Application of RSAD1 gene as target spot in screening of drugs for inhibiting picornaviridae virus infection

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application of an RSAD1 gene / protein serving as a target spot in screening of drugs for inhibiting picornaviridae virus infection. The silent RSAD1 gene is accidentally found to be capable of remarkably inhibiting the replication of the Seneca virus and can be used as a target spot for researching and developing an antiviral drug for the Seneca virus. The invention provides an sgRNA sequence of a targeted RSAD1 gene, a CRISPR-Cas9 gene editing technology is combined, the RSAD1 gene is silenced, an RSAD1 gene knockout monoclonal cell line is obtained, the cell line can remarkably inhibit the replication of Seneca virus, and a target spot is provided for further screening drugs and reagents for resisting the replication of Seneca virus; meanwhile, it is found that overexpression of the RSAD1 protein in host cells can significantly promote replication of Seneca viruses, and the RSAD1 protein can be used as a production cell line of Seneca viruses or vaccines and used for production of Seneca viruses or vaccines.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to an application of RSAD1 gene as a target in screening drugs for inhibiting picornavirus virus infection. Background Art

[0002] Senecavirus A (SVA) is a single-stranded positive-sense RNA virus and the only member of the Senecavirus genus of the Picornaviridae family. Other members of the Picornaviridae family include viruses of the genera Enterovirus, Rhinovirus, Cardiovirus, and Orthomavirus. Senecavirus is highly pathogenic to pigs and can infect pigs of different ages. Adult pigs develop vesicular ulcers in the mouth, nose, and hoof crown after infection, and newborn piglets die acutely after infection. The virus was introduced into Guangdong Province in my country in 2015 and then became prevalent. Subsequently, SVA outbreaks occurred in pig farms in many provinces, causing serious economic losses to my country's pig farming industry.

[0003] The CRISPR-Cas9 system is composed of clustered regularly interspaced short palindromic repeats (CRISPR) gene sequences and Cas family proteins. It is a third-generation gene editing technology that can target almost any gene. It is easy to operate and has high knockout efficiency. It is widely used in gene editing, especially in the construction of gene knockout cell lines.

[0004] Proteins containing the radical S-adenosyl-methionine (SAM) domain generate 5'-deoxyadenosine radicals by cleaving the SC(5') bond in the SAM domain, catalyzing a series of complex redox reactions and exerting redox enzyme activity. Literature reports that the radical S-adenosyl-methionine domain-containing protein 2 (RSAD2) has redox enzyme activity and can inhibit the replication of multiple viruses such as Zika virus, influenza virus, and hepatitis C virus.

[0005] The present invention unexpectedly discovered that inhibiting the expression of RSAD1 gene in host cells can significantly inhibit the replication of SVA; secondly, the present invention provides a sgRNA specifically targeting the RSAD1 gene, the sgRNA can specifically target the RSAD1 gene, and combined with CRISPR-Cas9 technology to achieve the knockout of the RSAD1 gene, the RSAD1 gene can be used as a drug target for screening and developing anti-SVA, and for screening anti-SVA drugs; at the same time, the present invention discovered that overexpressing RSAD1 protein in host cells can significantly promote the replication of Seneca virus, and can be used as a production cell line for Seneca virus or vaccine, and used for the production of Seneca virus or vaccine. Summary of the invention

[0006] In view of the above technical problems, the present invention unexpectedly discovered that inhibiting the expression of RSAD1 gene in host cells can significantly inhibit the replication of SVA, that is, the RSAD1 gene can be used as a drug target for screening and developing anti-SVA drugs, and can be used for screening anti-SVA drugs; overexpression of RSAD1 protein in host cells can significantly promote the replication of Seneca virus, and can be used as a production cell line for Seneca virus or vaccine, and can be used for the production of Seneca virus or vaccine. Specifically including the following contents:

[0007] In a first aspect, the present invention provides the use of RSAD1 gene / protein as a target in screening drugs for preventing or treating viral infections, wherein the drug targets RSAD1 and inhibits the expression of RSAD1 gene / protein.

[0008] Preferably, the virus is a Picornaviridae virus.

[0009] Preferably, the Picornaviridae virus is Seneca virus.

[0010] In a second aspect, the present invention provides the use of RSAD1 gene / protein expression inhibitors in the preparation of drugs for preventing or treating viral infections.

