Constant isothermal sensitive detection method for detecting monkey pox virus and application

Abstract

The invention belongs to the technical field of in-vitro detection, and particularly relates to a detection method for sensitively detecting monkey pox virus at constant isothermal temperature and application. The detection reagent provided by the invention comprises an RPA freeze-drying reagent and a CRISPR / Cas12a detection system freeze-drying reagent, the RPA freeze-drying reagent comprises an RPA isothermal amplification reagent, Buffer A, a front primer, a rear primer and a mixed freeze-drying protective agent; the CRISPR / Cas12a detection system freeze-drying reagent comprises Cas12a, gRNA (guide ribonucleic acid), ssDNA (single-stranded deoxyribonucleic acid) reporter molecules, Buffer 3.1 and a mixed freeze-drying protective agent. The composition of the mixed freeze-drying protective agent is optimized according to the composition of a detection system and a specific detection method. The kit solves the problems of normal-temperature storage and transportation of RPA / CRISPR detection reagents of the monkey pox virus, has the characteristics of simplicity and convenience in operation, rapidness in detection, high sensitivity, suitability for on-site and large-scale screening and the like, provides an efficient and accurate solution for large-scale screening, and has a very good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of in vitro detection, and specifically relates to a detection method and application of isothermal sensitive detection of monkeypox virus. Background Art

[0002] Monkeypox virus (MPXV) belongs to the genus Orthopoxvirus of the Poxviridae family, along with smallpox and vaccinia viruses, and can be transmitted through body fluids, respiratory tract, and other means. Although skin lesions are the most common clinical symptom of MPXV, the range of diseases that cause skin lesions is wide and does not have differential diagnostic characteristics. Existing laboratory methods still have limitations in distinguishing MPXV from other orthopoxviruses and diagnosing acute monkeypox infection, and cannot achieve rapid, immediate, and sensitive diagnosis of MPXV.

[0003] Recombinase polymerase amplification (RPA) has good sensitivity and isothermal amplification characteristics and is used to detect MPXV, but non-specific products will affect the accuracy of the test results. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and its related protein Cas (CRISPR-associated proteins) system can bind to specific guide RNA (gRNA) to accurately lock the target DNA or RNA sequence and cut it. The combination of RPA and CRISPR-Cas system can simultaneously achieve fast and efficient detection process, and effectively solve the interference problem caused by non-specific amplification products.

[0004] However, the existing method of combining RPA with CRISPR technology requires opening the lid and transferring part of the amplified product, which has the risk of aerosol contamination, and the performance of the detection reagent is also easily affected by temperature. Therefore, the present invention provides a detection method without the risk of aerosol contamination, and a freeze-dried detection reagent and a kit with stable performance at room temperature. Summary of the invention

[0005] In view of the above problems, the present invention provides a detection method and application for isothermal sensitive detection of monkeypox virus.

[0006] A one-step fluorescence detection reagent for monkeypox virus, comprising a RPA lyophilized reagent and / or a CRISPR / Cas12a detection system lyophilized reagent;

[0007] The RPA lyophilized reagent is a lyophilized reagent made from an RPA constant temperature amplification system, and the RPA constant temperature amplification system includes the following components:

[0008] RPA constant temperature amplification reagent 1 / 20-25μL,

[0009] Buffer A55.0-68.8% v / v,

[0010] Forward primer 0.036-0.045μM,

[0011] Post primer 0.036-0.045μM,

[0012] Mixed lyophilized protective agent 20.0-25.0% v / v;

[0013] The CRISPR / Cas12a detection system lyophilized reagent is a lyophilized reagent made from the CRISPR / Cas12a detection system, and the CRISPR / Cas12a detection system includes the following components:

[0014] Cas12a 0.20-0.33μM,

[0015] gRNA 0.20-0.33μM,

[0016] ssDNA reporter molecule 1.2-2μM,

[0017] Buffer 3.18.0-13.3% v / v,

[0018] Mixed lyophilized protective agent 16-26.7% v / v;

[0019] Wherein, the mixed lyophilization protective agent comprises the following components:

[0020] Polyethylene glycol 8-24% w / v,

[0021] Trehalose 2-28% w / v,

[0022] Mannitol 28-56% w / v.

