CpG oligodeoxyribonucleotide and application thereof in vaccine adjuvant

Abstract

The present invention relates to CpG oligodeoxyribonucleotides with improved body immunity, combinations thereof with additional adjuvants, and uses of the CpG adjuvants or combinations thereof in various vaccine compositions. The CpG independently serves as an adjuvant or is combined with an existing marketed adjuvant for use, and the CpG has the very remarkable advantages that the immune effect is advanced, the immune effect is improved, the lasting period of the immune protection effect is longer, the potential anaphylactic reaction is lower and the like, is superior to a commercially available vaccine adjuvant or an adjuvant system, and is a very excellent effective component of the vaccine adjuvant or the vaccine adjuvant system.

Description

Technical Field

[0001] The invention belongs to the field of oligodeoxyribonucleotide adjuvants, and specifically relates to a variety of CpG oligodeoxyribonucleotides and compositions thereof capable of improving the immunity of an organism, and applications thereof in vaccine adjuvants. Background Art

[0002] In the process of responding to infection by pathogenic microorganisms, the immune system composed of innate immunity and adaptive immunity constitutes a strong immune barrier for the host. The host will use this immune barrier to adopt a variety of passive and active defense mechanisms to resist infection by pathogenic microorganisms. Vaccines have been developed by using the host's defense mechanism against infection by pathogenic microorganisms.

[0003] As people delve deeper into vaccine research and development, the importance of vaccine adjuvants has gradually become apparent. Existing studies have shown that adjuvants can promote the immunity of vaccines in a variety of ways, including: (1) stabilizing or capturing immunogens to prolong their release, thereby prolonging immune stimulation; (2) promoting inflammatory responses at the site of immunogen deposition, thereby attracting activated macrophages and dendritic cells to improve the uptake and presentation of immunogens; (3) presenting co-stimulatory signals to T cells and B cells to enhance the specific immune induction of immunogens.

[0004] Toll-like receptors (TLRs) are an important component of the host pathogen sensing mechanism. TLRs are generally divided into two families based on their localization: TLR 1, TLR 2, TLR 4, TLR 5, and TLR 6 are expressed on the cell surface and sense bacterial cell wall components, while TLR 3, TLR 7, TLR 8, and TLR 9 are expressed in endosomes and sense viral or bacterial nucleic acids. The molecular structures recognized by TLRs are evolutionarily conserved, expressed by a variety of infectious microorganisms, and are called pathogen-associated molecular patterns (PAMPs). The innate immune response triggered by TLR activation is characterized by the production of proinflammatory cytokines, chemokines, type I interferons, and antimicrobial peptides. This innate response promotes and regulates the adaptive immune system, promoting the production of high-affinity immunogen-specific antibodies and cytotoxic T cells. Although several TLRs utilize similar signaling pathways, they differ in the induced cytokine profiles and engagement with adaptive immunity. Among them, TLR-9 is one of the most important Toll-like receptors, and its natural ligand is a demethylated viral or bacterial CpG-containing DNA fragment.

[0005] With the gradual maturity of small nucleic acid chemical synthesis technology, artificially synthesized CpG oligodeoxyribonucleotides (ODN) have gradually come into people's view, which can directly activate TLR9 receptors of plasmacytoid dendritic cells (pDC), B cells and other cells. The resulting immune response is characterized by the fact that B cells exposed to CpG ODN become more numerous and more easily activated by immunogens, and CpG ODN stimulates plasmacytoid dendritic cells to produce type I interferons and other substances to effectively present antigens to T cells. This innate immune response lays the foundation for antigen-specific adaptive immunity. Therefore, CpG ODN can be used to enhance the function of antigen-presenting cells and promote the generation of humoral and cellular vaccine-specific immune responses, and is a vaccine adjuvant with great potential.

[0006] Among all types of CpG ODN, the activity of type B CpG ODN has been widely studied in preclinical and clinical trials. Type B CpG ODN (also called "K" type), which contains a CpG motif, is usually a thiophosphate backbone, which enhances the resistance of type B CpG ODN to nuclease digestion and can significantly prolong the half-life in vivo (30-60 minutes, while the half-life of the phosphodiester backbone is 5-10 minutes). Type B CpG ODN can stimulate B cell proliferation and secretion of IgM. Based on the immune properties of type B CpG ODN, CpG 1018 was successfully developed by Dynavax as a hepatitis B vaccine adjuvant, which can significantly improve the vaccine's protective ability for immunocompromised people. CPG 1018 is a type B CpG oligonucleotide and an effective TLR9 agonist that can stimulate B cell proliferation and differentiation and significantly increase antibody levels.

[0007] As vaccine research and development progresses, people's demand for safer and more effective adjuvants or adjuvant systems is also increasing. In particular, the next generation of vaccines are mostly recombinant protein vaccines, which require adjuvants to achieve effective immune protection. A very prominent example is the herpes zoster vaccine. The first herpes zoster vaccine was a live attenuated vaccine developed by Merck. Although it was approved for marketing, its protective effect was only about 60%. Later, the herpes zoster recombinant protein vaccine developed by GSK, due to the super strong effect of the adjuvant AS01 in improving cellular immunity, its protection rate in the population reached more than 95%, becoming the only herpes zoster vaccine on the market. However, its AS01 adjuvant has more serious toxic and side effects (pain at the injection site, fever, etc.). Therefore, the development of vaccine adjuvants that enhance cellular immune function and have good tolerability and safety has become a top priority in vaccine research and development. Although existing studies have shown that CpG ODN has excellent potential for adjuvant application, the current application of CpG ODN as a human or animal vaccine adjuvant is still very limited. Only Dynavax's CpG 1018 has been approved for the production of hepatitis B vaccine. More safe and efficient CpG ODN vaccine adjuvants or adjuvant systems need to be developed urgently. Summary of the invention

[0008] The present invention provides novel adjuvant combinations, which can effectively activate the human or animal immune system, including CpG oligodeoxyribonucleotides and a variety of other types of adjuvant combinations. The adjuvant combination has the advantages of improved immune effect, earlier time and longer duration. The present invention also provides the advantageous effects of CpG oligodeoxyribonucleotides as a single adjuvant, for example, in the preparation of SARS-CoV vaccines.