[0011] Preferably, the virus is a Picornaviridae virus.

[0012] Preferably, the Picornaviridae virus is Seneca virus.

[0013] Preferably, the RSAD1 gene / protein expression inhibitor includes a small interfering RNA designed with the RSAD1 gene / protein as a target or an sgRNA targeted to knock out the RSAD1 gene / protein.

[0014] Preferably, the sgRNA targeting RSAD1 gene / protein knockout is delivered by a delivery vector.

[0015] Preferably, the targeting sequence of the sgRNA for targeted knockout of RSAD1 gene / protein is: TCTAGCCAGCCCCCGTACTG.

[0016] Preferably, the sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R:

[0017] sgRNA-F: 5'-CACCGTCTAGCCAGCCCCCGTACTG-3';

[0018] sgRNA-R: 5'-AAACCAGTACGGGGGCTGGCTAGAC-3'.

[0019] In a third aspect, the present invention provides the use of RSAD1 gene / protein as a target in screening virus or vaccine production enhancers, wherein the drug targets RSAD1 and promotes the expression of RSAD1 gene / protein.

[0020] Preferably, the virus is a Picornaviridae virus.

[0021] Preferably, the Picornaviridae virus is Seneca virus.

[0022] In a fourth aspect, the present invention provides the use of RSAD1 protein or its expression promoter in the preparation of virus or vaccine production enhancer.

[0023] Preferably, the virus is a Picornaviridae virus.

[0024] Preferably, the Picornaviridae virus is Seneca virus.

[0025] In a fifth aspect, the present invention provides the use of a RSAD1 protein overexpressing cell line in the preparation of a virus or vaccine producing cell line.

[0026] Preferably, the virus is a Picornaviridae virus.

[0027] Preferably, the Picornaviridae virus is Seneca virus.

[0028] The beneficial effects of the present invention are as follows: ① The present invention firstly finds that inhibiting the expression of RSAD1 gene in host cells can inhibit the replication of Picornaviridae virus SVA; ② The present invention provides an sgRNA targeting RSAD1 gene, wherein the sgRNA can target RSAD1 gene, and can achieve high-efficiency knockout of RSAD1 gene in host cells in combination with CRISPR-Cas9 technology; ③ The present invention provides a method for constructing a RSAD1 gene knockout cell line by delivering the sgRNA to a host cell through CRISPR-Cas9 technology; ④ The monoclonal cell line obtained according to the method of the present invention can significantly inhibit the replication of Picornaviridae virus SVA, can be used as a drug screening target for treating Picornaviridae virus, and provides research tools and materials for further studying the molecular mechanism of RSAD1 gene regulating the replication of Picornaviridae virus in cells; ⑤ The present invention finds that overexpressing RSAD1 protein in host cells can significantly promote the replication of Seneca virus, and can be used as a production cell line for Seneca virus or vaccine, and is used for the production of Seneca virus or vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of sgRNA sequences targeting the RSAD1 genomic region;

[0030] Figure 2 Analysis of gene deletion mutations in RSAD1-KO cell lines;

[0031] Figure 3 Western blotting was used to detect the protein level of RSAD1 gene in knockout cell lines;

[0032] Figure 4 Cell viability test results of RSAD1 gene function-deficient cell lines;

[0033] Figure 5 Fluorescence quantitative qPCR was used to detect the replication level of SVA in RSAD1-WT and RSAD1-KO cells;

[0034] Figure 6 Western blotting was used to detect the viral protein levels of SVA replicated in RSAD1-WT and RSAD1-KO cells;

[0035] Figure 7 TCID 50 Detection of viral titer of SVA in RSAD1-KO cells;

[0036] Figure 8 The expression results of RSAD1 protein were detected in the RSAD1-overexpressing PK-15 cell line;

[0037] Fig. 9 Results of SVA 3D transcription level detection in RSAD1 overexpressing PK-15 cell line;

[0038] Fig.10 Expression results of SVA structural protein VP2 in RSAD1-overexpressing PK-15 cell line;

[0039] Fig.11 TCID 50 The viral titer of SVA was detected in the RSAD1-overexpressing PK-15 cell line. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical scheme and advantages of the present invention clearer, the embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. However, it will be appreciated by those skilled in the art that in the embodiments of the present invention, many technical details are provided to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical scheme claimed in the present application can be implemented.

