A composite microbial agent and its application in preparing white sour soup

Abstract

The present invention belongs to the technical field of microbial fermentation, and particularly relates to a composite microbial agent and its application in preparing white sour soup. The present invention uses a composite microbial agent prepared by newly screened Lactobacillus paracasei MY6 and Pichia pastoris PY4 to ferment glutinous rice homogenate to produce white sour soup with high acidity and low nitrite content. Compared with naturally fermented sour soup, the fermentation cycle prepared by the preparation method of the present invention is short, and the prepared white sour soup has a higher titratable acid content, a lower pH and a lower nitrite content, which not only shortens the fermentation cycle of rapid acidification of white sour soup, but also reduces the nitrite in the white sour soup, thereby improving the safety of the product.

Description

Technical Field

[0001] The invention belongs to the field of microbial fermentation, and particularly relates to a composite microbial agent and application thereof in the preparation of white sour soup. Background Art

[0002] Miao white sour soup is a traditional fermented food with a long history, widely distributed in southwest China, especially in the Miao ethnic group settlements in Guizhou Province. Sour soup is not only an important part of the daily diet of local residents, but also regarded as a traditional delicacy with unique flavor and health functions. The traditional preparation of sour soup relies on the natural fermentation process, mainly through the synergistic action of various microorganisms such as lactic acid bacteria and yeast, and complex biochemical transformation in a low pH environment, thus forming its unique sour taste, aroma and nutritional value.

[0003] However, the traditional natural fermentation process is greatly affected by environmental conditions, which can easily lead to unstable fermentation effects, thus affecting the quality and flavor consistency of sour soup. The diversity of microbial flora and its dynamic changes are crucial to the fermentation process of sour soup and the quality of the final product. However, since the source of microorganisms in natural fermentation is uncontrollable, it may cause problems such as fermentation failure, insufficient acidity, or microbial contamination. In addition, certain harmful substances in natural fermentation, such as the production of nitrite, may also pose a potential threat to food safety.

[0004] In recent years, with the development of the food industry and the advancement of fermentation technology, microbial research on the fermentation process of sour soup has gradually deepened. By screening and adding functional microbial agents, the efficiency of sour soup fermentation can be effectively improved, and key indicators in the fermentation process, such as acidity, flavor and safety, can be controlled, thereby improving the consistency and quality stability of the product. The application of composite microbial agents can not only ensure the traditional flavor and nutritional components of sour soup, but also significantly shorten the fermentation time, optimize the fermentation process, and promote the industrial production and large-scale development of sour soup.

[0005] Therefore, developing a composite microbial agent suitable for Miao sour soup fermentation can not only enhance the fermentation effect and maintain the traditional flavor, but also improve the safety of the product, which has important application prospects and industrial value. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention aims to propose a composite microbial agent and its application in the preparation of white sour soup. By screening and adding functional microbial agents in a targeted manner during sour soup fermentation, the problems of long fermentation cycle, insufficient acidity and high nitrite content in traditional sour soup are solved.

[0007] To achieve the above object, on the one hand, the present invention provides a Lactobacillus paracasei, wherein the Lactobacillus paracasei is Lactobacillus paracasei MY6, which is classified and named as Lactobacillus paracaseiLactobacillus paracasei , and was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on October 30, 2024. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO. 32409.

[0008] In a second aspect, the present invention provides a Pichia pastoris, wherein the Pichia pastoris is Pichia pastoris PY4, which is classified and named Pichia pseudolambica , and was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on October 30, 2024. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.32410.

[0009] In a third aspect, the present invention provides a probiotic composition, comprising the Lactobacillus paracasei described in the first aspect and the Pichia pastoris described in the second aspect.

[0010] Furthermore, the ratio of the number of live bacteria in the Lactobacillus paracasei culture to that in the Pichia pastoris culture is 1-3:1-3.

[0011] Furthermore, the probiotic composition also includes a food-acceptable carrier, auxiliary material or additive.

[0012] Furthermore, the viable counts of Lactobacillus paracasei and Pichia pastoris in the probiotic composition are not less than 1×10 8 CFU / mL.

[0013] In a fourth aspect, the present invention provides a composite microbial agent, wherein the agent comprises the probiotic composition or a fermentation product thereof as described in the third aspect.

[0014] Furthermore, the ratio of the number of live bacteria in the Lactobacillus paracasei culture to that in the Pichia pastoris culture is 1-3:1-3.

