SNP (Single Nucleotide Polymorphism) site related to leaf posture of millet in heading stage, molecular marker and application of SNP site and molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to leaf postures of millet in a heading stage, a molecular marker and application of the SNP site and the molecular marker, the SNP site is located at the 6603655th site of the eighth chromosome of the millet, and the allelic variation of the SNP site is T / C. The invention provides an SNP site obviously related to the heading stage leaf posture character of the millet, and develops a molecular marker related to the heading stage leaf posture character of the millet, so that a genome DNA sequence is associated with a heading stage leaf posture character gene of the millet, and establishment of a millet molecular marker assisted breeding system is facilitated; and a direction and a basis can be provided for finer positioning and millet breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biomolecules, and in particular relates to SNP sites and molecular markers related to millet leaf posture at heading stage and applications thereof. Background Art

[0002] Millet (Setaria italica), also known as millet or millet in ancient times, is an annual herbaceous crop native to China. It is one of China's important food crops and plays an irreplaceable role in the sustainable development of dryland agriculture. Millet is drought-resistant and water-saving, and is considered a strategic reserve crop to cope with future drought environments and climate warming. The leaf posture of millet during the heading period, that is, the growth posture of the leaves, will affect the photosynthesis of the leaves, and ultimately affect the yield of millet. The leaf posture of millet is semi-upward, and this growth posture is conducive to the leaves to better capture sunlight and photosynthesize, thereby promoting the accumulation and operation of nutrients. Such a growth posture helps to improve the photosynthetic efficiency of millet, promote high nutrient accumulation and high operation, and is one of the key measures to achieve high yield and high quality of millet. As a diploid self-pollinating crop, millet has a small genome, is easy to operate, has a short reproductive cycle, and is relatively simple in inheritance. It now has a high-quality reference genome sequence, and the publication of the millet SSR genetic linkage map has laid a good foundation for the genetic analysis of millet. Although the whole genome sequence of millet has been sequenced, there are few reports on the genetic association studies of millet leaf posture traits at the heading stage; therefore, it is necessary to develop, utilize and identify molecular markers of millet leaf posture at the heading stage in order to breed better varieties. Summary of the invention

[0003] Based on the above background, the present invention provides SNP loci, molecular markers and applications thereof related to leaf posture at the heading stage of millet, so as to breed better varieties.

[0004] The technical solution of the present invention is:

[0005] The SNP site associated with millet leaf posture during heading period, the SNP site is located at position 6603655 of chromosome 8 of millet, and its allele variation is T / C.

[0006] Based on the same inventive concept, the present invention provides an application of a substance for detecting the polymorphism or genotype of SNP in a millet genome in any of the following applications, the application comprising:

[0007] 1) Application in predicting leaf posture of millet at heading stage;

[0008] 2) Application in identification or auxiliary identification of leaf posture traits of millet at heading stage;

[0009] 3) Application in related breeding or auxiliary breeding for improving leaf posture of millet at heading stage;

[0010] The SNP site is located at position 6603655 of chromosome 8 of millet, and its allele variation is T / C.

[0011] Based on the same inventive concept, the present invention provides a molecular marker that can be associated with the leaf posture of millet at the heading stage, and the molecular marker includes the 6603655th site of the eighth chromosome of millet;

[0012] The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1, and can be specifically seen as follows:

[0013] TAAACATTGAGAAAGCCTGCATACCCGGTAACAAC[C / T]ACGTATTAATAATGGTTACTTCGTACATGCTCACG, the 36th base is a C / T allele variation.

[0014] Based on the same inventive concept, the present invention also provides the use of molecular markers related to millet leaf posture at heading stage in any of the following, the application comprising:

[0015] 1) Application in predicting leaf posture of millet at heading stage;

[0016] 2) Application in identification or auxiliary identification of leaf posture traits of millet at heading stage;

[0017] 3) Application in related breeding or auxiliary breeding for improving leaf posture of millet at heading stage.