[0023] Preferably, the RPA isothermal amplification system comprises the following components:

[0024] RPA constant temperature amplification reagent 1 / 25μL,

[0025] Buffer A 55% v / v,

[0026] Forward primer 0.036μM,

[0027] The rear primer is 0.036 μM,

[0028] Mixed lyophilized protective agent 20% v / v;

[0029] The CRISPR / Cas12a detection system includes the following components:

[0030] Cas12a 0.25μM,

[0031] gRNA 0.25μM,

[0032] ssDNA reporter molecule 1.5μM,

[0033] Buffer 3.110% v / v,

[0034] Mixed lyophilized protective agent 20% v / v;

[0035] Wherein, the mixed lyophilization protective agent comprises the following components:

[0036] Polyethylene glycol 24% w / v,

[0037] Trehalose 28% w / v,

[0038] Mannitol 56% w / v.

[0039] A one-step test strip detection reagent for monkeypox virus, comprising a RPA freeze-dried reagent and / or a CRISPR / Cas12a detection system freeze-dried reagent;

[0040] The RPA lyophilized reagent is a lyophilized reagent made from an RPA constant temperature amplification system, and the RPA constant temperature amplification system includes the following components:

[0041] RPA constant temperature amplification reagent 1 / 20-25μL,

[0042] Buffer A55.0-68.8% v / v,

[0043] Forward primer 0.036-0.045μM,

[0044] Post primer 0.036-0.045μM,

[0045] Mixed lyophilized protective agent 20-25% v / v;

[0046] The CRISPR / Cas12a detection system lyophilized reagent is a lyophilized reagent made from the CRISPR / Cas12a detection system, and the CRISPR / Cas12a detection system includes the following components:

[0047] Cas12a 0.20-0.33μM,

[0048] gRNA 0.20-0.33μM,

[0049] ssDNA reporter molecule 1.2-2μM,

[0050] Buffer 3.18.0-13.3% v / v,

[0051] Mixed lyophilized protective agent 16-26.7% v / v;

[0052] Wherein, the mixed lyophilization protective agent comprises the following components:

[0053] Sorbitol 8-15% w / v,

[0054] Polyethylene glycol 4-20% w / v,

[0055] Trehalose 35-48% w / v,

[0056] Mannitol 20-40% w / v.

[0057] Preferably, the RPA isothermal amplification system comprises the following components:

[0058] RPA constant temperature amplification reagent 1 / 25μL,

[0059] Buffer A 55% v / v,

[0060] Forward primer 0.036μM,

[0061] The rear primer is 0.036 μM,

[0062] Mixed lyophilized protective agent 20% v / v;

[0063] The CRISPR / Cas12a detection system includes the following components:

[0064] Cas12a 0.25μM,

[0065] gRNA 0.25μM,

[0066] ssDNA reporter molecule 1.5μM,

[0067] Buffer 3.110% v / v,

[0068] Mixed lyophilized protective agent 20% v / v;

[0069] Wherein, the mixed lyophilization protective agent comprises the following components:

[0070] Sorbitol 15% w / v,

[0071] Polyethylene glycol 20% w / v,

[0072] Trehalose 48% w / v,

[0073] Mannitol 40% w / v.

[0074] Preferably, the front primer comprises at least one of the primers having nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2;

[0075] The rear primer includes at least one of the primers having nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4;

[0076] The gRNA includes at least one of the RNAs having nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0077] Preferably, the ssDNA reporter molecule is a single-stranded DNA reporter molecule modified with a fluorescent group and a quenching group.

[0078] The present invention also provides use of the above detection reagent in preparing a monkeypox virus detection kit.

[0079] The present invention also provides a one-step detection kit for monkeypox virus, comprising: Buffer B, glycerol and the above detection reagent.

[0080] A method for one-step detection of monkeypox virus for non-diagnostic purposes using the above-mentioned monkeypox virus one-step detection kit comprises the following steps:

[0081] Step 1, respectively re-dissolve the RPA lyophilized reagent and the CRISPR / Cas12a detection system lyophilized reagent;

[0082] Step 2, add glycerol to the solution of the reconstituted CRISPR / Cas12a detection system freeze-dried reagent and mix well;

[0083] Step 3, adding the Buffer B and the test sample to the solution of the reconstituted RPA freeze-dried reagent, and incubating the solution obtained in step 2 for reaction;

[0084] Step 4, detection by fluorescence detection or color development on a test strip.

[0085] The present invention optimizes primers and gRNA for one-step RPA / CRISPR detection of monkeypox virus, and optimizes the most appropriate lyoprotectant combination for these specific primer and gRNA combinations. Thus, the present invention provides for the first time a lyophilized reagent capable of one-step RPA / CRISPR detection of monkeypox virus and a kit prepared therefrom. The lyophilized reagent and kit have the following beneficial technical effects:

[0086] 1. By optimizing the primer and gRNA sequences and optimizing the freeze-dried protective agent combination, the present invention has good sensitivity, specificity and repeatability for monkeypox virus detection and can meet the needs of practical applications.

