Application of reagent for inhibiting expression of long-chain non-coding RNA MIR4435-2HG in preparation of product for treating non-alcoholic fatty liver disease

Abstract

The invention relates to the field of gene engineering, in particular to application of a reagent for inhibiting expression of long-chain non-coding RNA MIR4435-2HG in hepatocytes in a product for treating non-alcoholic fatty disease. According to the application disclosed by the invention, the expression quantity of the lncRNA MIR4435-2HG is reduced by knocking down the mouse hepatocyte lncRNA MIR4435-2HG in a targeted manner through an expression vector, so that the fatty degeneration of the hepatocyte of a non-alcoholic fatty liver disease animal model can be effectively relieved, the contents of total cholesterol and triglyceride in blood are remarkably reduced, and the expression steady state of a lipid metabolism regulation key gene is maintained. The expression vector knocks down the human hepatocyte lncRNA MIR4435-2HG, so that the expression quantity of the lncRNA MIR4435-2HG is reduced, the human hepatocyte lipid accumulation caused by palmitic acid stimulation can be effectively relieved, and the lipid metabolism regulation key gene expression steady state is maintained.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to the use of a reagent for inhibiting the expression of lncRNA MIR4435-2HG in hepatocytes in the preparation of a product for treating non-alcoholic fatty liver disease. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases in the world. Its main clinical feature is the accumulation of lipids in the liver caused by metabolic disorders. It is closely related to metabolic syndromes such as obesity, insulin resistance, and diabetes, and is the manifestation of metabolic syndrome in the liver. Simple fatty liver may further develop into non-alcoholic steatohepatitis (NASH), liver fibrosis, and eventually turn into cirrhosis or even liver cancer.

[0003] At present, lifestyle intervention is still the main method for treating NAFLD, including improving diet structure, increasing exercise, etc. There is no specific drug for NAFLD. Therefore, the research and development of drugs for treating NAFLD has important clinical value and potential economic benefits.

[0004] Chinese patent document CN113262304A discloses the use of miR-4435-2HG and / or GDAP1 gene inhibitors in the preparation of drugs for treating AML. The present invention first discovered that downregulating the expression of miR-4435-2HG and / or GDAP1 can significantly inhibit the proliferation of AML tumor cells and effectively promote the apoptosis of AML tumor cells. However, there is no report on the use of agents that inhibit the expression of lncRNA MIR4435-2HG in hepatocytes in the preparation of products for treating non-alcoholic fatty liver disease. Summary of the invention

[0005] The purpose of the present invention is to solve one of the technical problems existing in the prior art and to provide an agent for inhibiting the expression of long non-coding RNA MIR4435-2HG (lncRNA MIR4435-2HG) in hepatocytes for use in the preparation of a product for the treatment of non-alcoholic fatty liver disease.

[0006] In a first aspect of the present invention, there is provided a use of an agent for inhibiting the expression and / or activity of lncRNA MIR4435-2HG in hepatocytes in the preparation of a product having at least one of the following functions:

[0007] (1) Prevention and / or treatment of non-alcoholic fatty liver disease;

[0008] (2) Prevent and / or treat liver lipid metabolism disorders;

[0009] (3) prevent and / or treat insulin resistance;

[0010] (4) Reduce lipid accumulation in hepatocytes;

[0011] (5) Reduce the activities of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase in serum;

[0012] (6) Reduce total cholesterol levels in serum;

[0013] (7) Reduce the level of triglycerides in serum.

[0014] The main cause of NALFD is excessive lipid accumulation in the liver. Therefore, the NAFLD animal model obtained by high-fat diet feeding and the palmitic acid-induced cell model have good consistency with NAFLD patients. The present invention found in the experiment that targeted knockdown of lncRNA MIR4435-2HG in mouse hepatocytes and reducing the expression of lncRNA MIR4435-2HG can effectively improve the ballooning degeneration of hepatocytes in the NAFLD mouse model, significantly reduce hepatocyte lipid accumulation, reduce serum alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase activity, reduce serum total cholesterol content, reduce serum triglyceride content, and maintain the steady state of expression of key genes regulating lipid metabolism. Knocking down lncRNA MIR4435-2HG in human liver cell lines and reducing the expression of lncRNA MIR4435-2HG can effectively reduce lipid accumulation in cells.