[0015] Furthermore, the preparation method of the composite microbial agent includes: activating and subculturing Lactobacillus paracasei in MRS medium, activating and subculturing Pichia pastoris in PDB medium, and the viable counts of both bacteria reach 1×10 8 When the CFU / mL is above, collect the bacteria by centrifugation, dissolve them in sterile water and mix them in a volume ratio of 1~3:1~3.

[0016] In a fifth aspect, the present invention provides use of the probiotic composition or the bacterial agent described in the fourth aspect in the preparation of white sour soup.

[0017] Furthermore, the application is at least one of the following:

[0018] (1) Application in increasing the titratable acid content of white sour soup;

[0019] (2) Application in lowering the pH value of white sour soup;

[0020] (3) Application in reducing the nitrite content in white sour soup.

[0021] In a sixth aspect, the present invention provides a method for preparing high-acidity, low-nitrite white sour soup, the preparation method comprising the following steps:

[0022] S1. Pre-treating glutinous rice to obtain glutinous rice pulp;

[0023] S2. The Lactobacillus paracasei described in the first aspect is cultured in MRS medium until the viable count reaches 1×10 8 CFU / mL or more; and culturing the Pichia yeast described in the second aspect in PDA, and the number of viable bacteria reaches 1×10 8 CFU / mL or more; mixing the Lactobacillus paracasei culture and the Pichia pastoris culture to prepare a composite microbial agent;

[0024] S3. adding the composite microbial agent obtained in step S2 to the glutinous rice pulp obtained in step S1 for fermentation, and obtaining a high-acidity, low-nitrite white sour soup after post-ripening.

[0025] Furthermore, the pretreatment in step S1 is to wash, soak and beat the glutinous rice.

[0026] Furthermore, the pretreatment in step S1 specifically includes: selecting glutinous rice with uniform texture, free of insect pests and harmful microorganisms; after cleaning, soaking it in pure water for 12 hours to achieve the purpose of rapid maturation of the material in the subsequent steps; continuing to add pure water for pulping, boiling for 15-20 seconds and then cooling for standby use to obtain glutinous rice pulp.

[0027] In a specific embodiment of the present invention, the ratio of glutinous rice weight to pure water volume is 250g:1L.

[0028] Furthermore, in step 2, the volume ratio of the Lactobacillus paracasei culture to the Pichia pastoris culture is 1-3:1-3.

[0029] Furthermore, in step S3, the inoculation amount of the composite microbial agent is 4-8% by volume.

[0030] Furthermore, in step S3, the fermentation and post-ripening steps specifically include: in a sterile environment, aseptically filling the glutinous rice pulp into a sterile fermentation tank, adding a composite microbial agent at 5% (by volume), placing it in a 25-35°C incubator, and fermenting it for 96-216 hours. After the fermentation is completed, placing it in a 0-10°C low-temperature refrigerator and post-ripening it for 12-72 hours.

[0031] In a specific embodiment of the present invention, the culture temperature is 28-32°C, the fermentation is 120-168 h, the low-temperature ripening temperature is 2-6°C, and the ripening is 24-48 h.

[0032] In a seventh aspect, the present invention provides white sour soup prepared by the preparation method described in the sixth aspect, wherein the acidity of the white sour soup is higher than 8.50 mg / g and the nitrite content is lower than 10 mg / kg by weight.

[0033] Compared with the prior art, the present invention has the following advantages:

[0034] (1) The present invention screened and obtained two probiotic strains capable of increasing the titratable acid content of Miaojia Baisuantang. The two strains were identified as Lactobacillus paracasei (named MY6) and Pichia pastoris (named PX4).

[0035] (2) The present invention provides a method for preparing high-acid Miao white sour soup using a composite microbial agent made from MY6 and PX4. The composite microbial agent has excellent fermentation performance, which not only shortens the fermentation cycle of rapid acidification of white sour soup, but also improves the consistency and quality stability of the product.