[0087] 2. The present invention realizes for the first time the one-step RPA / CRISPR detection reagent of monkeypox virus to be made into a freeze-dried reagent, which has the advantages of convenient storage and transportation, stable reagent performance, and easy use.

[0088] 3. The detection method of the present invention is a one-step detection. There is no need to separate the RPA amplification reaction and the CRISPR / Cas12a detection in two reaction tubes. There is no operation of transferring the reaction solution, which can effectively avoid the contamination problem of nucleic acid aerosol.

[0089] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0090] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1 Schematic diagram of the structure of the microfluidic chip for MPXV RPA / CRISPR detection provided in Example 2.

[0092] Figure 2 This is a graph showing the sensitivity experimental results of the one-step fluorescence detection method for freeze-dried MPXV virus.

[0093] Figure 3 This is a graph showing the specific experimental results of the one-step fluorescence detection method for freeze-dried MPXV virus.

[0094] Figure 4 Sensitivity test results of the one-step test strip detection method for freeze-dried MPXV virus.

[0095] Figure 5 This is a graph showing the specificity experimental results of the one-step test strip detection method for freeze-dried MPXV virus.

[0096] Figure 6 Sensitivity test results of the one-step test strip detection method for freeze-dried MPXV virus (using a microfluidic chip).

[0097] Figure 7 A graph showing the specificity experimental results of the one-step test strip detection method for freeze-dried MPXV virus (using a microfluidic chip). DETAILED DESCRIPTION

[0098] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available products.

[0099] In the following examples and experimental examples, the sources of some commercial reagents are as follows:

[0100] RPA constant temperature amplification reagent, Buffer A and Buffer B are from the DNA constant temperature rapid amplification kit (Cat. No.: WLB8201KIT) of Anpu Future Biotechnology Co., Ltd.; Buffer 3.1 is from New England Biolabs and is a component of EnGenLba Cas12a (Cpf1) (NEB#M0653).

[0101] Example 1 MPXV virus one-step fluorescence detection kit and detection method

[0102] 1. Kit composition and preparation method

[0103] The kit of this embodiment mainly includes RPA / CRISPR system detection reagent freeze-dried balls for monkeypox virus (MPXV) detection, which include RPA freeze-dried reagent balls made by freeze-drying the RPA isothermal amplification system and CRISPR detection reagent freeze-dried balls made by freeze-drying the CRISPR / Cas12a detection system. (Table 1)

[0104] Table 1

[0105]

[0106] In other embodiments, in the RPA constant temperature amplification system, the volume of enzyme-free water can also be adjusted within the range of 0-4.45 as needed.

[0107] The sequences of the front primer and the rear primer are shown in Table 2, wherein the sequence marked with "F" is the front primer, and the sequence marked with "R" is the rear primer. The preferred front primer in this embodiment is RPA-A27-F2, and the rear primer is RPA-A27-R2.

[0108] Table 2 Front primer and rear primer of RPA isothermal amplification

[0109]

[0110] gRNA: The crRNA of Cas12a was designed according to the cleavage characteristics of Cas12a protein, and its sequence number is SEQ ID NO.5, SEQ ID NO.6; the suboptimal PAM sequence (SEQ ID NO.6) is preferred in this embodiment.

[0111] SEQ ID NO.5 is a standard PAM sequence: UAAUUUCUAAGUGUAGAUU CAUUAUUAGGUGGGGGAUG;

[0112] SEQ ID NO.6 is a suboptimal PAM sequence: UAAUUUCUACUAAGUGUAGAUG GUGGGGGAUGGACAACCUU.

[0113] The ssDNA reporter molecule (Reporter) is ssDNA labeled with FAM-BHQ: (6-FAM)TTATT(BHQ1). In other embodiments, the fluorescent group FAM can also be replaced by VIC, HEX, TET, JOE, Cy5, Cy3, TAMRA, etc.

[0114] The composition of the mixed lyophilized protective agent is an aqueous solution containing the following components: 24% w / v polyethylene glycol 6000 (PEG, purchased from Bi oFroxx ), 28% w / v trehalose, 56% w / v mannitol. The percentages are weight volume percentages, g / ml.

[0115] The specific method of making the above RPA / CRISPR detection system into freeze-dried balls is as follows:

[0116] 1. Prepare RPA freeze-dried reagent balls: Use a precise liquid dispensing system to drop 25 μL of the prepared freeze-dried mixed solution of the RPA constant temperature amplification system into liquid nitrogen to condense into round balls. Wait for about 10 seconds for the balls to sink to the bottom of the liquid nitrogen. Pick up the balls and transfer them to a vial that has been pre-cooled with dry ice.