[0009] In one aspect, an adjuvant or adjuvant combination is provided, comprising a CpG oligodeoxyribonucleotide adjuvant, wherein the CpG oligodeoxyribonucleotide comprises the sequence shown in SEQ ID NO:1.

[0010] In some embodiments, the CpG oligodeoxyribonucleotide further comprises a modification selected from the group consisting of a thio modification, a fluoro modification, and a methoxy modification.

[0011] In some embodiments, at least one phosphodiester bond in the CpG oligodeoxyribonucleotide is replaced with a phosphorothioate bond.

[0012] In some embodiments, all phosphodiester bonds in the CpG oligodeoxyribonucleotide are replaced with phosphorothioate bonds.

[0013] Oligodeoxyribonucleotides In some embodiments, the CpG oligodeoxyribonucleotides are single-stranded or double-stranded.

[0014] In some embodiments, one or more nucleotides in the CpG oligodeoxyribonucleotide are replaced by corresponding locked nucleic acid (LNA) nucleotides.

[0015] In some embodiments, the adjuvant combination further comprises at least one additional adjuvant component, the additional adjuvant component being selected from aluminum adjuvant, mineral oil adjuvant, ISA adjuvant, squalene oil-in-water adjuvant, AS series adjuvant, nanoparticle adjuvant, liposome adjuvant and a combination thereof. More specifically, the additional adjuvant component is selected from aluminum hydroxide, aluminum phosphate, white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS01 adjuvant, AS03 adjuvant, AS04 adjuvant, PLGA adjuvant, liposome adjuvant and a combination thereof.

[0016] In one aspect, there is provided use of the adjuvant or adjuvant combination in the preparation of a vaccine composition.

[0017] In some embodiments, the vaccine composition is a vaccine composition for human or animal use, such as a vaccine composition for human use.

[0018] In some embodiments, the vaccine composition is a vaccine composition for preventing or treating viral infection, bacterial infectious disease, fungal infectious disease or parasitic infectious disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solution of the present application, the drawings required for use in the embodiments are briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0020] Figure 1 This is the S1-specific IgG antibody titer test result 7 days after the first immunization;

[0021] Figure 2 This is the S1-specific IgG1 antibody titer test result 7 days after the first immunization;

[0022] Figure 3 This is the S1-specific IgG2a antibody titer test result 7 days after the first immunization;

[0023] Figure 4 This is the S1-specific IgG antibody titer test result 21 days after the first immunization;

[0024] Figure 5 This is the S1-specific IgG1 antibody titer test result 21 days after the first immunization;

[0025] Figure 6 This is the S1-specific IgG2a antibody titer test result 21 days after the first immunization;

[0026] Figure 7 This is the S1-specific IgG antibody titer test result 35 days after the first immunization;

[0027] Figure 8 This is the S1-specific IgG1 antibody titer test result 35 days after the first immunization;

[0028] Fig. 9 This is the S1-specific IgG2a antibody titer test result 35 days after the first immunization;

[0029] Fig.10 This is the S1-specific IgG antibody titer test result 49 days after the first immunization;

[0030] Fig.11 This is the S1-specific IgG1 antibody titer test result 49 days after the first immunization;

[0031] Fig.12 This is the S1-specific IgG2a antibody titer test result 49 days after the first immunization;

[0032] Fig.13 This is the S1-specific IgG antibody titer test result 63 days after the first immunization;

[0033] Fig.14 This is the S1-specific IgG1 antibody titer test result 63 days after the first immunization;

[0034] Fig.15 This is the result of the S1-specific IgG2a antibody titer test 63 days after the first immunization;

[0035] Fig.16 Comparison of the ability of different adjuvants or adjuvant systems to enhance vaccine activity;

[0036] Fig.17 This is the S1-specific IgE antibody test result 35 days after the first immunization. DETAILED DESCRIPTION

[0037] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. All patents, patent applications and other publications cited herein are incorporated by reference in their entirety. If the definitions set forth herein conflict with the definitions set forth in the patents, patent applications and other publications incorporated herein by reference, the definitions set forth herein shall prevail.

[0038] As used herein, the terms "adjuvant combination", "adjuvant system" and "complex adjuvant" are used interchangeably and refer to the combined use of two or more adjuvants with different immunological effects to further enhance or regulate antigen-specific immune responses.

[0039] As used herein, the terms "CpG oligodeoxyribonucleotide", "CpG ODN" and "CpG immunostimulatory nucleic acid" are used interchangeably to refer to an oligonucleotide containing at least one unmethylated cytosine-guanine dinucleotide motif. CpG oligodeoxyribonucleotides can generally be divided into several categories based on their structure and biological properties, including A-type CpG ODNs containing one or more CpG motifs in a palindromic structure in the central phosphodiester region of the sequence and composed of poly-G motifs with thiolation modifications at the 5' and 3' ends; B-type CpG ODNs with thiolation modifications throughout the backbone; C-type CpG ODNs composed of one or more 5'CpG units and a 3' palindrome; and P-type CpG ODNs composed of two thiophosphate backbone palindromes, as described in Bode et al., 2011, Expert Rev Vaccines, 10(4):499–511. Although each category of CpG ODN contains at least one unmethylated CG dinucleotide, their differences in structure and flanking regions result in significant differences in immunological activity. The CpG oligodeoxyribonucleotides involved in the present invention are CpG ODNs of class B. The nucleotide sequences provided herein include nucleotides connected by phosphodiester bonds or by phosphorothioate bonds.

[0040] Adjuvant combination containing CpG oligodeoxyribonucleotides

[0041] As an agonist of Toll-like receptor 9 (TLR9), CpG ODN can stimulate cells expressing TLR9 and activate downstream innate immune response pathways, inducing the expression of type I and type III interferons in plasmacytoid dendritic cells on the one hand, and activating B cells on the other hand, prompting the secretion of inflammatory factors, thereby enhancing humoral and cellular immune responses. Therefore, when used as a vaccine adjuvant, CpG ODN can improve the function of antigen-presenting cells and promote the production of vaccine-specific humoral and cellular immune responses.