[0041] definition

[0042] The term "sgRNA (small guide RNA)" is a guide RNA (gRNA), which refers to a small non-coding RNA that guides the insertion or deletion of uridine residues into the kinetoplastid during the RNA editing process. The gRNA edits RNA molecules with a length of approximately 60-80 nucleotides and is transcribed from a separate gene.

[0043] The present invention first synthesized sgRNA targeting the RSAD1 gene, and then used the CRISPR / Cas9 method to specifically knock out the RSAD1 gene. Taking PK-15 cells as an example, the RSAD1 gene (RSAD1 amino acid sequence is shown in SEQ ID NO.1; nucleotide sequence is shown in SEQ ID NO.2) was knocked out to obtain a gene knockout host cell, which provides a strategy for inhibiting the infection of SVA.

[0044] Using CRISPR / Cas9 gene editing technology, the sgRNA targeting the RSAD1 gene guides the Cas9 protein to bind to the specific sequence position of the RSAD1 gene to cut the DNA double strand, causing double-strand breaks in the gene. Under the action of the cell's own repair mechanism, random mutations occur. Mutations such as nucleotide deletions or insertions will cause changes in the gene's reading frame, ultimately achieving the purpose of losing the function of the gene-encoded protein and obtaining a cell line with a gene-encoded protein loss function.

[0045] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0046] The sources of the plasmids involved in the following examples were purchased from ORIGENE.

[0047] SVACH-FJ-2017 (GenBank: KY74510) was obtained from the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0048] The RSAD1 gene sequence described in the following examples is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.1.

[0049] Example 1 Construction of RSAD1 gene knockout PK-15 cell line

[0050] The RSAD1 gene sequence was queried using the NCBI database, and according to the CRISPR / Cas9 design principles, a sgRNA was designed in the fourth exon region of the RSAD1 gene using CRISPR software (e.g. Figure 1 shown):

[0051] The targeting sequence of the RSAD1-sgRNA is: TCTAGCCAGCCCCCGTACTG (shown in SEQ ID NO.3); the RSAD1-sgRNA is a double-stranded fragment formed by annealing RSAD1-sgRNA-F (5'-CACCGTCTAGCCAGCCCCCGTACTG-3', shown in SEQ ID NO.4) and RSAD1-sgRNA-R (5'-AAACCAGTACGGGGGCTGGCTAGAC-3', shown in SEQ ID NO.5);

[0052] Annealing of sgRNA: Add 10 μL ddH2O to dissolve 1 OD of sgRNA upstream and downstream single-stranded nucleotide dry powder primers, take 1 μL of each upstream and downstream primers, and add annealing buffer, a total of 50 μL system, anneal at 99℃ for 5 minutes to make the upstream and downstream primers form double strands;

[0053] Enzyme digestion of lenti-CRISPR-v2 vector: 1 μg of vector, 1 μL of endonuclease Esp3I, 2 μL of 10× buffer, and 20 μL of ddH2O in a reaction system, digest at 37°C for 2 h, and recover the digested fragments on gel;

[0054] Ligation of restriction enzyme vector and sgRNA: T4 ligase 1μL, 10×T4 ligase buffer 1μL, lenti-CRISPR-v2 restriction enzyme fragment 1μL, annealed sgRNA 1μL, ddH2O 6μL, a total of 10μL system, ligation at room temperature for 2h;

[0055] Transformation of lenti-CRISPR-v2-sgRNA ligation products: The ligation products were transformed into DH5α competent cells, plasmids were extracted, and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target gene sequence using BLAST software, and sgRNA recombinant plasmids with different exons targeting RSAD1 gene were successfully constructed. The position and sequence information are as follows Figure 1 ; The recombinant plasmids were named: lenti-CRISPR-v2-RSAD1-sgRNA.

[0056] Cell transfection: According to the standard transfection procedure of PEI, lenti-CRISPR-v2-RSAD1-sgRNA plasmid (10μg) was co-transfected with two auxiliary vectors (LH1, 7.5μg and LH2, 5μg) into 293T cells. The supernatant was collected 36h after transfection, filtered with a 0.45μm filter, and polybrene (8μg / mL) was added to infect PK-15 cells. After screening for 3 generations with a medium containing 1μg / mL puromycin, the cells were counted and the cells were divided into 96-well plates at a dilution ratio of one cell per well. About 2-3 weeks later, monoclones were picked and sequenced to identify their genotypes. Two RSAD1 knockout monoclones and two wild-type monoclones were randomly selected from them and expanded for subsequent experiments.