[0117] 2. Prepare freeze-dried pellets of CRISPR / Cas12a detection reagent: Use a precise liquid dispensing system to drop 8 μl of the prepared freeze-dried mixed solution of the CRISPR / Cas12a detection system into liquid nitrogen to condense into round pellets. Wait for about 10 seconds for the pellets to sink to the bottom of the liquid nitrogen. Pick up the pellets and transfer them to a vial that has been pre-cooled with dry ice.

[0118] After the reagent pellets are collected, they are transferred to the freeze dryer. The freeze drying procedure is shown in Table 3:

[0119] Table 3

[0120]

[0121] 2. Detection Method

[0122] First, add 6.8μL of enzyme-free water to reconstitute the CRISPR / Cas12a detection reagent lyophilized pellet, add it to the bottom of the reaction tube, and then add 1.2μL of glycerol and mix well. Then reconstitute the RPA lyophilized pellet with 21μL of enzyme-free water and add it to the reaction tube. Then add 2μL of Buffer B and 2μL of the target to be tested, gently cover the lid, incubate at 37℃ for 1 hour, and place the reaction tube in a constant temperature fluorescence detector to collect fluorescence data every 1 minute.

[0123] Example 2 MPXV virus one-step test strip detection kit and detection method

[0124] 1. Kit composition and preparation method

[0125] The kit of this embodiment mainly includes RPA / CRISPR system detection reagent freeze-dried balls for MPXV virus detection. The composition and preparation method of the freeze-dried balls are basically the same as those in Example 1, except that:

[0126] (1) Different compositions of mixed freeze-dried protective agents

[0127] The composition of the mixed lyophilized protective agent for the one-step test strip detection of MPXV virus in this embodiment is an aqueous solution containing the following components: 15% w / v sorbitol, 20% w / v polyethylene glycol, 48% w / v trehalose, and 40% w / v mannitol. The percentages are mass volume percentages, g / ml.

[0128] (2) Different ssDNA reporter molecules

[0129] The ssDNA reporter molecule (Reporter) is ssDNA labeled with FAM-Biotin: (6-FAM)TTATTATT(Biotin)

[0130] 2. Detection Method

[0131] Method 1:

[0132] Redissolve the CRISPR / Cas12a detection reagent freeze-dried pellet in 6.8 μL of enzyme-free water, add it to the bottom of the reaction tube, and then add 1.2 μL of glycerol and mix well. Then redissolve the RPA freeze-dried reagent pellet with 21 μL of enzyme-free water and add it to the reaction tube. Then add 2 μL of Buffer B and 2 μL of the target to be tested, and incubate at 37 ° C for 1 hour for amplification. Finally, take 1 μL of the reaction product, add 39 μL of 5% PEG chromatography buffer, mix well, insert it into the lateral flow immunochromatography test strip (from Milenia GenLineHybriDetect kit, purchased from Mileniabiotec), and observe the results with the naked eye after 15 minutes.

[0133] Method 2:

[0134] Design a microfluidic chip for MPXV RPA / CRISPR detection, such as Figure 1 As shown, the microfluidic chip includes a reagent area, a mixing channel area, a CRISPR shearing area, and a test strip reading area.

[0135] The detection steps are as follows:

[0136] 1) Add 6.8 μL of enzyme-free water to the CRISPR lyophilized reagent pellet and add it to the bottom of the reagent area, then add 1.2 μL of glycerol. Then, add 21 μL of enzyme-free water to the RPA lyophilized reagent pellet and add it to the reagent area.

[0137] 2) Add 2 μL of Buffer B and 2 μL of the sample to be tested after rapid lysis and release into the reagent area.

[0138] 3) Pass through the channel and enter the reaction area, and incubate at 37°C for 1 hour to carry out the reaction.

[0139] 4) The reaction product flows into the lateral flow immunochromatography test strip in the strip reading area, and the result is observed with the naked eye after 15 minutes.

[0140] The technical solution of the present invention is further illustrated by experiments below.

[0141] Experimental Example 1 Optimal Conditions for One-Step Fluorescence Detection of MPXV Virus

[0142] 1. Primer and crRNA, ssDNA reporter molecule design

[0143] The present invention searches for the full gene sequence (Genome ID: NC_003310.1) of monkeypox virus (MPXV) through NCBI (www.ncbi.nlm.nih.gov), and selects the conservative region of A27L gene (GenBank: ON563414) as the target region.