[0015] Furthermore, the lipid metabolism disorder is lipid metabolism disorder caused by non-alcoholic fatty liver disease.

[0016] Furthermore, the insulin resistance is insulin resistance caused by non-alcoholic fatty liver disease.

[0017] Furthermore, the agent for inhibiting the expression and / or activity of lncRNA MIR4435-2HG in hepatocytes is:

[0018] (a) miRNA;

[0019] (b) interfering RNA, or an expression vector of the interfering RNA;

[0020] (c) antisense oligonucleotides;

[0021] (d) blocking agents;

[0022] (e) Gene editing systems;

[0023] (f) Small molecule compounds.

[0024] Furthermore, the agent for inhibiting the expression and / or activity of lncRNA MIR4435-2HG in hepatocytes may be an adeno-associated virus vector or other expression vector capable of transducing the shRNA of lncRNA MIR4435-2HG into host hepatocytes, and may also be other agents such as antibodies capable of specifically binding to lncRNA MIR4435-2HG and causing it to lose its specific activity; miRNA that causes decreased expression of lncRNA MIR4435-2HG by inhibiting transcription and silencing the lncRNA MIR4435-2HG encoding gene; antisense oligonucleotides that inhibit the expression of the lncRNA MIR4435-2HG encoding gene; CRISPR editing system that can specifically knock out the lncRNA MIR4435-2HG encoding gene, etc.

[0025] Furthermore, the expression vector is any one of a plasmid vector and a viral vector.

[0026] Furthermore, the expression vector is an adeno-associated virus vector. The use of an adeno-associated virus vector for interfering RNA has a high safety.

[0027] In a preferred embodiment of the present invention, the adeno-associated virus vector is AAV8. AAV8 has high affinity and specificity and can stably express interfering RNA in hepatocytes.

[0028] Furthermore, the interfering RNA is any one of siRNA and shRNA. siRNA is transiently expressed in hepatocytes, while shRNA can be integrated into the host's hepatocytes by expression vectors such as viruses to achieve stable expression, making the inhibitory effect more lasting.

[0029] In a preferred embodiment of the present invention, the nucleotide sequence of the shRNA is shown in SEQ ID No.1 or SEQ ID No.2:

[0030] GGUCUGGUCGGUUUCCCAUUU(SEQ ID No.1)

[0031] AAAUGGGAAAACCGACCAGACC (SEQ ID No. 2).

[0032] In a preferred embodiment of the present invention, the nucleotide sequence of the siRNA is as shown in SEQ ID No.3 or SEQ ID No.4:

[0033] GCAGAAGACAAAGCCGAAUGC(SEQ ID No.3)

[0034] GCAUUCGGCUUUGUCUUCUGC (SEQ ID No. 4).

[0035] The second aspect of the present invention provides the use of lncRNA MIR4435-2HG as a target in screening drugs for preventing and / or treating non-alcoholic fatty liver disease.

[0036] The present invention found in the experimental process that after the targeted knockdown of lncRNA MIR4435-2HG in mouse liver cells and the decrease in the expression of lncRNA MIR4435-2HG, the ballooning lesions and lipid accumulation of mouse liver cells induced by a high-fat diet can be improved, the activities of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase in the blood can be reduced, and the total cholesterol and triglyceride levels in the blood can be significantly reduced, maintaining the steady state of expression of key genes regulating lipid metabolism. At the same time, knocking down lncRNA MIR4435-2HG in human liver cell lines and reducing the expression of lncRNA MIR4435-2HG can effectively reduce lipid accumulation in cells. Therefore, lncRNA MIR4435-2HG or the gene encoding lncRNA MIR4435-2HG can be used as a target for drug screening for the prevention and / or treatment of non-alcoholic fatty liver disease.