[0057] The results are as follows Figure 2 As shown, there is a 1 base deletion at the intended cleavage position (cutting between the 3rd and 4th bases from the PAM motif (TGG)).

[0058] Western blotting was used to detect the protein expression of RSAD1. Figure 3 As shown, RSAD1 protein expression was not detected in the RSAD1-KO cell line. The above results indicate that the RSAD1 gene knockout PK-15 cell line was successfully constructed.

[0059] Example 2 Viability detection of RSAD1 gene knockout PK-15 cell line

[0060] After digestion, count the cells to be tested, adjust the concentration of the cell suspension, add 100 μL of 2000 cells to each well of a 96-well plate, and culture them in a cell culture incubator; add 10 μL of CCK-8 reagent to each well, continue to culture in a cell culture incubator for 3 hours, and use an enzyme reader to measure the absorbance at 450 nm and analyze the data. Figure 4 As shown, the cell viability of RSAD1 gene knockout PK-15 cell line RSAD1-KO is the same as that of the control group PK-15 cells, indicating that the knockout of RSAD1 gene does not affect the normal proliferation and growth of host cells.

[0061] Example 3 Replication level of SVA in RSAD1-KO cell line

[0062] RSAD1-KO and control group PK-15 cells (WT) were plated in 6-well plates, and infected with SVA 12 hours later. The cells were harvested at 0, 6, and 12 hours, and total RNA was extracted by Trizol lysis method. Reverse transcription was performed using HiScript IIQ RT SuperMix (Novagen R222-01) reverse transcription kit, and qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Novagen Q711-02) reagent. GAPDH was used as an internal reference gene to detect the transcription level of SVA3D. The primer sequences used were SVA3D-qPCR-F (5'-AGAATTTGGAAGCCATGCTCT-3', shown in SEQ ID NO.6) and SVA3D-qPCR-R (5'-GAGCCAACATAGARACAGATTGC-3', shown in SEQ ID NO.7) swine-GAPDH-qPCR-F (5'-ACATGGCCTCCAAGGAGTAAGA-3', shown in SEQ ID NO.8) and swine-GAPDH-qPCR-R (5'-GATCGAGTTGGGGCTGTGACT-3', shown in SEQ ID NO.9). The results are shown in Figure 5 As shown, knockout of RSAD1 significantly suppressed the transcription level of SVA3D and inhibited SVA replication.

[0063] In order to study the effect of knocking out RSAD1 on the level of SVA virus protein, RSAD1-KO and control group PK-15 cells (WT) were plated in 6-well plates, and infected with SVA 12 hours later. Cell samples were collected at 0, 4, 8, and 12 hours, and the cells were lysed with 2×SDS loading buffer and boiled at 95°C for 10 minutes. The protein samples were subjected to SDS-PAGE electrophoresis (concentrating gel, constant voltage 80V, 30 minutes; separation gel, constant voltage 120V, time depends on actual situation), and then the protein was transferred to the NC membrane by wet transfer method, and the condition was 100V constant voltage transfer in an ice bath for 1 hour. The NC membrane was blocked in 5% skim milk powder for 1 hour, incubated with primary antibody at room temperature for 2 hours, and then washed 3 times with TBST (TBS containing 0.1% Tween 20), 10 minutes each time. The secondary antibody was incubated at room temperature for 1 hour, and washed 4 times with TBST (TBS containing 0.1% Tween20), 10 minutes each time. Finally, the relative content of the target protein is detected using chemiluminescent substrates of different sensitivities (depending on the experimental requirements). Figure 6 As shown, in the samples collected after SVA infection, the expression of SVA structural protein VP2 in RSAD1-KO cell line was significantly lower than that in wild-type cells, indicating that RSAD1 gene-deficient monoclonal cell line can significantly inhibit the expression of SVA VP2 and inhibit the replication of SVA.