[0144] The gRNA of Cas12a was designed according to the cleavage characteristics of Cas12a protein. And the designed multiple gRNAs were optimized through experiments. The optimal primers and gRNAs obtained are shown in Example 1.

[0145] 2. Optimization of testing conditions

[0146] This experimental example adjusted the various detection conditions on the basis of Example 1, and compared the fluorescence intensity of the target gene at the same concentration under different conditions. In the same time period, the detection conditions corresponding to the fastest and highest increase in fluorescence intensity were selected as the preferred conditions. The preferred results are shown in Table 4 below:

[0147] Table 4

[0148] Optimal RPA primer concentration 1~2μM Optimal RPA reaction volume 20-25 μL Optimum reaction temperature 37℃ Optimal reaction time 60~90min Optimal CRISPR reaction volume 6-10 μL Optimal crRNA and Cas12a concentration and ratio 1:1 Optimal CRISPR reaction buffer Buffer3.1 Optimal reporter concentration 30~50μM Optimal additive glycerol volume 0.9~1.5μL

[0149] The composition of the optimized optimal RPA / CRISPR detection system is shown in Example 1.

[0150] Experimental Example 2 Screening experiment of mixed lyophilized protective agent for one-step fluorescence detection kit of MPXV virus

[0151] In the following experiments, reagents or conditions not specifically described were performed according to the description of Example 1.

[0152] 1. Screening of single protective agent

[0153] The effects of sorbitol, dextran, PEG, sucrose, trehalose, ammonium acetate, xylitol, mannitol, and dimethyl sulfoxide as lyophilization protectants for RPA detection system and CRISPR detection system on the fluorescence signal were studied.

[0154] 5.0 μl and 1.6 μl of 9 lyophilized protective agents with a concentration of 15% (mass volume percentage, g / ml) were added to the RPA reagent and the CRISPR reagent, respectively, to obtain the RPA / CRISPR detection system containing a single protective agent (Table 5).

[0155] Table 5

[0156]

[0157] The fluorescence intensity of the RPA / CRISPR detection system containing different types of lyophilized protective agents was tested. Compared with the fluorescence intensity of the RPA / CRISPR detection system without lyophilized protective agents, if the fluorescence signal intensity decreased by no more than 10% during the same period of time, it was considered that the protective agent had no inhibitory effect on the detection system. The results are shown in Table 6:

[0158] Table 6 Fluorescence intensity of the RPA / CRISPR detection system containing 15% of a single protective agent

[0159]

[0160]

[0161] The above results show that PEG, sucrose, seaweed and mannitol have no effect on the RPA / CRISPR detection system.

[0162] 2. Suitable concentration range of protective agent

[0163] The above freeze-dried protective agent whose fluorescence signal intensity decreases by no more than 10% is selected, and the concentration is configured to be 1%-64%. The fluorescence intensity of the RPA / CRISPR detection system is tested for different concentrations of freeze-dried protective agent. Compared with the fluorescence intensity of the RPA / CRISPR detection system without freeze-dried protective agent, if the fluorescence signal intensity decreases by no more than 10% within the same time period, it is considered that the concentration has no inhibitory effect on the detection system, and the appropriate concentration range of the protective agent is determined. The results are shown in Table 7:

[0164] Table 7 Suitable concentration range of protective agent for RPA / CRISPR detection system

[0165]

[0166] The above results show that the suitable concentration range of PEG is 8%-48%, the suitable concentration range of sucrose is 4%-40%, the suitable concentration range of trehalose is 2%-56%, and the suitable concentration range of mannitol is 4%-56%.

[0167] 3. Screening of freeze-dried protective agents for RPA isothermal amplification reagents

[0168] 1) The contents of PEG, sucrose, trehalose and mannitol were optimized by orthogonal experimental design with 4 factors and 3 levels, as shown in Tables 8 and 9.

[0169] Table 8. Factor level table

[0170] factor Level 1 Level 2 Level 3 PEG 0％ 24％ 48％ sucrose 0％ 20％ 40％ Trehalose 0％ 28％ 56％ Mannitol 0％ 28％ 56％

[0171] Table 9. Scheme

[0172]

[0173] 2) All the above 9 schemes were selected, and the RPA isothermal amplification reagent was freeze-dried. The preparation method of the freeze-dried reagent was performed according to the method in Example 1. The freeze-drying system is shown in Table 10:

[0174] Table 10

[0175]

[0176] 3) Morphological examination of freeze-dried pellets of RPA isothermal amplification reagent:

[0177] The preparation method of the RPA constant temperature amplification reagent freeze-dried ball is prepared according to Example 1. After the preparation is completed, the appearance of the RPA constant temperature amplification reagent freeze-dried ball is observed to see whether it is qualified. The test results are shown in Table 11:

