACCCCCGCGgaattca

[0305] tgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccatt

[0306] ttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtg

[0307] caggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccgg

[0308] tttctatgccaaaccttgtaccggaggtgatcgatccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccccgggcacggtt

[0309] gcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtaagtgaaaattatgggc

[0310] agtgggtgatagagtggtgggtttggtgtggtaattttttttttaatttttacagttttgtggtttaaagaattttgtattgtgatttttttaaaaggtcctgtgtctgaacctgagcct

[0311] gagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagagaatgcaatagta

[0312] gtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgcc

[0313] aggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataaggtgtaaacctgtgattgcgtgtgtggtt

[0314] aacgcctttgtttgctgaatgagttgatgtaagtttaataaagggtgagataatgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatataatgcgccgt

[0315] gggctaatcttggttacatctgacctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggttttggag

[0316] gtttctgtggggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatc

[0317] tgggtcaccaggcgcttttccaagagaaggtcatcaagactttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggag

[0318] Tgaagaaacccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgctactgttgtcttccgtccg

[0319] cccggcgataataccgacggaggagcagcagcagcagcaggaggaagccaggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatgagatctgggcgtggttaagggtgggaaagaatatataaggtgggggtctta。

Claims

1. A recombinant adenovirus vector, characterized in that: It comprises an adenovirus genome, a resistance gene and a replication initiation site element ori, wherein the adenovirus genome is an adenovirus genome of serotype 2, serotype 3, serotype 5, serotype 26, serotype 35 or serotype 37.

2. The recombinant adenovirus vector according to claim 1, characterized in that: The adenovirus genome is a genome of a replication-defective adenovirus or a genome of an oncolytic adenovirus.

3. The recombinant adenovirus vector according to claim 1, characterized in that: The adenovirus genome is provided with restriction endonuclease cleavage sites at both ends, so that the adenovirus genome can form a linearized genome after enzyme cleavage; further, the adenovirus genome introduces restriction endonuclease cleavage sites at the 5' end of the 5'ITR and the 3' end of the 3'ITR.

4. The recombinant adenovirus vector according to claim 1, characterized in that: The resistance gene is at least one of an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene or a tetracycline resistance gene.

5. The recombinant adenoviral vector according to claim 1, characterized in that: The ori element is pMB1 ori, pUC ori, pBR322 ori, ColE1 ori, R6K ori, p15A ori, pSC101 ori ori.

6. The recombinant adenovirus vector according to claim 1, characterized in that: When the adenovirus genome is a replication-defective adenovirus genome, it includes the following main element characteristics: 5'ITR, packaging sequence Ψ, △E1, △E3, fiber region, and 3'ITR.

7. The recombinant adenoviral vector according to claim 1, characterized in that: When the adenovirus genome is an oncolytic adenovirus genome, it includes the following main element characteristics: 5'ITR, packaging sequence Ψ, E1, △E3, Fiber region, 3'ITR; the promoter in the E1 region is a tumor-specific promoter; further, the E1 contains at least E1A in the E1 region.

8. The recombinant adenoviral vector according to claim 1, characterized in that: The tumor-specific promoter is E2F-1 promoter, alpha-fetoprotein promoter (FAP), prostate-specific antigen (PSA) promoter, human telomerase reverse transcriptase (hTERT) promoter, survivin promoter or Ki67 protein promoter.

9. The recombinant adenoviral vector according to any one of claims 1 to 8, characterized in that: When the adenovirus genome is a replication-deficient adenovirus genome, restriction endonuclease cleavage sites are provided in the ΔE1 and / or ΔE3 regions; when the adenovirus genome is an oncolytic adenovirus genome, restriction endonuclease cleavage sites are provided in the E1 region and / or ΔE3 region.

10. The recombinant adenoviral vector according to any one of claims 1 to 10, characterized in that: The restriction endonuclease is one of BanIII, Bsa29I, BseCI, BshVI, BspDI, BspXI, BsuTUI, ClaI, SwaI, SgrDI, XbaI and PacI.

11. The recombinant adenoviral vector according to claim 9, characterized in that: The restriction endonucleases at the △E1 and △E3 sites and at both ends of the adenovirus genome are different enzymes.