[0036] (3) Compared with naturally fermented sour soup, the white sour soup prepared by the preparation method of the present invention has a higher titratable acid content (increased by 31.46%), a lower pH and a lower nitrite content (reduced by 50.22%), which not only reduces the nitrite in the white sour soup, but also improves the safety of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 To screen 26 lactic acid bacteria strains for the superior fermentation of Miaojia Baisuantang;

[0038] Figure 2 To screen 13 yeast strains for the superior fermentation of Miaojia Baisuantang;

[0039] Figure 3 The colony morphology of Lactobacillus paracasei MY6 and Pichia pastoris PY4 is shown in Figure 1, where A is Lactobacillus paracasei MY6 and B is Pichia pastoris PY4;

[0040] Figure 4This is the molecular evolutionary tree of the isolated Lactobacillus paracasei MY6 and Pichia pastoris PY4, where A is Lactobacillus paracasei MY6 and B is Pichia pastoris PY4;

[0041] Figure 5 The results are the comparison of the physical and chemical properties of Miaojia white sour soup fermented by compound microbial agents (H) and naturally fermented (NK) and unfermented (CK), where A is titratable acid and pH, B is nitrite content, and C is total sugar and reducing sugar content;

[0042] Figure 6 The electronic sensory comparison results of Miaojia white sour soup fermented with compound microbial agents and naturally fermented and unfermented white sour soup, where A is the electronic eye, B is the electronic nose, and C is the electronic tongue;

[0043] Figure 7 This is the volatile organic compounds of Miaojia white sour soup fermented with composite microbial agents and naturally fermented and unfermented white sour soup, where A is the flavor free amino acid and B is the comparison result. DETAILED DESCRIPTION

[0044] The following is a further description of the concept of the present invention and the technical effects produced in conjunction with specific embodiments, so as to fully understand the purpose, features and effects of the present invention. The methods are conventional methods unless otherwise specified. The materials can be obtained from public commercial channels unless otherwise specified. The illustrative embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations of the present invention. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0045] In the following examples, Lactobacillus paracasei and Pichia pastoris were derived from naturally fermented Miaojia Baisuantang, and the isolated strains were deposited in the General Microbiological Center of China National Committee for the Preservation and Administration of Microbiological Cultures. The chemical reagents used were purchased from regular chemical reagent suppliers and were analytically pure.

[0046] Example 1 Bacterial separation and purification

[0047] The collected naturally fermented Miaojia Baisuantang products were diluted 10 times in a clean bench with sterile saline, and 0.1 mL of the bacterial solution with appropriate dilution multiples was evenly coated on MRS solid culture medium and PDA culture medium, and placed in a 30°C incubator for constant temperature culture for 12-48 h. Then, the culture base was taken out and a single colony with a diameter of 1-2 mm and a smooth surface was picked under a sterile environment, and inoculated onto a new MRS solid culture medium and PDA culture medium by streaking method, and repeated many times until pure colonies were isolated and purified. The screened microorganisms were diluted in a gradient with sterile saline and cultured at 30°C for 24 hours using MRS solid culture medium and PDA culture medium. Then, according to the size, color, gloss, and transparency of the colony, a single colony with a smooth surface and milky white color was picked, and the strain was purified by streaking on MRS solid plates and PDA plates for 2-3 times, and then stored in a refrigerator at 4°C.

[0048] Example 2 Screening of dominant strains for fermentation of high-acid Miao white sour soup

[0049] Select 250g of glutinous rice, wash it with running water, soak it in 1L of pure water for about 12h, homogenize it, boil it (about 10-20s), take 300g of it and pack it into a 500mL fermentation tank, cool it for later use. Sterilize the 250mL conical flask at 105℃ for 20min.

[0050] The activated 26 lactic acid bacteria were inoculated into the sterilized MRS liquid medium in the clean bench for 3-4 subcultures. When the number of viable bacteria reached 1×10 8 When the CFU / mL is above, prepare seed solution for later use.

[0051] The activated 13 yeast strains were inoculated into the sterilized PDB liquid medium in the clean bench for 3-4 subcultures. When the number of viable bacteria reached 1×10 8 When the CFU / mL is above, prepare seed solution for later use.

[0052] The seed liquid of 26 lactic acid bacteria and 13 yeast strains were inoculated into glutinous rice homogenate at an inoculation rate of 5% for fermentation. The fermentation conditions were: 30℃ constant temperature static culture for 120 h, and then transferred to a 4℃ low-temperature refrigerator for post-ripening for 48 h. During the fermentation and post-ripening period, the pH value and titratable acid content were measured every 24 h, for a total of 7 sample time points, namely 0, 24, 48, 72, 96, 120, 144, and 168 h. The suitable fermentation strains were selected by comparing the results of multiple index determinations.