[0178] Table 11RPA constant temperature amplification reagent freeze-dried ball morphology results

[0179] plan Formability Surface smoothness Completeness Resolubility in conclusion Solution 1 2 1 1 1 Failure Solution 2 2 2 1 1 Failure Solution 3 1 2 2 1 Failure Solution 4 3 3 3 3 qualified Solution 5 3 2 1 1 Failure Solution 6 1 2 2 1 Failure Solution 7 3 3 3 3 qualified Solution 8 3 3 3 3 qualified Solution 9 2 1 2 2 Failure

[0180] The above results show that RPA isothermal amplification reagent lyophilized protectant screening schemes 4, 7, and 8 can be used for the next step of screening.

[0181] 4) Moisture content of RPA constant temperature amplification reagent freeze-dried pellet

[0182] The moisture content of the RPA constant temperature amplification reagent freeze-dried balls that passed the above morphological inspection was measured using a card type moisture meter. The results are shown in Table 12:

[0183] Table 12 Water content of RPA constant temperature amplification reagent freeze-dried balls

[0184] plan Moisture content in conclusion Solution 4 3.52％ qualified Solution 7 1.86％ qualified Solution 8 5.36％ Failure

[0185] The above results show that RPA isothermal amplification reagent lyophilized protectant screening schemes 4 and 7 can be used for the next step of screening.

[0186] 5) Select the RPA freeze-dried reagent balls with qualified moisture content for performance inspection

[0187] First, add 8μL of CRISPR / Cas12a detection system to the bottom of the reaction tube. Then reconstitute the RPA freeze-dried reagent ball with 21μL of enzyme-free water and add it to the reaction tube. Then add 2μL Buffer B and 2μL of the target to be tested, gently cover the lid, and set up negative and positive controls. Incubate at 37°C for 1 hour, place the reaction tube in a constant temperature fluorescence detector, and continue to collect fluorescence data every 1 minute. The fluorescence results of the above scheme are compared with the fluorescence intensity of the unfreeze-dried RPA detection system and the CRISPR detection system. The results are shown in Table 13:

[0188] Table 13 RPA constant temperature amplification reagent freeze-dried reagent ball fluorescence intensity

[0189] plan Fluorescence intensity increase Solution 4 99％ Solution 7 92％

[0190] The above results show that RPA isothermal amplification reagent lyophilized protectant screening schemes 4 and 7 can be used for the next step of screening.

[0191] 6) Select the above qualified RPA constant temperature amplification reagent lyophilization protectant solution, and lyophilize the CRISPR / Cas12a detection reagent. The lyophilization system is shown in Table 14:

[0192] Table 14 CRISPR / Cas12a freeze-drying system

[0193]

[0194] 7) Morphological examination of freeze-dried pellets of CRISPR / Cas12a detection reagent:

[0195] The preparation method of the CRISPR / Cas12a detection reagent freeze-dried ball was prepared according to Example 1. After the preparation was completed, the appearance of the CRISPR / Cas12a detection reagent freeze-dried ball was observed to see whether it was qualified. The test results are shown in Table 15:

[0196] Table 15 CRISPR / Cas12a detection reagent freeze-dried pellet morphology results

[0197] plan Formability Surface smoothness Completeness Resolubility in conclusion Solution 4 3 3 3 3 qualified Solution 7 3 3 3 3 qualified

[0198] The above results show that the CRISPR / Cas12a detection reagent lyophilized protectant screening schemes 4 and 7 are qualified and can be used for the next step of screening.

[0199] 8) Moisture content of CRISPR / Cas12a detection reagent freeze-dried pellets

[0200] The moisture content of the CRISPR / Cas12a detection reagent freeze-dried pellets that passed the above morphological inspection was measured using a cardiometer, and the results are shown in Table 16:

[0201] Table 16 Moisture content of CRISPR / Cas12a detection reagent freeze-dried pellets

[0202]

[0203]

[0204] Conclusion: Both Scheme 4 and Scheme 7 of the CRISPR / Cas12a detection reagent lyophilized protectant screening were qualified and can be used for the next step of screening.

[0205] 9) Select the CRISPR / Cas12a detection reagent freeze-dried pellets with qualified moisture content for performance inspection

[0206] The performance test was performed according to the detection method in Example 1. The fluorescence results of the above scheme were compared with the fluorescence intensity of the unfreeze-dried RPA detection system and the CRISPR detection system. The results are shown in Table 17:

[0207] Table 17 Fluorescence intensity of CRISPR / Cas12a detection reagent freeze-dried reagent spheres

[0208] plan Fluorescence intensity Solution 4 97％ Solution 7 87％

[0209] The above results show that for the MPXV virus one-step fluorescence detection kit and detection method of the present invention, Scheme 4 is the best mixed lyophilized protective agent formula.