[0018] Based on the same inventive concept, the present invention also provides a method for predicting the leaf posture of millet at the heading stage, using a specific probe or chip of the SNP site to detect the millet genomic DNA of the prediction object, obtain the base situation of the allele variation site of the SNP site, and predict the leaf posture at the heading stage according to the base situation;

[0019] Alternatively, the DNA of a single leaf or seed of millet is used as a template, and PCR amplification is performed using primers corresponding to the above-mentioned molecular markers. The amplified products are sequenced and identified, and the leaf posture of millet at the heading stage is predicted based on the identification results.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides SNP sites significantly correlated with the leaf posture traits of millet at the heading stage, and develops molecular markers related to the leaf posture traits of millet at the heading stage, thereby linking the genomic DNA sequence with the leaf posture traits of millet at the heading stage, which is beneficial to the establishment of a molecular marker-assisted breeding system for millet, and can provide direction and basis for more precise positioning and millet breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The millet population structure analysis of Example 1 of the present invention;

[0023] Figure 2 LD attenuation distribution diagram of Example 1 of the present invention;

[0024] Figure 3 The Manhattan plot and QQ-Plot plot of the leaf posture traits at heading stage of Example 1 of the present invention are shown. The portion above the dotted line in the figure is the SNP site with significant difference, p<0.01. DETAILED DESCRIPTION

[0025] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0027] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0028] Example 1: Determination of SNP loci and molecular markers associated with leaf posture at heading stage of millet

[0029] In this example, 230 millet materials provided by Zhangjiakou Academy of Agricultural Sciences were selected, and the varieties of the millet materials included the following: Xiaofannuo, Sugu, Hongguzi, Dogtail Millet, Huangxu, Longzhuahuang, Xiangyanggu, Huanggu, Dahuanggu, Maomaohuang, Longgu 26, Longgu 30, Longgu 31, Longgu 17, Longgu 18, Longgu 19, Henggu 10, Henggu 11, Henggu 12, Henggu 21 varieties from various provinces across the country, and Liuwahonggu×Henan 4·2SE165. 5·Xiaomaohuang·Xia1f, Chaoxianggu×Selected Dasui 5·2SE Mixed·8father, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f hybrid varieties, 230 millet materials were sown in the experimental field of Zhangjiakou Academy of Agricultural Sciences in mid-May 2023. Field tests were adopted, and each millet material was planted in 2 rows, with a row length of 2m, a row spacing of 50cm, and a plant spacing of 3-5cm. According to local routine management, field traits of each material were measured at the heading stage.

[0030] DNA samples were extracted from 230 millet materials (leaves). After the DNA quality inspection was qualified, it was quantitatively and qualitatively checked by NanoDropND-2000, Thermo Scientific, and the DNA integrity was tested by gel electrophoresis. According to the conventional method and its standard process, the experimental samples were amplified, fragmented, precipitated, resuspended, hybridized on the chip, and washed according to the standard process of the chip.

[0031] 1) Original millet chip data processing

[0032] First, the raw data obtained by scanning with the GeneTitan system was imported into the software Affymetrix Power Tools, and the raw data was clustered and genotyped using the software. Finally, the PLINK format data was exported through the Affymetrix Power Tools software for subsequent data analysis. The PLINK format data was further converted into SNP VCF format data using the PLINK program, and the VCF format data was further analyzed.

[0033] 2) Conversion of chip SNP data

[0034] The total SNP VCF files above were screened, and the VCF files of SNPs of heading period traits were obtained according to the number of samples with phenotypes at different periods.

[0035] 3) Sample population structure analysis

[0036] ADMIXTURE program was used to perform principal component analysis to obtain the population clustering of the samples.

[0037] 4) Linkage disequilibrium (LD) analysis

[0038] The linkage disequilibrium coefficient (r2) is used to measure the linkage disequilibrium level between SNP sites on chromosomes. When r2 = 0, it means that the population is in linkage equilibrium or has no LD. The larger the r2, the closer the distance between SNP sites. Generally, when r2 is greater than or equal to 0.8, the two sites are considered to be in linkage disequilibrium. The distance between sites corresponding to the decay of r2 to half is used as the linkage disequilibrium decay distance. The VCFtools software is used to calculate the decay value of linkage disequilibrium, and a nonlinear regression model is used to draw a trend graph of the decay of r2 as the physical distance between SNP sites increases.