12. The recombinant adenoviral vector according to any one of claims 1 to 11, characterized in that: At least one of the following is satisfied: the △E1 has a restriction endonuclease SgrDI cleavage site; the △E3 has a restriction endonuclease PacI cleavage site; the restriction endonuclease sites set at both ends of the adenovirus genome are SwaI restriction endonuclease sites.

13. The recombinant adenoviral vector according to any one of claims 1 to 12, characterized in that: The Fiber region is further inserted with an RGD sequence; or, a foreign gene is further inserted into the ΔE3 region.

14. The recombinant adenoviral vector according to any one of claims 1 to 13, characterized in that: The exogenous gene inserted into the ΔE3 region is an exogenous gene encoding at least one of a cytokine, an immune checkpoint molecule, an immune checkpoint molecule inhibitor, an immunomodulatory molecule, an antigen molecule, an enzyme molecule or an siRNA molecule.

15. The recombinant adenoviral vector according to any one of claims 1 to 14, characterized in that: The adenovirus genome is an adenovirus backbone genome derived from adenovirus vector pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10i.

16. The method for preparing a recombinant adenovirus vector according to any one of claims 1 to 15, characterized in that The following steps are involved: 1) constructing tool carrier A and tool carrier B; 2) linearizing tool carrier A and tool carrier B respectively; 3) performing homologous recombination on the linearized tool vector A and tool vector B to obtain a recombinant adenovirus vector; The main elements of the tool vector A are: 5'ITR, packaging sequence Ψ, △E1, 3'ITR, resistance gene, replication origin ori; The elements of the tool vector B mainly include resistance genes, the replication origin ori, and the rest of the adenovirus genome except for the 5'ITR, packaging signal Ψ, 3'ITR, E1 region genes and most of the E3 region genes (6.7k, gp19k, 11.6k, 10.4k, 14.5k and 14.7k); Homology arms are arranged upstream of the 5' end of the 3'ITR of the tool vector A and downstream of the 3' end of the △E1 region; Homology arms are arranged downstream of the 3' end of the Fiber region of the tool carrier B and upstream of the 5' end of the ΔE3 region; The homology arm upstream of the 5' end of the 3'ITR of the tool vector A is homologous to the homology arm downstream of the 3' end of the Fiber region of the tool vector B; the homology arm downstream of the 3' end of the △E1 region of the tool vector A is homologous to the homology arm upstream of the 5' end of the △E3 region of the tool vector B.

17. The method for preparing a recombinant adenovirus vector according to claim 16, characterized in that: The step 3) homologously recombine the linearized tool vector A and tool vector B using the Gibson homologous recombination method.

18. The method for preparing a recombinant adenovirus vector according to any one of claims 16 and 17, characterized in that: The △E1 region in the tool vector A is provided with a restriction endonuclease cleavage site; further, the △E1 region in the tool vector A is provided with a restriction endonuclease SgrDI cleavage site.

19. The method for preparing a recombinant adenovirus vector according to any one of claims 16 to 18, characterized in that: The 5' end of the 5'ITR of the tool vector A and the 3' end of the 3'ITR are provided with restriction endonuclease cleavage sites to achieve linearization; further, the 5' end of the 5'ITR of the tool vector A and the 3' end of the 3'ITR are provided with restriction endonuclease cleavage sites SwaI.

20. The method for preparing a recombinant adenovirus vector according to any one of claims 16 to 19, characterized in that: The △E3 region of the tool vector B is provided with a restriction endonuclease cleavage site; further, the tool vector B has a restriction endonuclease PacI cleavage site in the △E3 region.

21. The method for preparing a recombinant adenovirus vector according to any one of claims 16 to 20, characterized in that: The tool vector B is provided with restriction endonuclease cutting sites at the 3' end of the downstream homologous arm at the 3' end of the Fiber region and the 5' end of the upstream homologous arm at the 5' end of the △E3 region; further, the tool vector B is provided with restriction endonuclease cutting sites SwaI at the 3' end of the downstream homologous arm at the 3' end of the Fiber region and the 5' end of the upstream homologous arm at the 5' end of the △E3 region.

22. The method for preparing a recombinant adenovirus vector according to any one of claims 1 to 21, characterized in that: The adenovirus genome is an adenovirus backbone genome derived from adenovirus vector pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10i.

23. Use of the recombinant adenovirus vector according to any one of claims 16 to 22 in preparing a replication-deficient recombinant adenovirus and / or an oncolytic adenovirus.

Images