[0064] In addition, TCID 50 The experiment detected the difference in virus titer between RSAD1-KO and WT cells. SVA was used to infect the two types of cells, and cell samples were collected at different time points. After repeated freezing and thawing three times, the obtained cell samples were perfused with serum-free DMEM for 10 -2 ~10 -8 The virus was diluted in a gradient manner and inoculated into a monolayer of IBRS-2 cells in a 96-well cell culture plate with different gradient virus dilutions. Eight wells were inoculated at each dilution, and 100 μL was used in each well. The cells were cultured in a 37°C, 5% CO2 incubator and observed for 4 days. The cytopathic effect (CPE) was observed and recorded every 12 hours, and the TCID of the amplified virus was calculated according to the Reed-Muench method. 50 The results are as follows Figure 7 As shown in the figure, in the samples collected after SVA CH-FJ-2017 (GenBank: KY74510) was inoculated, the virus titer of SVA in the RSAD1-KO PK-15 cell line with RSAD1 gene knockout was significantly lower than that in wild-type cells, indicating that the RSAD1 gene-deficient monoclonal cell line can significantly inhibit the replication of SVA. The above experimental results show that the RSAD1 gene knockout cell line can significantly inhibit the replication of the Picornaviridae virus SVA and can be used as a drug target for inhibiting the replication of Picornaviridae viruses.

[0065] The above experimental results show that the RSAD1 gene knockout cell line can significantly inhibit the replication of the Picornaviridae virus SVA and can be used as a drug target for inhibiting the replication of Picornaviridae viruses.

[0066] Example 4 Construction of RSAD1 overexpressing PK-15 cell line

[0067] 1. Construction of Plasmid

[0068] According to the RSAD1 gene sequence, the upstream primer RSAD1-BamHI-F (5'-CCGGGATTTGGATCCATGGCGCTCCCCGGGGCTCGG-3', shown in SEQ ID NO.10) and the downstream primer RSAD1-NheI-R (5'-CTT GTAGTCGCTAGCTCCTCCTGGCACAGGGGAGGA-3', shown in SEQ ID NO.11) were designed.

[0069] RSAD1 gene fragment amplification: Take 1 μL of upstream and downstream primers and add high-fidelity polymerase MaxDNA Polymerase (Takara R045B) 1 μL, plasmid template 0.5 μL, ddH2O to 50 μL, the system was amplified according to the reaction program of 95℃3min, 95℃15s, 58℃15s, 72℃3min, 30 cycles, and 72℃10min, and the PCR product was recovered by gel;

[0070] Enzyme digestion of Plov vector: 1 μg of vector, 1 μL of endonuclease BamHI, 1 μL of NheI, 2 μL of 10× buffer, and 20 μL of ddH2O were added to the reaction system for digestion at 37℃ for 2 h, and the digested fragments were recovered by gel gel;

[0071] Homologous recombination of restriction vector and gene fragment: using homologous recombination kit ClonExpress IIOne StepCloning Kit (Novozyme C112-02), homologous recombination enzyme 1μL, 5× homologous recombination enzyme buffer 2μL, Plov vector restriction fragment 1μL, RSAD1 fragment 2μL, ddH2O 4μL, a total of 10μL system, 37℃ homologous recombination for 30min;

[0072] Transformation of Plov-RSAD1 homologous recombination products: The products were transformed into DH5α competent cells, plasmids were extracted, and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target gene sequence using MegAlign software, and the Plov-RSAD1 recombinant plasmid was successfully constructed.

[0073] 2. Cell Transfection

[0074] According to the standard transfection procedure of PEI, Plov-RSAD1 plasmid (10 μg) was co-transfected with two auxiliary vectors (LH1 (7.5 μg) and LH2 (5 μg)) into 293T cells. The supernatant was collected 36 hours after transfection, filtered through a 0.45 μm filter, polybrene (8 μg / mL) was added, and PK-15 cells were infected. Resistance screening was carried out using a culture medium containing 1 μg / mL puromycin and cultured for 3 generations. Finally, the PK-15 cell line pRSAD1 stably expressing RSAD1 was obtained.

[0075] Western blotting was used to detect the protein expression of RSAD1. Figure 8 As shown, overexpression of RSAD1 protein was detected in the RSAD1 overexpression cell line. The above results indicate that the RSAD1 gene overexpression PK-15 cell line was successfully constructed.