[0053] Basic measurement indicators include:

[0054] pH value determination: using pH meter;

[0055] Determination of titratable acid content: Determined by titration with sodium hydroxide standard titration solution;

[0056] The data were processed and analyzed using OrginPro 21.0 drawing software.

[0057] Analysis of the test results: The titratable acid content of the fermentation broth of different strains is as follows: Figure 1-2 Among them, 0-120 h is the change trend of titratable acid content in 30℃ fermentation, and 120-168 h is the change trend of titratable acid content in 4℃ post-ripening. Figure 1 It can be seen that during the entire fermentation and ripening process, the titratable acid content increased rapidly in the first 72 hours, and the titratable acid content increased slowly or even stabilized from 72 hours to 120 hours. During the ripening process, the titratable acid content tended to be stable or slightly decreased.

[0058] Among the bacterial strains, MY6 showed the highest titratable acid content, reaching a peak of 9.3 at 168 h, becoming the strain with the strongest acid production ability in the bacterial group. Similarly, among the fungal strains, PY4 showed the highest titratable acid content, reaching a peak of 6.34 at 168 h.

[0059] Therefore, according to the above experimental results, it can be seen that Lactobacillus paracasei MY6 and Pichia pastoris PY4 have strong adaptability in the Miaojia white sour soup system, and the prepared Miaojia white sour soup is better than other strains. The above two strains were selected and deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration on October 30, 2024, and subsequent research was carried out.

[0060] The strain deposit information is as follows:

[0061] Lactobacillus paracasei is classified as Lactobacillus paracasei MY6 and named as Lactobacillus paracasei Lactobacillus paracasei , and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 30, 2024, with the deposit number CGMCC NO. 32409.

[0062] Pichia pastoris is named after the Pichia pastoris PY4 classification Pichia pseudolambica , and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 30, 2024, with the deposit number CGMCC NO.32410.

[0063] Example 3 Bacterial species identification

[0064] The isolated strains were systematically identified by phenotypic characteristics, 16SrDNA and ITS.

[0065] (1) The colony morphology of the isolated strains is as follows Figure 3As shown, the colony morphology of strain MY6 on MRS plates was milky white, with regular round edges and a smooth surface; the colony morphology of strain PY4 on PDA plates was milky white, with serrated edges and a wrinkled surface.

[0066] (2) The isolated MY6 was inoculated into MRS liquid medium for activation for 24 h, and 1 mL of bacterial liquid was taken into a 1.5 mL sterile centrifuge tube. The genome was extracted using Plant Zol (TransGen kit). The extracted genomic DNA was amplified using bacterial universal primers 27F (SEQ ID NO: 1 5′-AGAGT TTGAT CCTGG CTCAG-3′) and 1492R (SEQ ID NO: 2 5′-CTACG GCTAC CTTGT TACGA -3′). The PCR conditions were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 57°C annealing for 30 s, 72°C extension for 1.5 min, 25 cycles; 72°C extension for 7 min; 3% agarose gel electrophoresis detection, and then the amplified sample was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing.

[0067] Log in to the NCBI website, perform BLAST homology analysis and comparison between the MY6 16S (SEQ ID NO: 3) rDNA sequencing results and the PY4 ITS sequencing results and the relevant information in the website database, identify the strains and construct a phylogenetic tree. The results are as follows Figure 4 shown by Figure 4 It can be seen that MY6 is Lactobacillus paracasei and PY4 is Pichia pastoris.

[0068] Sequence information of MY6:

[0069]

[0070] Sequence information of PY4:

[0071] CCTCTCCCGTGAGAGGGGGGACCTGCGGAAGGATCATTACTGTGATTTAACATCTTCCACACGTGCGTGAGCGCAAGCAAAACACGAAAAAAACTGTAGTACGAGAGTCAAAACAAACCAAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAA CGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCCTTCTTGCTTGCGAGCAGAAATGGGGGGGCCCTGGCATTGGGGCCGCTCTGAAAAGAAACGTTGCGGGCGAAGCGAACTATGAGTAGGACGCTTGGCCGCCGAACTTAATACATAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAAGGCGGA (SEQ ID NO:4)

[0072] Example 4 Comparison of the quality of Miaojia sour soup fermented with composite microbial inoculants

[0073] Preparation of Miao sour soup:

[0074] Step 1. Select glutinous rice with uniform texture, free of insect pests and harmful microorganisms; after cleaning, add purified water according to the ratio of glutinous rice weight to purified water volume of 250g:1L to soak for 12 hours. Continue to add purified water to pulp, boil for 15-20 seconds, cool and set aside to obtain glutinous rice pulp.