[0037] The third aspect of the present invention provides a drug screening method for preventing and / or treating non-alcoholic fatty liver disease, the screening method comprising the following steps: detecting changes in the expression level and / or activity of lncRNA MIR4435-2HG in the subject before and after drug administration.

[0038] The present invention found in the experimental process that the targeted knockdown of lncRNA MIR4435-2HG in mouse liver cells can significantly improve the ballooning lesions and lipid accumulation of mouse liver cells caused by high-fat diet feeding, reduce the activity of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase in the blood, significantly reduce the total cholesterol and triglyceride levels in the blood, and maintain the steady state of expression of key genes regulating lipid metabolism. At the same time, knocking down lncRNA MIR4435-2HG in human liver cell lines and reducing the expression of lncRNA MIR4435-2HG can effectively reduce lipid accumulation in cells. Therefore, drug screening can be carried out based on whether the candidate compound has an inhibitory effect on the expression and / or activity of lncRNA MIR4435-2HG and the strength of the inhibitory effect.

[0039] A fourth aspect of the present invention provides use of a reagent for detecting the expression level of lncRNA MIR4435-2HG in preparing a kit for diagnosis and / or prognosis of non-alcoholic fatty liver disease.

[0040] The present invention found in the experimental process that the expression of lncRNA MIR4435-2HG in the liver tissue of patients with non-alcoholic fatty liver disease and in the liver tissue of non-alcoholic fatty liver disease model mice was significantly increased. Targeted knockdown of lncRNA MIR4435-2HG in mouse hepatocytes and reduction of the expression of lncRNA MIR4435-2HG can effectively alleviate the ballooning lesions and lipid accumulation of mouse hepatocytes caused by high-fat diet feeding, reduce the activity of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase in the blood, and significantly reduce the total cholesterol and triglyceride levels in the blood. At the same time, knocking down lncRNA MIR4435-2HG in human liver cell lines and reducing the expression of lncRNA MIR4435-2HG can effectively reduce lipid accumulation in cells. It can be seen that the content of lncRNA MIR4435-2HG is closely related to non-alcoholic fatty liver disease, so the diagnosis and / or prognosis of non-alcoholic fatty liver disease can be achieved by detecting the expression level and / or activity of lncRNA MIR4435-2HG.

[0041] The beneficial effects and advantages of the present invention are:

[0042] 1. The present invention provides a new treatment plan for non-alcoholic fatty liver disease: The present invention finds that by using an expression vector to knock down lncRNA MIR4435-2HG in mouse liver cells, the expression level of lncRNA MIR4435-2HG is reduced, which can effectively alleviate the fatty degeneration of liver cells in the above-mentioned animal model of non-alcoholic fatty liver disease, significantly reduce the levels of total cholesterol and triglycerides in the blood, and maintain the steady state of expression of key genes regulating lipid metabolism. By using an expression vector to knock down lncRNA MIR4435-2HG in human liver cells, the expression level of lncRNA MIR4435-2HG is reduced, which can effectively alleviate the lipid accumulation in human liver cells caused by palmitic acid stimulation and maintain the steady state of expression of key genes regulating lipid metabolism.

[0043] 2. The present invention provides a new solution for the early diagnosis of non-alcoholic fatty liver disease: The present invention found that the expression of lncRNAMIR4435-2HG in the liver of NAFLD model mice was significantly higher than that in normal mice; at the same time, the expression of lncRNAMIR4435-2HG in the liver of NAFLD patients was significantly higher than that in normal people, indicating that non-alcoholic fatty liver disease can be diagnosed early by detecting the expression level of lncRNAMIR4435-2HG. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The comparison results of liver weight and liver weight to body weight ratio of mice in the high-fat diet-fed NC-shAAV group and the MIR4435-2HG-shAAV group of Example 1 are shown.