[0042] In some aspects, the present invention provides an adjuvant combination comprising a CpG ODN, the adjuvant combination comprising a CpG ODN and at least one additional adjuvant, wherein the CpG ODN can be selected from:

[0043] A CpG oligodeoxyribonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 1.

[0044] In some specific embodiments, all phosphodiester bonds in the sequence shown in SEQ ID NO: 1 are replaced by phosphorothioate bonds.

[0045] The additional adjuvant may be an adjuvant that is not of the CpG ODN type, which adjuvants are well known to those skilled in the art, such as adjuvants used in human vaccines or veterinary vaccines, more specifically, such as aluminum adjuvants (aluminum hydroxide, aluminum phosphate), white oil adjuvants, ISA206 adjuvants, MF59 adjuvants, AS01 adjuvants, AS03 adjuvants, and AS04 adjuvants. Without limitation, the adjuvant combination of the present disclosure may also include other adjuvants in addition to CpG ODN adjuvants, including but not limited to other TLR (Toll-like receptor) agonists, NOD agonists, CLR (C-type lectin receptor) agonists, RLR agonists, aluminum adjuvants (e.g., aluminum hydroxide, aluminum phosphate), squalene-containing oil-in-water emulsions (e.g., MF59), mineral oil adjuvants (e.g., white oil adjuvants), ISA adjuvants (e.g., ISA206), AS adjuvants (e.g., AS01, AS03, AS04), liposome adjuvants (e.g., neutral or positive liposomes), nano adjuvants (e.g., PLGA), saponin adjuvants, α-galactosylceramide-derived adjuvants, polysaccharide adjuvants. The inventors have found that although these other adjuvants can effectively improve the humoral immunity level of the vaccine, the improvement of the cellular immunity level is limited, and by combining with the CpG ODN adjuvant, the cellular immunity level of the vaccine can be effectively improved.

[0046] Aluminum adjuvant

[0047] Aluminum adjuvant is the first vaccine adjuvant approved for human use. Since its first use in 1926, at least 146 licensed vaccines worldwide contain aluminum adjuvants, including hepatitis A virus, hepatitis B virus, human papillomavirus vaccines, etc. Aluminum adjuvant is a classic Th2 vaccine adjuvant that mainly stimulates the production of cytokines such as interleukin IL-4, IL-5, IL-13, etc. Its mechanism of action may be related to antigen storage, sustained release and targeting, phagocytosis and cell differentiation, and causing local inflammatory response, but it cannot induce Th1 type cellular immunity and cytotoxic T lymphocyte (CTL) response. The two main types of aluminum adjuvants are aluminum hydroxide and aluminum phosphate. At the same time, aluminum adjuvants can also induce the production of antigen-specific IgE antibodies.

[0048] Squalene oil-in-water emulsion

[0049] MF59 or MF59 analogs are one of the earliest approved clinical adjuvants. They are a water-oil emulsion adjuvant, mainly composed of squalene, Tween 80 and Span85. Its water-in-oil design significantly reduces viscosity and enhances human tolerance. Squalene is an oil phase component, widely distributed in animals, plants and the human body, and has the characteristics of biocompatibility and degradability. Tween 80 and Span85 are surfactants that enhance the stability of the emulsion. MF59 is an ideal adjuvant for viral vaccines. When used in combination with influenza, HIV and other vaccines, it can significantly enhance antibody titers and has good tolerance in different populations. It can promote antigen uptake, recruit a large number of immune cells into the injection site, and recruit monocytes and neutrophils to present antigens and transport them into lymph nodes. However, MF59 mainly enhances humoral immunity and has limited enhancement of cellular immunity. When used in combination with CpG, it induces higher antibody titers and Th1-type responses than a single adjuvant.

[0050] ISA adjuvant

[0051] Montanide (ISA) adjuvant is a commercial W / O emulsion. ISA contains purified mineral oil or squalene oil, and mannitol esters as emulsifiers. It has few side effects and is widely used in the production and development of veterinary vaccines. For example, Montanide's W / O adjuvant is used in chicken Newcastle disease vaccine and hyopneumonia Mycoplasma subunit vaccine, pig and cattle inactivated foot-and-mouth disease vaccine, and farmed fish vaccines infected by various viruses and bacteria. In the two-phase emulsion water-in-oil-in-water (W / O / W), oil droplets containing internal water droplets are dispersed into a continuous aqueous phase. This emulsion can simultaneously provide rapid release of antigens from the external aqueous phase and prolonged release from the internal aqueous phase, which can quickly and continuously stimulate immune cells. At present, there are relatively few W / O / W emulsions on the market. The most widely used in veterinary vaccines are ISA201 and ISA206. After mixing with antigens under mild conditions, vaccines are prepared to protect different types of livestock from several economically important pathogens (such as influenza virus and foot-and-mouth disease virus).

[0052] AS series adjuvants

[0053] AS adjuvant is a series of human vaccine adjuvants developed by GlaxoSmithKline (GSK), including AS01, AS02, AS03 and AS04. Among them, AS01 is a liposome adjuvant containing monophosphoryl lipid A (MPL) and saponin (QS-21), which can stimulate stromal cells to produce cytokines, recruit monocytes and neutrophils, promote monocyte differentiation into dendritic cells, improve the antigen presentation ability of dendritic cells at the injection site and in the draining lymph nodes, and assist the vaccine in producing higher adaptive immunity. AS02 is also an oil-in-water emulsifier containing MPL and QS-21. AS03 is an oil-in-water emulsifier containing α-tocopherol, squalene, and Tween 80, which can stimulate the production of proinflammatory cytokines and chemokines by activating the NF-κB pathway, chemotactic monocytes, and promote antigen-induced production of high levels of antibodies. AS04 is an aluminum salt adjuvant with added MPL. Its main functions include: inducing the production of proinflammatory cytokines; inducing the production of chemokines; recruiting monocytes / macrophages, especially dendritic cells, to the injection site; and inducing the production of IL-2 and IFN-γ.