[0210] Experimental Example 3 Performance Verification of One-Step Fluorescence Detection Method for Freeze-dried MPXV Virus

[0211] 1. Sensitivity test

[0212] The performance test was carried out according to the detection method in Example 1, wherein 10 -1 -10 5 aM of 2μL of the target to be tested, and set up negative control and positive control to obtain the results as follows Figure 2 As shown: when the monkeypox virus concentration is 10aM, the fluorescence intensity can be clearly detected, indicating that the fluorescence detection method of the kit of Example 1 has high sensitivity.

[0213] 2. Specificity test

[0214] The performance test was performed according to the detection method in Example 1, wherein the plasmid standards of monkeypox, smallpox, cowpox, and vaccinia viruses were used as samples to be tested. Figure 3 As shown, the results show that the fluorescence detection method of the kit of Example 1 is specific to the plasmid standard of monkeypox virus.

[0215] The above experimental results show that the MPXV virus one-step fluorescence detection kit and detection method provided in Example 1 have excellent detection performance and can meet the requirements of actual detection.

[0216] Experimental Example 4 Optimal Conditions for One-Step Test Strip Detection of MPXV Virus

[0217] This experimental example adjusted the various conditions of the test strip detection on the basis of Example 2, and compared the fluorescence intensity of the target gene at the same concentration under different conditions. In the same time period, the detection conditions corresponding to the fastest color development speed and the most obvious color development were selected as the preferred conditions. The preferred results are shown in Table 18 below

[0218] Table 18

[0219] Optimal RPA primer concentration 1~2μM Optimal RPA reaction volume 20-25 μL Optimum reaction temperature 37℃ Optimal reaction time 60~90min Optimal CRISPR reaction volume 6-10 μL Optimal crRNA and Cas12a concentration and ratio 1:1 Optimal CRISPR reaction buffer Buffer3.1 Optimal reporter concentration 30~50μM Optimal volume of additive glycerol 0.9~1.5μL Optimal reaction product volume 1~2μL Optimal test strip buffer concentration 4～8％ Optimal test strip buffer volume 35~45μL Optimal test strip reaction time 15~20min

[0220] The composition of the optimized optimal RPA / CRISPR detection system is shown in Example 2.

[0221] Experimental Example 5: Screening experiment of mixed lyophilized protective agent for MPXV virus one-step test strip detection kit

[0222] In the following experiments, reagents or conditions not specifically described were performed according to the description of Example 2.

[0223] 1. Screening of single protective agent

[0224] The effects of sorbitol, dextran, PEG, sucrose, trehalose, ammonium acetate, xylitol, mannitol, and dimethyl sulfoxide as lyoprotectants for RPA detection system and CRISPR detection system on the colorimetric signal were studied.

[0225] 5.0 μL and 1.6 μL of 9 lyophilized protective agents with a concentration of 15% (mass volume percentage, g / mL) were added to the RPA reagent and the CRISPR reagent, respectively, to obtain an RPA / CRISPR detection system containing a single protective agent (Table 19)

[0226] Table 19 RPA / CRISPR detection system containing a single protective agent

[0227]

[0228]

[0229] The color intensity of the RPA detection system and the CRISPR detection system containing different types of lyophilized protective agents was tested and compared with the color intensity of the RPA detection system and the CRISPR detection system without lyophilized protective agents. The results are shown in Table 20:

[0230] Table 20 Color intensity of the RPA / CRISPR detection system containing 15% of a single protective agent

[0231] 15% lyophilized protective agent Color intensity Sorbitol powerful Dextran weak PEG powerful sucrose powerful Trehalose powerful Ammonium acetate weak Xylitol weak Mannitol powerful Dimethyl sulfoxide weak

[0232] The above results show that sorbitol, PEG, sucrose, trehalose and mannitol have no effect on the color development of the test strips of the RPA / CRISPR detection system.

[0233] 2. Suitable concentration range of protective agent

[0234] The above lyophilized protective agents that have no effect on the RPA / CRISPR detection system were selected, and the concentration was configured to be 1%-64%. The color development effects of different concentrations of lyophilized protective agents on the RPA detection system and the CRISPR detection system were tested to determine the appropriate concentration range of the protective agent. The results are shown in Table 21:

[0235] Table 21 Suitable concentration range of protective agent for RPA / CRISPR detection system

[0236]

[0237]

[0238] The above results show that the suitable concentration range of sorbitol is 8%-40%, the suitable concentration range of PEG is 4%-56%, the suitable concentration range of sucrose is 4%-48%, the suitable concentration range of trehalose is 2%-48%, and the suitable concentration range of mannitol is 2%-56%.