[0045] Figure 2 yes Figure 1 The results of comparing the activities of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) in the serum of two groups of mice in the shown example.

[0046] Figure 3 yes Figure 1 The results of comparing the total cholesterol and triglyceride levels in the serum of two groups of mice in the shown example.

[0047] Figure 4 yes Figure 1 The comparison results of HE staining and Oil Red O staining of liver of two groups of mice in the shown example.

[0048] Figure 5 yes Figure 1 The comparative results of the expression of key genes regulating lipid metabolism in the liver of two groups of mice in the shown example.

[0049] Figure 6 yes Figure 1 The examples shown are comparison results of insulin tolerance and glucose tolerance of two groups of mice.

[0050] Figure 7 This is the comparison result of Oil Red O staining of the human hepatocyte cell line THLE-2 in the palmitic acid-stimulated si-NC group and the si-MIR4435-2HG group in Example 3.

[0051] Figure 8 The comparison results of the expression of lncRNA MIR4435-2HG in Example 4 in the liver tissue of patients with non-alcoholic fatty liver disease (NAFLD) and normal human liver tissue (A), and the comparison results of the expression results in the liver tissue of mice with non-alcoholic fatty liver disease model (HFD) and normal mouse liver tissue (B). DETAILED DESCRIPTION

[0052] The specific implementation methods provided by the present invention are described in detail below in conjunction with examples.

[0053] Example 1: Effect of targeted knockdown of lncRNA MIR4435-2HG in mouse hepatocytes on lipid metabolism disorders induced by a high-fat diet

[0054] According to the mouse lncRNA MIR4435-2HG gene sequence (NCBI accession No.100043424) and RNAi principles, shRNA was constructed and inserted into the AAV8 adeno-associated virus expression vector, and mouse hepatocytes were transduced to obtain AAV8-mediated liver lncRNA MIR4435-2HG knockdown mice (MIR4435-2HG-shAAV group). At the same time, a corresponding empty vector control group (NC-shAAV group) was set up.

[0055] The sequence of the shRNA is as follows:

[0056] GGUCUGGUCGGUUUCCCAUUU(SEQ ID No.1)

[0057] AAAUGGGAAAACCGACCAGACC (SEQ ID No. 2).

[0058] Six mice in each of the AAV-shnc group and AAV-sh MIR4435-2HG group were fed with a high-fat diet for twelve weeks and weighed every two weeks. After twelve weeks, serum samples were taken from the mice for the detection of total cholesterol level, triglyceride level, alanine aminotransferase activity, aspartate aminotransferase activity, and alkaline phosphatase activity; the mice were killed, and the liver tissues were obtained and weighed. Some of the liver tissues were paraffin-embedded and HE-stained, and some of the liver tissues were frozen-embedded and Oil Red O-stained. RNA from some liver tissues was extracted for qPCR detection.

[0059] The results are as follows Figure 1-4 shown. Figure 1 Comparison of liver weight and liver weight to body weight ratio between the two groups of mice. Figure 2 Comparison of serum alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase activities between the two groups of mice. Figure 3 Comparison of serum total cholesterol and triglyceride levels between the two groups of mice. Figure 4 Comparison of the results of HE staining and Oil Red O staining of the livers of the two groups of mice. Figure 5 Comparison of the expression of key genes regulating lipid metabolism in liver tissues of two groups of mice. Figure 1-5The results showed that after high-fat diet feeding, the liver weight of mice in the NC-shAAV group increased significantly, the serum alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase enzyme activities were higher, the serum triglyceride and total cholesterol levels were higher, and a large amount of lipid accumulation and balloon-like lesions appeared in the hepatocytes, and the expression of key genes regulating lipid metabolism increased abnormally, indicating that high-fat diet feeding caused obvious lipid metabolism disorders in mice. On the contrary, the liver weight of mice in the MIR4435-2HG-shAAV group was significantly lower than that of mice in the control group, the serum alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase enzyme activities were significantly decreased, the serum triglyceride and total cholesterol levels were significantly decreased, the lipid accumulation in hepatocytes was reduced, the hepatocyte balloon-like lesions were improved, and the expression of key genes regulating lipid metabolism decreased and restored to homeostasis. The above research results show that targeted knockdown of lncRNA MIR4435-2HG in hepatocytes can effectively improve the liver lipid metabolism disorders induced by high-fat diet.