[0054] Mineral oil adjuvant

[0055] Mineral oil adjuvant is an emulsion vaccine made by adding an emulsifier to light mineral oil (trade name white oil) that meets pharmaceutical standards and then mixing it with an appropriate proportion of aqueous solution antigens. White oil adjuvant is the most commonly used adjuvant in animal oil adjuvant vaccines. It can prolong the antigen immunization time and reduce the number of immunizations. However, it has the problem of difficulty in injection due to high viscosity and inflammatory reaction at the injection site. The main factors affecting the immune effect of white oil adjuvant are aromatic hydrocarbons, heavy metals and the viscosity of white oil movement.

[0056] Application of adjuvant combination

[0057] The CpG oligodeoxyribonucleotide adjuvant of the present invention can be used in combination with any of the above adjuvants. In some aspects, the present invention provides the use of the adjuvant combination disclosed herein in the preparation of a vaccine composition. The vaccine composition is a vaccine composition for preventing or treating viral infection, bacterial infectious disease, fungal infectious disease or parasitic infectious disease. The vaccine composition can be administered to an individual to increase the immune response against the corresponding virus, which can prevent or treat the corresponding viral infection of the individual.

[0058] By way of example and not limitation, the viruses targeted by the vaccine composition can be selected from coronavirus and the new coronavirus SARS-CoV-2, human immunodeficiency virus HIV-1, human papillomavirus, varicella zoster virus, human herpes simplex virus, respiratory syncytial virus, hepatitis B virus, hand, foot and mouth virus, coxsackie virus, human cytomegalovirus, influenza virus, tuberculosis (TB), etc. Accordingly, the term vaccine as used herein encompasses therapeutic vaccines (for the treatment of diseases) and prophylactic vaccines (for the prevention of diseases). In some embodiments of the present invention, the virus is the new coronavirus SARS-CoV-2. Accordingly, the antigenic components in the vaccine composition are recombinant protein antigens and / or polypeptides or epitope antigens derived from SARS-CoV-2, preferably SARS-CoV-2S1 protein.

[0059] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0060] Example

[0061] Example 1: Synthesis of CpG ODN molecules

[0062] The present invention adopts solid phase synthesis method to chemically synthesize CpG ODN. The specific operation is as follows:

[0063] (1) Solid-phase synthesis: It consists of computer-controlled repeated synthesis steps (detritylation, coupling, sulfidation, capping) and the final step of dephosphorylation of the backbone protecting group;

[0064] (2) Aminolysis: After synthesis, the oligonucleotide is cut off from the support using ammonia or an organic amine. The oligonucleotide is dissolved in the solution, and the universal linker group connected to the first base at the 3' end and the protecting group of the amino group on the base are removed;

[0065] (3) Purification: The crude product obtained by aminolysis is purified and separated by ion exchange chromatography, reverse phase chromatography or electrophoresis to obtain a purified product;

[0066] (4) Desalting and concentrating: using ultrafiltration equipment to desalt and concentrate the purified product;

[0067] (5) Packaging and freeze-drying: A white, off-white or light yellow loose body is obtained by freeze-drying.

[0068] Types of nucleic acid modifications include, but are not limited to, thiolation modifications.

[0069] Table 1: Sequences of CpG ODN adjuvants

[0070] serial number sequence SEQ ID NO:1 TCGACGTTCGTCGTTCGTCGTCGT

[0071] Specifically, the sequence of AM1009 is

[0072] T*C*G*A*C*G*T*T*C*G*T*C*G*T*T*C*G*T*C*G*T*C*G*T*C*G*T(Note: * indicates thio modification).

[0073] Example 2: Preparation of SARS-CoV-2S1 protein

[0074] In order to evaluate the immune activity of AM1009 as a vaccine adjuvant or adjuvant system component, this study used SARS-CoV-2S1 protein as a vaccine protein model to study the immune activity of the vaccine. The preparation process of SARS-CoV-2S1 protein is as follows:

[0075] (1) Expression vector construction

[0076] Val16-Arg685 of SARS-CoV-2S1 protein was expressed, and 10 His were added to its C-terminus to form a His tag. The signal peptide used was the antibody heavy chain signal peptide. The amino acid sequence of the fusion protein was shown in SEQ ID NO: 2.

[0077] (2) The nucleic acid encoding the amino acid sequence in step (1) is codon-optimized, a Kozak sequence is added to the N-terminus, and a stop codon is added to the C-terminus. The nucleic acid sequence is shown in SEQ ID NO: 3.

[0078] (3) The nucleic acid sequence was commissioned to Nanjing Qingke Biotechnology Co., Ltd. for synthesis and cloned into the XbaI site of the expression vector pCDNA3.4.

[0079] (4) Cell transfection

[0080] The expression plasmid in the transfection level step (3) was extracted in large quantities and transfected into HEK293 cells. The cells were harvested 7 days after transfection and the supernatant was collected by centrifugation.

[0081] (5) Protein purification

[0082] The supernatant in step (4) was subjected to Ni-NTA column affinity chromatography, washed with binding buffer, and the target protein was eluted with elution buffer. The eluate was ultrafiltered into PBS buffer, and then the purity was identified by SDS-PAGE electrophoresis, the concentration was determined by Nano Drop, and the aliquots were frozen at -80°C.

[0083] Example 3: Preparation of vaccine with AM1009 as adjuvant

[0084] (1) Under sterile conditions, take 50 μL of 2 mg / ml SARS-CoV-2 S1 protein solution and dilute to 250 μL with PBS;

[0085] (2) Prepare a 2 mg / mL AM1009 solution;

[0086] (3) Add 250 μL of the solution from step (2) to the solution from step (1) and mix well.

[0087] Example 4: Preparation of aluminum adjuvant vaccine

[0088] Aluminum hydroxide adjuvanted vaccines:

[0089] (1) Take 50 μL of 2 mg / ml SARS-CoV-2 S1 protein solution and dilute to 450 μL with PBS;

[0090] (2) Take 50 μL of aluminum hydroxide gel adjuvant (2%) and add it to the solution in step (1) and mix well.

[0091] Aluminum phosphate adjuvanted vaccines:

[0092] (1) Take 50 μL of 2 mg / ml SARS-CoV-2 S1 protein solution and dilute to 400 μL with PBS;

[0093] (2) Take 100 μL of aluminum phosphate adjuvant (0.5%), add it to the solution in step (1), and mix well.