[0075] Step 2. Prepare three groups of sour soup products, namely, a blank control group (CK), a natural fermentation group (NK), and a compound microbial fermentation group (H), respectively, as follows:

[0076] (1) Preparation process of blank control group (CK): The glutinous rice paste obtained in step 1 is the blank control group.

[0077] (2) Fermentation process of natural fermentation group (NK): Select glutinous rice with uniform texture, free of insect pests and harmful microorganisms; after cleaning, add pure water according to the ratio of glutinous rice weight to pure water volume of 250 g: 1L to soak for 12 hours. Continue to add pure water to beat the pulp, place it in a 30℃ incubator and ferment it for 120 hours. After fermentation is completed, place it in a 4℃ low-temperature refrigerator and ripen it for 48 hours to obtain white sour soup.

[0078] (3) Composite microbial agent fermentation group (H) Fermentation process: Lactobacillus paracasei MY6 was cultured in MRS medium until the viable cell count reached 1×10 8 CFU / mL or more; and culture Pichia pastoris PY4 in PDA, with the number of viable bacteria reaching 1×10 8 CFU / mL or more; mix the culture of Lactobacillus paracasei and the culture of Pichia pastoris to prepare a composite microbial agent. Add the prepared composite microbial agent to the glutinous rice paste prepared in step 1 at 5% (by volume), place it in a 30℃ incubator, and ferment it for 120 hours. After the fermentation is completed, place it in a 4℃ low-temperature refrigerator and ripen it for 48 hours to prepare white sour soup.

[0079] like Figure 5 As shown in A, the total acidity of the natural fermentation group (NK) reached 6.68 mg / g and the pH value was 3.01; the total acidity of the compound microbial inoculant fermentation group (H) was 8.78 mg / g and the pH value was 2.95. The total acidity of the NK group was significantly lower than that of the H group, which can be attributed to the rapid growth of MY6 and PY4 in the first seven days after inoculation and fermentation, resulting in the accumulation of lactic acid and other organic acids, which reduced the pH value. The above results indicate that microbial inoculation plays an important role in enhancing the fermentation characteristics and overall quality of Miaojia Baisuantang.

[0080] like Figure 5 As shown in Figure C, the total sugar (TS) of Miaojia Baisuantang decreased significantly, while the reducing sugar (RS) increased significantly after fermentation. The reducing sugar of the NK group reached 5.20 mg / g, while the total sugar was 193.09 mg / g; the reducing sugar of the H group was 8.83 mg / g, and the total sugar was 204.32 mg / g. These results indicate that the starch and other polysaccharides in Miaojia Baisuantang were not directly utilized by microorganisms, but through complex microbial interactions, oligosaccharides and polysaccharides were decomposed into reducing sugars, and some reducing sugars were further metabolized. Overall, total sugars were converted into reducing sugars during the fermentation process, which shows that microbial activity plays an important role in changing the carbohydrate composition of Miaojia Baisuantang.

[0081] like Figure 5As shown in B, the nitrite content of CK, NK and H groups was 11.82 mg / kg, 18.11 mg / kg and 9.01 mg / kg, respectively. The nitrite content of H group was significantly lower than that of CK and NK groups, thus improving the safety of Miaojia Baisuantang. The above results show that compared with natural fermentation, the composite microbial agent composed of MY6 and PY4 can effectively control the nitrite content in Baisuantang.

[0082] like Figure 6 The results are shown in the electronic sensory comparison of Miaojia white sour soup fermented with compound microbial agents and naturally fermented and unfermented white sour soup. In the color data collected by the electronic eye, L* represents lightness, a* represents green to red, and b* represents blue to yellow. △E=(L*2+a*2+b*2)1 / 2, and the smaller the value, the smaller the color change. From the electronic eye results ( Figure 6 A) It can be seen that there is no significant difference in the brightness of the three groups, but the ΔE of group H is smaller than that of CK, indicating that the color change of compound microbial fermentation is smaller than that of natural fermentation.

[0083] Volatile substance data collected by electronic eyes ( Figure 6 B) It can be seen that, in addition to color, aroma also plays a vital role in the overall sensory experience. The responses of W1W, W1S, and W5S sensors to VOCs in the three samples showed more obvious differences, indicating that fermentation had a significant impact on sulfides, terpenes, nitrogen oxides, methane, and aromatic compounds in WSS.