[0060] Example 2: Effect of targeted knockdown of lncRNA MIR4435-2HG in mouse hepatocytes on high-fat diet-induced insulin resistance

[0061] Glucose tolerance test (GTT): Six mice from the NC-shAAV group and six mice from the MIR4435-2HG-shAAV group that had been fed a high-fat diet for twelve weeks were fasted for 16 hours but not water. Then, 2 g / kg of mouse body weight was injected intraperitoneally with glucose, and blood was collected at 0 min, 15 min, 30 min, 45 min, 60 min, 90 min, and 120 min, and the blood glucose concentration was measured with a blood glucose test strip.

[0062] Insulin tolerance test (ITT): Six mice from the NC-shAAV group and six mice from the MIR4435-2HG-shAAV group, which had been fed a high-fat diet for twelve weeks, were fasted for 16 hours but not water. Then, 1 unit / kg of mouse body weight was injected intraperitoneally with insulin, and blood was collected at 0 min, 15 min, 30 min, 45 min, 60 min, 90 min, and 120 min, and blood glucose concentration was measured with blood glucose test strips.

[0063] The results are as follows Figure 6 shown. Figure 6 The results of glucose tolerance and insulin tolerance tests were compared between the two groups of mice. Figure 6 The results showed that hepatocyte-specific knockdown of lncRNA MIR4435-2HG can improve the mice's ability to process blood sugar and enhance their insulin sensitivity. The above research results show that knocking down hepatocyte lncRNA MIR4435-2HG can effectively alleviate insulin resistance caused by a high-fat diet.

[0064] Example 3: Effect of knocking down lncRNA MIR4435-2HG expression in human liver THLE-2 cells on intracellular lipid accumulation

[0065] According to the human lncRNA MIR4435-2HG gene sequence and RNAi principle, siRNA was constructed and transfected into human liver THLE-2 cells using liposome transfection reagent to obtain lncRNA MIR4435-2HG knockdown expression THLE-2 cells (si-MIR4435-2HG), and a control group (nc group) was set up. The cells were stimulated with palmitic acid for 24 hours and fixed with paraformaldehyde and then stained with Oil Red O.

[0066] The sequence of siRNA is as follows:

[0067] GCAGAAGACAAAGCCGAAUGC(SEQ ID No.3)

[0068] GCAUUCGGCUUUGUCUUCUGC (SEQ ID No. 4).

[0069] The results are as follows Figure 7 shown. Figure 7 Compared with the control group cells, lipid accumulation in the lncRNA MIR4435-2HG knockdown group cells was significantly reduced. The above results indicate that lncRNA MIR4435-2HG knockdown can alleviate palmitic acid-induced fat accumulation and the disorder of key gene expression in lipid metabolism regulation.

[0070] Example 4: Expression of LncRNA MIR4435-2HG in liver tissues of patients with non-alcoholic fatty liver disease and mice with non-alcoholic fatty liver disease model

[0071] Six liver tissue samples from patients with nonalcoholic fatty liver disease and six liver tissue samples from normal humans were collected, and six liver tissue samples from mice with nonalcoholic fatty liver disease model and six liver tissue samples from normal mice were collected. Tissue RNA was extracted with Trizol, and the relative expression level of lncRNA MIR4435-2HG was detected by qPCR.