[0094] Example 5: Preparation of vaccine with adjuvant system (aluminum adjuvant + AM1009)

[0095] Preparation of vaccine with aluminum hydroxide + AM1009 as adjuvant:

[0096] (1) Take 50 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0097] (2) adding 50 μL of aluminum hydroxide gel adjuvant (2%) to the solution in step (1);

[0098] (3) Add 350 μL of PBS solution to the solution in step (2) and mix well;

[0099] (4) Take 50 μL of 2 mg / mL AM1009 solution, add it to the above solution, and mix well to allow the adjuvant to effectively adsorb the antigen.

[0100] Preparation of vaccine with aluminum phosphate + AM1009 as adjuvant:

[0101] (1) Take 50 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0102] (2) adding 100 μL of aluminum phosphate gel adjuvant (0.5%) to the solution in step (1);

[0103] (3) Add 300 μL of PBS solution to the solution in step (2) and mix well;

[0104] (4) Take 50 μL of 2 mg / mL AM1009 solution and add it to the above solution. Mix well so that the adjuvant can effectively adsorb the antigen.

[0105] Example 6: Preparation of MF59 adjuvanted vaccine

[0106] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0107] (2) Add 240 μL of PBS solution to the solution in step (1) and mix well;

[0108] (3) Add the solution obtained in step (2) into 300 μL of MF59 adjuvant and mix well.

[0109] Example 7: Preparation of white oil adjuvant vaccine

[0110] (1) Take 100 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0111] (2) Add 150 μL of PBS solution to the solution in step (1), mix thoroughly, and then add to a syringe;

[0112] (3) Take 0.75 ml of white oil adjuvant and add it to another syringe. Connect the two syringes with a connector.

[0113] (4) Push the device in step (3) back and forth quickly until an emulsion is formed.

[0114] Example 8: Preparation of ISA206 adjuvant system vaccine

[0115] (1) Take 100 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0116] (2) Add 400 μL of PBS solution to the solution in step (1) and mix thoroughly;

[0117] (3) preheating the solution in step (2) to 31° C. and adding it to a syringe;

[0118] (4) Take 500 μL of ISA206 adjuvant, preheat it to 31°C and add it to another syringe;

[0119] (5) Connect two syringes with a connector;

[0120] (6) Push the device in step (5) back and forth quickly until an emulsion is formed.

[0121] Example 9: Preparation of AS01 adjuvant system vaccine

[0122] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0123] (2) Add 240 μL of PBS solution to the solution in step (1) and mix thoroughly;

[0124] (3) Add 300 μL AS01 adjuvant to the solution in step (2);

[0125] (4) After mixing the solutions in step (3), gently rotate to mix.

[0126] Example 10: Preparation of AS03 adjuvant system vaccine

[0127] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0128] (2) Add 240 μL PBS to the solution in step (1) and mix thoroughly;

[0129] (3) Add the solution from step (2) to 300 μL AS03 adjuvant and mix well;

[0130] Example 11: Preparation of AS04 adjuvant system vaccine

[0131] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0132] (2) Add 240 μL PBS to the solution in step (1) and mix thoroughly;

[0133] (3) Add the solution from step (2) to 300 μL AS04 adjuvant and mix well.

[0134] Example 12: Preparation of adjuvant system (MF59+AM1009) vaccine

[0135] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0136] (2) Take 60 μL of 2 mg / mL AM1009;

[0137] (3) Add the solutions from steps (1) and (2) to 180 μL of PBS solution and mix well;

[0138] (4) Add 300 μL of MF59 adjuvant to the mixed solution in step (3) and mix well.

[0139] Example 13: Preparation of adjuvant system (white oil adjuvant + AM1009) vaccine

[0140] (1) Take 100 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0141] (2) Add 100 μL of 2 mg / mL AM1009 solution to the solution in step (1);

[0142] (3) Add 50 μL of PBS solution to the solution in step (2), mix thoroughly and add to a syringe;

[0143] (4) Take 0.75 ml of white oil adjuvant and add it to another syringe. Connect the two syringes with a connector.

[0144] (5) Push the device in step (4) back and forth quickly until an emulsion is formed.

[0145] Example 14: Preparation of adjuvant system (ISA 206+AM1009) vaccine

[0146] (1) Take 100 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0147] (2) Add 100 μL of 2 mg / mL AM1009 solution to the solution in step (1);

[0148] (3) Add 300 μL of PBS solution to the solution in step (2) and mix thoroughly;

[0149] (4) preheating the solution in step (3) to 31° C. and adding it to a syringe;

[0150] (5) Take 500 μL of ISA206 adjuvant, preheat it to 31°C and add it to another syringe;

[0151] (6) Connect two syringes with a connector;

[0152] (7) Push the device in step (6) back and forth quickly until an emulsion is formed.

[0153] Example 15: Preparation of adjuvant system (AS01+AM1009) vaccine

[0154] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0155] (2) Add 60 μL of 2 mg / mL AM1009 to the solution in step (1);

[0156] (3) Add 180 μL of PBS solution to the solution in step (2) and mix thoroughly;

[0157] (4) Add the solution from step (3) to 300 μL of AS01 adjuvant;

[0158] (5) After mixing the solutions in step (4), gently rotate to mix.

[0159] Example 16: Preparation of adjuvant system (AS03+AM1009) vaccine

[0160] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0161] (2) Add 60 μL of 2 mg / mL AM1009 solution to the solution in step (1);

[0162] (3) Add 180 μL of PBS solution to the solution in step (2) and mix thoroughly;

[0163] (4) Add the solution from step (3) to 300 μL of AS03 adjuvant and mix well.

[0164] Example 17: Preparation of adjuvant system (AS04+AM1009) vaccine

[0165] (1) Take 60 μL of 2 mg / ml SARS-CoV-2 S1 protein solution;

[0166] (2) Add 180 μL of PBS solution to the solution in step (1) and mix thoroughly;

[0167] (3) Add the solution from step (2) to 300 μL of AS04 adjuvant and mix thoroughly;

[0168] (4) Add 60 μL of 2 mg / mL AM1009 solution to the solution in step (3) to allow the adjuvant to effectively adsorb the antigen.