[0076] Example 5 Replication level of SVA in cells overexpressing RSAD1

[0077] The PK-15 cell line pRSAD1 stably expressing RSAD1 and the control group (Vector) PK-15 cells were plated in 6-well plates, and infected with SVA 12 hours later. The cells were collected at 0, 6, and 12 hours, and the total RNA of the cells was extracted by Trizol lysis method. Reverse transcription was performed using HiScript IIQ RT SuperMix (Novagen R222-01) reverse transcription kit, and qPCR was completed using Ch amQ Universal SYBR qPCR Master Mix (Novagen Q711-02) reagent. GAPDH was used as an internal reference gene to detect the transcription level of SVA 3D (the detection method is the same as in Example 3). The results are shown in Figure 3. Fig. 9 As shown, compared with the control group (Ve ctor) PK-15 cells, the PK-15 cell line pRSAD1 stably expressing RSAD1 can significantly promote the transcription level of SVA 3D and promote the replication of SVA.

[0078] Furthermore, the PK-15 cell line pRSAD1 stably expressing RSAD1 and the control group (Vector) PK-15 cells were plated in 6-well plates, and infected with SVA 12 hours later. Cell samples were collected at 0, 6, and 12 hours, and the cells were lysed with 2×SDS loading buffer and boiled at 95°C for 10 minutes. The protein samples were subjected to SDS-PAGE electrophoresis to detect the relative content of the target protein (the method is the same as in Example 3). The results are as follows: Fig.10 As shown, in the samples collected after SVA infection, the expression of SVA structural protein VP2 in the PK-15 cell line pRSAD1 that stably expresses RSAD1 was significantly higher than that in wild-type cells, indicating that overexpression of RSAD1 can promote the expression of SVA VP2 and promote the replication of SVA.

[0079] In addition, TCID 50 The experiment detected the difference in virus titer between RSAD1-KO and WT cells (the method is the same as in Example 3). Fig.11 As shown, in the samples collected after SVA CH-FJ-2017 (GenBank: KY74510) was inoculated, the viral titer of SVA in the PK-15 cell line pRSAD1 stably expressing RSAD1 was significantly higher than that in the control group cells, indicating that overexpression of RSAD1 can significantly promote the replication of SVA.

[0080] The above experimental results show that overexpression of RSAD1 protein in host cells can significantly promote the replication of Seneca virus, a Picornaviridae virus, and can be used as a production cell line for Seneca virus or vaccine, and used for the production of Seneca virus or vaccine. At the same time, RSAD1 protein can be used as a target for the screening of production enhancers for Seneca virus or vaccine, and RSAD1 protein or its expression promoter can be used as a production enhancer for Seneca virus or vaccine, and used to promote the production of Seneca virus or vaccine.

Claims

1. Use of RSAD1 gene / protein as a target in screening drugs for preventing or treating Picornaviridae virus infection, wherein the drug targets RSAD1 and inhibits the expression of RSAD1 gene / protein.

2. Use of RSAD1 gene / protein expression inhibitors in the preparation of drugs for preventing or treating Picornaviridae viral infections.

3. The use according to claim 2, characterized in that The RSAD1 gene / protein expression inhibitor includes a small interfering RNA designed with the RSAD1 gene / protein as a target, or a sgRNA targeted to knock out the RSAD1 gene / protein.

4. The use according to claim 3, characterized in that The targeting sequence of the sgRNA for targeted knockout of RSAD1 gene / protein is: TCTAGCCAGCCCCCGTACTG.

5. The use according to claim 4, characterized in that The sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R: sgRNA-F: 5'-CACCGTCTAGCCAGCCCCCGTACTG-3'; sgRNA-R: 5'-AAACCAGTACGGGGGCTGGCTAGAC-3'.

6. The use according to claim 1 or 2, characterized in that: The Picornaviridae virus is Seneca virus.

7. Use of RSAD1 gene / protein as a target in screening Picornaviridae viruses or vaccine production enhancers, wherein the drug targets RSAD1 and promotes the expression of RSAD1 gene / protein.

8. Use of RSAD1 protein or its expression promoter in the preparation of Picornaviridae virus or vaccine production enhancer.

9. Application of RSAD1 protein overexpressing cell line in the preparation of Picornaviridae virus or vaccine production cell line.

10. The use according to any one of claims 7 to 9, characterized in that: The Picornaviridae virus is Seneca virus.

Images