[0072] The results are as follows Figure 8 As shown in the figure, compared with normal people, the expression of lncRNAMIR4435-2HG in the liver tissue of patients with non-alcoholic fatty liver disease was significantly increased; compared with normal mice, the expression of lncRNAMIR4435-2HG in the liver tissue of non-alcoholic fatty liver disease model mice was significantly increased.

[0073] Based on the above results, it can be seen that the expression of lncRNAMIR4435-2HG in the liver of patients with non-alcoholic fatty liver disease and in the liver tissue of non-alcoholic fatty liver disease model mice is significantly increased. Using AAV8 as a vector to carry lncRNAMIR4435-2HG shRNA to knock down lncRNAMIR4435-2HG in mouse hepatocytes can alleviate lipid metabolism disorders and insulin resistance induced by high-fat diet feeding. Interfering with the expression of lncRNAMIR4435-2HG in human hepatocytes THLE-2 with siRNA can also reduce lipid accumulation caused by palmitic acid stimulation. The above results indicate that the expression and / or activity of hepatocyte lncRNA MIR4435-2HG can be inhibited by specific preparations to achieve the purpose of preventing and / or treating NAFLD. Among them, these preparations can be the adeno-associated virus vector or other expression vector in the above embodiment that can transduce the shRNA of lncRNA MIR4435-2HG into the host liver cells, and can also be other such as antibodies that can specifically bind to lncRNA MIR4435-2HG and make it lose its specific activity; miRNA that inhibits transcription and silences the lncRNA MIR4435-2HG encoding gene, thereby causing the expression of lncRNA MIR4435-2HG; antisense oligonucleotides that inhibit the expression of lncRNA MIR4435-2HG encoding gene; CRISPR editing system that can specifically knock out the lncRNA MIR4435-2HG encoding gene, etc.

[0074] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. Use of an agent for inhibiting the expression and / or activity of lncRNA MIR4435-2HG in hepatocytes in the preparation of a product having at least one of the following functions: (1) Prevention and / or treatment of non-alcoholic fatty liver disease; (2) Prevent and / or treat liver lipid metabolism disorders; (3) prevention and / or treatment of insulin resistance; (4) Reduce lipid accumulation in hepatocytes; (5) Reduce the activities of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase in serum; (6) Reduce total cholesterol levels in serum; (7) Reduce the level of triglycerides in serum.

2. The use according to claim 1, characterized in that: The lipid metabolism disorder is lipid metabolism disorder caused by non-alcoholic fatty liver disease.

3. The use according to claim 1, characterized in that: The insulin resistance is insulin resistance caused by non-alcoholic fatty liver disease.

4. The use according to claim 1, characterized in that: The reagent for inhibiting the expression and / or activity of lncRNA MIR4435-2HG in hepatocytes is: (a) miRNA; (b) interfering RNA, or an expression vector of the interfering RNA; (c) antisense oligonucleotides; (d) blocking agents; (e) Gene editing systems; (f) Small molecule compounds.

5. The use according to claim 4, characterized in that: The expression vector is any one of a plasmid vector and a viral vector.

6. The use according to claim 4, characterized in that: The interfering RNA is any one of siRNA and shRNA.

7. The use according to claim 6, characterized in that: The nucleotide sequence of the shRNA is shown as SEQ ID No.1 or SEQ ID No.

2.

8. The use according to claim 6, characterized in that: The nucleotide sequence of the siRNA is shown as SEQ ID No.3 or SEQ ID No.

4.

9. Application of lncRNA MIR4435-2HG as a target in screening drugs for preventing and / or treating non-alcoholic fatty liver disease.

10. Use of a reagent for detecting the expression level of lncRNA MIR4435-2HG in the preparation of a kit for diagnosis and / or prognosis of non-alcoholic fatty liver disease.

Images