[0169] Example 18: Immunization of mice with vaccines

[0170] (1) Prepare an appropriate number of Balb / c mice and raise them in isolation and quarantine;

[0171] (2) Mice were grouped according to the experimental requirements, with 5 mice in each group; the negative control was mice injected with S1 protein (S1 protein group);

[0172] (3) Immunizing mice by intramuscular injection on day 0 (first immunization time), day 14, and day 28, respectively. The vaccine used for immunization was the vaccine prepared in Example 3-17, with a volume of 50 μL / mice;

[0173] (4) Daily observation of the clinical status of the animals from the start of the experiment until the animals are euthanized, including mental state, activity level, diet, drinking water, etc.;

[0174] (5) Sample collection: Blood was collected on days 7, 21, 35, 49, and 63. 100–150 μL of whole blood was collected from each mouse each time and centrifuged at 6000 rpm, 4°C, for 10 min to obtain serum.

[0175] (6) Freeze the collected samples at -80°C until titer measurement.

[0176] Example 19: Detection of mouse immune titer

[0177] (1) Protein coating: The coating concentration of SARS-CoV-2S1 protein is 2 μg / ml. Dilute the protein concentration. Add the diluted sample to a 96-well ELISA plate, add 100 μL to each well, seal the plate with a sealing film, and place in a 4°C refrigerator overnight;

[0178] (2) Washing: Take out the 96-well plate coated overnight, discard the liquid in the wells, wash three times with PBS, 300 μL / well, and pat dry;

[0179] (3) Blocking: Add 300 μL of 2% BSA blocking buffer to each well, seal the plate with a sealing film, and incubate at 37°C for 1 h;

[0180] (4) Washing: After blocking, discard the liquid in the wells, wash three times with PBST, 300 μL / well, and pat dry;

[0181] (5) Primary antibody incubation: Add 100 μL of diluted sample (serum) to each well, seal the plate with a sealing film, and incubate at 37°C for 1 h;

[0182] (6) Washing: After incubation, discard the liquid in the wells, wash three times with PBST, 300 μL / well, and pat dry;

[0183] (7) Secondary antibody incubation: Add 100 μL of diluted secondary antibody to each well, seal the plate with sealing film, and incubate at 37°C for 1 h;

[0184] (8) Washing: After incubation, discard the liquid in the wells, wash with PBST 5 times, 300 μL / well, and pat dry;

[0185] (9) Color development: Add 100 μL TMB color development solution to each well and develop at 37°C;

[0186] (10) Stop: Add 50 μL of ELISA stop solution and gently tap the edge of the ELISA plate to mix;

[0187] (11) Reading the plate: Place the ELISA plate in an ELISA reader and read the plate at a detection wavelength of 450 nm and a reference wavelength of 570 nm.

[0188] Example 20: Analysis and discussion of immune results

[0189] The antibody titer test results of mice immunized with the vaccine of Example 3-17 are as follows: Figures 1 to 17 The total IgG antibody titer reflects the level of all IgG subtype antibodies, IgG1 reflects the level of humoral immunity, and IgG2a reflects the level of cellular immunity.

[0190] Figure 1 It is the total IgG antibody titer 7 days after immunization. Figure 1 It can be seen that the IgG immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is significantly better than that of ISA206 adjuvant alone (no S1 protein-specific IgG antibodies were detected 7 days after one immunization with ISA206 alone); the IgG immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant is significantly better than that of MF59 alone (no S1 protein-specific IgG antibodies were detected 7 days after one immunization with MF59 alone); the IgG immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant is significantly better than that of AS03 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is significantly better than that of AS01 adjuvant alone.

[0191] Figure 2 IgG1 antibody titer of each immunization group 7 days after immunization. Figure 2 It can be seen that the IgG1 immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is significantly better than that of ISA206 adjuvant alone (using ISA206 as adjuvant alone, no S1 protein-specific IgG1 antibodies were detected 7 days after the first immunization).

[0192] Figure 3 is the IgG2a antibody titer of each immunization group 7 days after the first immunization. Figure 3It can be seen that the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate is significantly better than that of aluminum phosphate adjuvant alone (no S1 protein-specific IgG2a antibody was detected 7 days after the first immunization with aluminum phosphate adjuvant alone); the IgG2a immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is significantly better than that of white oil adjuvant alone (no S1 protein-specific IgG2a antibody was detected 7 days after the first immunization with white oil adjuvant alone); the IgG2a immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is significantly better than that of ISA206 alone Adjuvant (when ISA206 was used alone as adjuvant, no S1 protein-specific IgG2a antibodies were detected 7 days after the first immunization); the IgG2a immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant was significantly better than that of MF59 adjuvant alone (when MF59 was used alone as adjuvant, no S1 protein-specific IgG2a antibodies were detected 7 days after the first immunization); the IgG2a immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant was significantly better than that of AS03 adjuvant alone (when AS03 was used alone as adjuvant, no S1 protein-specific IgG2a antibodies were detected 7 days after the first immunization).

[0193] Figure 4 It is the total IgG antibody titer of each immunization group 7 days after the second immunization (i.e. 21 days after the first immunization). Figure 4 It can be seen that when AM1009 is used as an adjuvant, the IgG antibody titer of the vaccine is higher than that of the S1 protein group; the IgG immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is significantly better than that of white oil adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS04 adjuvant is better than that of AS04 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0194] Figure 5 IgG1 antibody titer of each immunization group 7 days after the second immunization (i.e. 21 days after the first immunization). Figure 5 It can be seen that the IgG1 immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is better than that of white oil adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0195] Figure 6 IgG2a antibody titer of each immunization group 7 days after the second immunization (i.e. 21 days after the first immunization). Figure 6It can be seen that the IgG2a antibody titer of AM1009 as an adjuvant was much higher than that of the S1 protein group (no S1 protein-specific IgG2a antibody was detected 7 days after the second immunization when immunized with S1 protein alone); the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide was significantly better than that of aluminum hydroxide alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate was significantly better than that of aluminum phosphate alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and white oil adjuvant was better than that of white oil alone; AM1009 and ISA206 adjuvant The IgG2a immune titer of the adjuvant system composed of AM1009 and MF59 adjuvants was significantly better than that of MF59 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS04 adjuvants was significantly better than that of AS04 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS03 adjuvants was significantly better than that of AS03 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant was significantly better than that of AS01 adjuvant alone.