[0039] 5) GWAS analysis of chip data and prediction of candidate genes

[0040] Based on the customized SNP chip (Affymetrix chip) with 82,738 sites, we further screened SNP sites that appeared in at least 95% of the samples, and obtained a total of 54,975 SNP sites at the heading stage. Entering the formal GWAS analysis, the R package GWASpoly analysis process was used to conduct various phenotypic association analyses at different developmental stages. Under the 1-dom and additive modes, the mixed linear Q+K algorithm (population structure + kinship) was used to find genes within 10kb upstream and downstream of the SNPs with significant phenotypic associations, and functionally annotated the SNP sites. The results showed that the significant SNP associated with the leaf posture of millet at the heading stage had the highest correlation with chromosome 8 (8_6603655). The polymorphism of this site is T / C, and the additive is 11.35. And by Figure 1 It can be seen that the clustering of ADMIXTURE needs to calculate the CV error (correlation error) under different K values. The trend of K value is to decrease first and then increase ( Figure 1 ), the K value at the beginning of the rise is the number of ancestral groups with the best genetic background. This experiment can be divided into approximately 35 ancestral groups. Figure 2 It can be seen that the LD decay distance of the foxtail millet genome in this embodiment is 9 M. A smaller LD decay distance is beneficial to narrowing the candidate regions for subsequent association analysis and improving the accuracy of the association results.

[0041] Example 2: Based on the SNP sites located in the previous example, this example develops molecular markers related to the leaf posture at the heading stage of millet, and the molecular markers include the 6603655th site of the eighth chromosome of millet;

[0042] The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1, and is specifically as follows:

[0043] TAAACATTGAGAAAGCCTGCATACCCGGTAACAAC[C / T]ACGTATTAATAATGGTTACTTCGTACATGCTCACG, the 36th base is a C / T allele variation.

[0044] The above molecular markers can be applied to predict leaf posture at the heading stage. Specifically, according to routine operations, PrimerPremier is used to design molecular primers corresponding to the molecular markers (this is a conventional technology and will not be described here in detail). The genome of millet is used as a template, specifically the DNA of millet leaves or seeds can be used as a template, and primers are used for PCR amplification. The amplification products are sequenced and identified, and the leaf posture traits of millet at the heading stage are predicted based on the identification results.

[0045] Example 3: SNP marker verification

[0046] After heading, the leaf posture of the 230 materials of Example 1 was statistically analyzed. Among them, the leaf posture of 214 materials was flat during heading, and the leaf posture of the remaining materials was upward.

[0047] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The SNP loci associated with millet leaf posture at heading stage are characterized by: The SNP site is located at position 6603655 of chromosome 8 of millet, and its allele variation is T / C.

2. Use of a substance for detecting the polymorphism or genotype of SNP in a millet genome in any of the following, characterized in that: The applications include: 1) Application in predicting leaf posture of millet at heading stage; 2) Application in identification or auxiliary identification of leaf posture traits of millet at heading stage; 3) Application in related breeding or auxiliary breeding for improving leaf posture of millet at heading stage; The SNP site is located at position 6603655 of chromosome 8 of millet, and its allele variation is T / C.

3. Molecular markers related to millet leaf posture at heading stage, characterized in that: The molecular marker includes the 6603655th site of chromosome 8 of millet; The nucleotide sequence of the molecular marker is shown in SEQ ID No.

1.

4. Use of the molecular marker related to millet leaf posture at heading stage according to claim 3 in any of the following applications, characterized in that: The applications include: 1) Application in predicting leaf posture of millet at heading stage; 2) Application in identification or auxiliary identification of leaf posture traits of millet at heading stage; 3) Application in related breeding or auxiliary breeding for improving leaf posture of millet at heading stage.

5. A method for predicting millet leaf posture at heading stage, characterized in that: Using a specific probe or chip for detecting the SNP site described in claim 1, the millet genomic DNA of the prediction object is detected to obtain the base situation of the allele variation site of the SNP site described in claim 1, and predict the leaf posture at the heading stage according to the base situation; Alternatively, the DNA of a single leaf or seed of millet is used as a template, and the primers corresponding to the molecular marker of claim 3 are used for PCR amplification, and the amplified product is sequenced and identified, and the leaf posture of millet at the heading stage is predicted based on the identification results.

Images