[0084] Flavor data collected by the electronic tongue ( Figure 6 C) It can be seen that the typical response signals of the seven working sensors include AHS as a sour sensor, PKS as a salty sensor, and NMS as an umami sensor, while the other sensors respond to various tastes. Each sensor provides a unique taste fingerprint for the WSS sample, indicating different levels of sensitivity to the presence of taste-related chemical elements. The sourness and umami of the H group are significantly higher than those of the NK and CK groups, while the saltiness is the lowest;

[0085] like Figure 7 The volatile organic compounds of Miaojia Baisuantang fermented with compound microbial agents and naturally fermented and unfermented Baisuantang are shown. Figure 7 A) shows that 35 VOCs were identified in the three groups of samples, including 11 alcohols, 9 esters, 6 aldehydes, 5 ketones, 2 acids, 1 furan, and 1 ether. Group H showed the highest concentration of key volatile compounds, including ethanol, ethylhexanoate, 2-propanone, 1-pentanol, 1-hydroxy-2-propanone, methanol, 1-hexanol, 1.8-eudesyl alcohol, 2-pentylfuran, 2-pentanone, and 1-hexanal; the free amino acid results ( Figure 7 B) It can be seen that the free amino acid content of group H was the highest, reaching 126.33 mg / kg, while that of group NK was the lowest, at 104.2 mg / kg. 17 flavor amino acids were detected in the three samples. Glutamic acid was the most abundant, accounting for 25.19%, 27.85% and 30.26% of the total free amino acids in groups CK, NK and H, respectively, indicating that group H exhibited obvious umami characteristics. The embodiments described above are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative labor are all within the scope of protection of the present invention.

Claims

1. A probiotic composition, characterized in that: The probiotic composition comprises Lactobacillus paracasei and Pichia pastoris; The Lactobacillus paracasei is Lactobacillus paracasei MY6, which is classified and named as Lactobacillus paracasei Lactobacillus paracasei , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 30, 2024, with the deposit number CGMCC NO. 32409; The Pichia pastoris is Pichia pastoris PY4, which is classified and named Pichia pseudolambica , and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 30, 2024, with the deposit number CGMCC NO.32410.

2. A composite microbial agent, characterized in that: The bacterial agent comprises the probiotic composition according to claim 1.

3. Use of the probiotic composition according to claim 1 or the bacterial agent according to claim 2 in the preparation of white sour soup.

4. The use according to claim 3, characterized in that: The application is at least one of the following: (1) Application in increasing the titratable acid content of white sour soup; (2) Application in lowering the pH value of white sour soup; (3) Application in reducing the nitrite content in white sour soup.

5. A method for preparing high-acidity, low-nitrite white sour soup, characterized in that: The preparation method comprises the following steps: S1. Pre-treating glutinous rice to obtain glutinous rice pulp; S2. Cultivate Lactobacillus paracasei in MRS medium until the viable count reaches 1×10 8 CFU / mL or more; and culture Pichia pastoris in PDA, with the number of viable bacteria reaching 1×10 8 CFU / mL or more; mixing the culture of Lactobacillus paracasei and the culture of Pichia pastoris to prepare a composite microbial agent; the Lactobacillus paracasei is Lactobacillus paracasei MY6, which is classified and named Lactobacillus paracasei Lactobacillus paracasei , deposited in the General Microbiological Center of China Microorganism Culture Collection Administration on October 30, 2024, with the deposit number CGMCC NO. 32409; the Pichia pastoris is Pichia pastoris PY4, and its classification is named Pichia pseudolambica , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 30, 2024, with the deposit number CGMCC NO.32410; S3. adding the composite microbial agent obtained in step S2 to the glutinous rice pulp obtained in step S1 for fermentation, and obtaining a high-acidity, low-nitrite white sour soup after post-ripening.

6. The preparation method according to claim 5, characterized in that: The pretreatment in step S1 is to wash, soak and beat the glutinous rice.

7. The preparation method according to claim 5, characterized in that: The volume ratio of the Lactobacillus paracasei culture to the Pichia pastoris culture in step 2 is 1-3:1-3.

8. The white sour soup prepared by the preparation method according to any one of claims 5 to 7, characterized in that: The acidity of the white sour soup is higher than 8.50 mg / g, and the nitrite content is lower than 10 mg / kg by weight.

Images