[0196] Figure 7 It is the total IgG antibody titer of each immunization group 7 days after the third immunization (i.e. 35 days after the first immunization). Figure 7 It can be seen that the IgG immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and aluminum phosphate is significantly better than that of aluminum phosphate adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is significantly better than that of white oil adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is better than that of ISA206 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant is better than that of MF59 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS04 adjuvant is better than that of AS04 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant is better than that of AS03 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0197] Figure 8 IgG1 antibody titer of each immunization group 7 days after the third immunization (i.e. 35 days after the first immunization). Figure 8It can be seen that the IgG1 antibody titer of AM1009 as an adjuvant is higher than that of the S1 protein group; the IgG1 immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and aluminum phosphate is significantly better than that of aluminum phosphate adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is better than that of white oil adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is better than that of ISA206 adjuvant alone. The IgG1 immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant is better than that of AS03 adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0198] Fig. 9 IgG2a antibody titer of each immunization group 7 days after the third immunization (i.e. 35 days after the first immunization). Fig. 9 It can be seen that the IgG2a antibody titer of AM1009 as an adjuvant is much higher than that of the S1 protein group; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate is significantly better than that of aluminum phosphate alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is significantly better than that of white oil alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is significantly better than that of The IgG2a immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant was significantly better than that of MF59 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS04 adjuvant was significantly better than that of AS04 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant was significantly better than that of AS03 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant was better than that of AS01 adjuvant alone.

[0199] Fig.10 is the total IgG antibody titer of each immunization group 49 days after the first immunization. Fig.10It can be seen that the IgG immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is better than that of white oil adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is better than that of ISA206 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant is better than that of MF59 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS04 adjuvant is better than that of AS04 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant is better than that of AS03 adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is significantly better than that of AS01 adjuvant alone.

[0200] Fig.11 IgG1 antibody titer of each immunization group 49 days after the first immunization. Fig.11 It can be seen that the IgG1 immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is better than that of white oil adjuvant alone; the IgG1 immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0201] Fig.12 is the IgG2a antibody titer of each immunization group 49 days after the first immunization. Fig.12 It can be seen that the IgG2a antibody titer of AM1009 as an adjuvant is significantly higher than that of S1 protein; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate is significantly better than that of aluminum phosphate adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is significantly better than that of white oil adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and ISA206 adjuvant is significantly better than that of S1 protein alone. The titer was significantly better than that of ISA206 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant was significantly better than that of MF59 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS04 adjuvant was better than that of AS04 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant was significantly better than that of AS03 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant was better than that of AS01 adjuvant alone.

[0202] Fig.13 is the total IgG antibody titer of each immunization group 63 days after the first immunization. Fig.13It can be seen that the IgG immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is better than that of aluminum hydroxide adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is better than that of white oil adjuvant alone; the IgG immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0203] Fig.14 IgG1 antibody titer of each immunization group 63 days after the first immunization. Fig.14 It can be seen that the IgG1 antibody titer of AM1009 as an adjuvant is higher than that of S1 protein; the IgG1 immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is better than that of aluminum hydroxide adjuvant alone.

[0204] Fig.15 IgG2a antibody titer of each immunization group 63 days after the first immunization. Fig.15 It can be seen that the IgG2a antibody titer of AM1009 as an adjuvant is much higher than that of S1 protein; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide is significantly better than that of aluminum hydroxide adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate is significantly better than that of aluminum phosphate adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and white oil adjuvant is significantly better than that of white oil adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and MF59 adjuvant is significantly better than that of MF59 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS04 adjuvant is better than that of AS04 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS03 adjuvant is significantly better than that of AS03 adjuvant alone; the IgG2a immune titer of the adjuvant system composed of AM1009 and AS01 adjuvant is better than that of AS01 adjuvant alone.

[0205] Fig.16The IgG2a test results of the S1 protein vaccine activity comparison of different adjuvants or adjuvant systems. As can be seen from the figure, 21 days after the first vaccination (mid-immunity) or 63 days after the first vaccination (late-immunity), the IgG2a immune titer of AM1009 as an independent adjuvant is significantly better than the existing marketed human or veterinary vaccine adjuvants (aluminum phosphate adjuvant, aluminum hydroxide adjuvant, MF59 adjuvant system, AS03 adjuvant system, AS04 adjuvant system, white oil adjuvant, AS01 adjuvant system). In addition, 21 days after the first immunization, the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum hydroxide, the adjuvant system composed of AM1009 and MF59, the adjuvant system composed of AM1009 and aluminum phosphate, the adjuvant system composed of AM1009 and AS03, the adjuvant system composed of AM1009 and AS04, and the adjuvant system composed of AM1009 and AS01 were significantly better than those of aluminum phosphate adjuvant, aluminum hydroxide adjuvant, MF59 adjuvant system, AS03 adjuvant system, AS04 adjuvant system, ISA206 adjuvant system, AS01 adjuvant system and AM1009 independent adjuvant; the IgG2a immune titer of the adjuvant system composed of AM1009 and ISA206 was significantly better than those of aluminum phosphate adjuvant, aluminum hydroxide adjuvant, MF59 adjuvant system, AS03 adjuvant system, AS04 adjuvant system, ISA206 adjuvant system, and AS01 adjuvant system. The IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate was significantly better than that of the adjuvant system composed of AM1009 and MF59. 63 days after the first immunization, the IgG2a immune titer of the adjuvant system composed of AM1009 and aluminum phosphate, the adjuvant system composed of AM1009 and aluminum hydroxide, the adjuvant system composed of AM1009 and MF59, the adjuvant system composed of AM1009 and AS03, the adjuvant system composed of AM1009 and AS04, and the adjuvant system composed of AM1009 and white oil adjuvant was significantly better than that of aluminum phosphate adjuvant, aluminum hydroxide adjuvant, MF59 adjuvant system, AS03 adjuvant system, AS04 adjuvant system, and white oil adjuvant.

[0206] Fig.17The results of S1-specific IgE antibody detection in each immunization group 35 days after the first immunization. As can be seen from the figure, 35 days after the first immunization (i.e. 7 days after the third immunization), mice produced a higher level of specific IgE antibodies to S1 protein. When aluminum hydroxide adjuvant, aluminum phosphate adjuvant, white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, and AS03 adjuvant system were used as vaccine adjuvants, the level of specific IgE antibodies produced by mice to S1 protein was higher than that of S1 protein alone. When AM1009, AS01 adjuvant system, and AS04 adjuvant system were used as independent vaccine adjuvants, the level of specific IgE antibodies produced by mice to S1 protein was significantly lower than that of S1 protein alone. In addition, the new adjuvant system composed of AM1009 and aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system can significantly reduce the level of specific IgE antibodies produced by mice against S1 protein compared with their respective basic adjuvant systems (aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system).

[0207] From the above results, it can be seen that AM1009, as an independent adjuvant, has very significant advantages in terms of early immune effect, enhanced immune effect, and longer duration of immune protection effect compared with existing aluminum adjuvants (aluminum hydroxide or aluminum phosphate), white oil adjuvants, ISA206 adjuvants, MF59 adjuvants, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system ( Figure 1-15 ). At the same time, the new adjuvant system composed of AM1009 and aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system has very significant advantages over their respective basic adjuvant systems (aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system), such as early immune effect, enhanced immune effect, and longer duration of immune protection effect ( Figure 1-15 ). More importantly, AM1009 as an independent adjuvant, or a new adjuvant system composed of aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system, has significant advantages over the human or veterinary adjuvant systems on the market (aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system), such as early immune effect, enhanced immune effect, and longer duration of immune protection effect ( Fig.16 ). In addition, AM1009 as an independent adjuvant, or a new adjuvant system composed of aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system can significantly reduce the level of vaccine-specific IgE produced by the body compared to the human or veterinary adjuvant systems on the market (aluminum adjuvant (aluminum hydroxide or aluminum phosphate), white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS04 adjuvant system, AS03 adjuvant system, and AS01 adjuvant system), and is expected to effectively reduce vaccine-induced allergic reactions ( Fig.17 ).

[0208] Therefore, whether AM1009 is used alone as an adjuvant or in combination with existing marketed adjuvants, it has very significant advantages such as early immune effect, enhanced immune effect, longer duration of immune protection effect, and lower potential allergic reactions. It is superior to commercially available vaccine adjuvants or adjuvant systems and is a very excellent vaccine adjuvant or effective component of a vaccine adjuvant system.

[0209] The present application is described in detail above in conjunction with specific implementation methods and exemplary examples, but these descriptions cannot be understood as limiting the present application. Those skilled in the art understand that, without departing from the spirit and scope of the present application, a variety of equivalent replacements, modifications or improvements can be made to the technical solution of the present application and its implementation methods, all of which fall within the scope of the present application. The scope of protection of the present application shall be subject to the attached claims.

Claims

1. An adjuvant or adjuvant combination, comprising a CpG oligodeoxyribonucleotide adjuvant, wherein the CpG oligodeoxyribonucleotide comprises the sequence shown in SEQ ID NO:

1.

2. The adjuvant or adjuvant combination of claim 1, wherein the CpG oligodeoxyribonucleotide further comprises a modification selected from the group consisting of a thio modification, a fluoro modification and a methoxy modification.

3. The adjuvant or adjuvant combination of claim 1 or 2, wherein at least one phosphodiester bond in the CpG oligodeoxyribonucleotide is replaced by a phosphorothioate bond.

4. The adjuvant or adjuvant combination of claim 3, wherein all phosphodiester bonds in the CpG oligodeoxyribonucleotide are replaced by phosphorothioate bonds.

5. The adjuvant or adjuvant combination according to any one of claims 1 to 4, wherein the CpG oligodeoxyribonucleotide is single-stranded or double-stranded.

6. The adjuvant or adjuvant combination of any one of claims 1 to 5, wherein one or more nucleotides in the CpG oligodeoxyribonucleotide are substituted by corresponding locked nucleic acid (LNA) nucleotides.

7. The adjuvant or adjuvant combination of any one of claims 1-6, wherein the CpG oligonucleotide is conjugated to a nanoparticle.

8. The adjuvant or adjuvant combination of claim 7, wherein the nanoparticles are selected from the group consisting of PLGA, chitosan, liposomes, and lipid modules.

9. The adjuvant or adjuvant combination of claim 7 or 8, wherein the CpG oligodeoxyribonucleotide is conjugated to the nanoparticle via a phosphodiester bond or a phosphorothioate bond.

10. The adjuvant or adjuvant combination of any one of claims 1 to 9, wherein the adjuvant combination further comprises at least one additional adjuvant component selected from the group consisting of aluminum adjuvants, mineral oil adjuvants, ISA adjuvants, squalene oil-in-water adjuvants, AS series adjuvants, nanoparticle adjuvants, liposome adjuvants, and combinations thereof.

11. The adjuvant combination of claim 10, wherein the additional adjuvant component is selected from the group consisting of aluminum hydroxide, aluminum phosphate, white oil adjuvant, ISA206 adjuvant, MF59 adjuvant, AS01 adjuvant, AS03 adjuvant, AS04 adjuvant, PLGA adjuvant, liposome adjuvant, and combinations thereof.

12. Use of the adjuvant or adjuvant combination according to any one of claims 1 to 11 in the preparation of a vaccine composition.

13. The use according to claim 12, wherein the vaccine composition is a vaccine composition for human or animal use, such as a vaccine composition for human use.

14. The use according to claim 12, wherein the vaccine composition is a vaccine composition for preventing or treating viral infection, bacterial infectious disease, fungal infectious disease or parasitic infectious disease.

Images