[0239] 3. Screening of freeze-dried protective agents for RPA isothermal amplification reagents

[0240] 1) The contents of sorbitol, PEG, sucrose, trehalose and mannitol were optimized by orthogonal experimental design with 5 factors and 4 levels, as shown in Tables 22 and 23.

[0241] Table 22 Factor level table

[0242] factor Level 1 Level 2 Level 3 Level 4 Sorbitol 0％ 15％ 30％ 40％ PEG 0％ 20％ 40％ 56％ sucrose 0％ 20％ 35％ 48％ Trehalose 0％ 20％ 35％ 48％ Mannitol 0％ 20％ 40％ 56％

[0243] Table 23 Scheme

[0244]

[0245]

[0246] 2) All 16 schemes above were selected, and the RPA isothermal amplification reagent was freeze-dried. The preparation method of the freeze-dried reagent was performed according to the method in Example 1. The freeze-drying system is shown in Table 24:

[0247] Table 24RPA constant temperature amplification reagent freeze-dried system

[0248]

[0249] 3) Morphological examination of freeze-dried pellets of RPA isothermal amplification reagent:

[0250] The preparation method of the RPA constant temperature amplification reagent freeze-dried ball is prepared according to Example 2. After the preparation is completed, the appearance of the RPA constant temperature amplification reagent freeze-dried ball is observed to see whether it is qualified. The test results are shown in Table 25:

[0251] Table 25RPA constant temperature amplification reagent freeze-dried ball morphology results

[0252]

[0253]

[0254] The above results show that RPA isothermal amplification reagent lyophilized protectant screening schemes 6, 7, 11, and 14 can be used for further screening.

[0255] 4) Moisture content of RPA constant temperature amplification reagent freeze-dried pellet

[0256] The moisture content of the RPA constant temperature amplification reagent freeze-dried balls that passed the above morphological inspection was measured using a card type moisture meter. The results are shown in Table 26:

[0257] Table 26 Water content of RPA constant temperature amplification reagent freeze-dried balls

[0258] plan Moisture content in conclusion Solution 6 1.86％ qualified Solution 7 2.21％ qualified Solution 11 4.55％ qualified Solution 14 3.89％ qualified

[0259] The above results show that RPA isothermal amplification reagent lyophilized protectant screening schemes 6, 7, 11, and 14 can be used for further screening.

[0260] 5) Select the RPA freeze-dried reagent balls with qualified moisture content for performance inspection

[0261] First, add 8μL of CRISPR / Cas12a detection system to the bottom of the reaction tube. Then, reconstitute the RPA lyophilized reagent ball with 21μL of enzyme-free water and add it to the reaction tube. Subsequently, add 2μL Buffer B and 2μL of the target to be tested, and set up negative and positive controls. Incubate at 37°C for 1 hour for amplification. Finally, take 1μL of the reaction product, add 39μL of 5% PEG chromatography buffer, mix well, insert the lateral flow immunochromatography test strip, and observe the results with the naked eye after 15 minutes. The results of the above test strips are compared with the color development of the test strips of the unfreeze-dried RPA detection system and the CRISPR detection system, and the results are shown in Table 27:

[0262] Table 27RPA constant temperature amplification reagent freeze-dried ball color intensity

[0263]

[0264]

[0265] The above results show that RPA isothermal amplification reagent lyophilized protectant screening schemes 6, 7, and 11 can be used for further screening.

[0266] 6) Screening of freeze-dried protective agents for CRISPR / Cas12a detection reagents

[0267] Select the above qualified RPA constant temperature amplification reagent lyophilization protectant solution, and lyophilize the CRISPR / Cas12a detection reagent. The lyophilization system is shown in Table 28:

[0268] Table 28

[0269]

[0270] 7) Morphological examination of freeze-dried pellets of CRISPR / Cas12a detection reagent:

[0271] The preparation method of the CRISPR / Cas12a detection reagent freeze-dried ball was prepared according to Example 1. After the preparation was completed, the appearance of the CRISPR / Cas12a detection reagent freeze-dried ball was observed to see whether it was qualified. The test results are shown in Table 29:

[0272] Table 29 CRISPR / Cas12a detection reagent freeze-dried pellet morphology results

[0273] plan Formability Surface smoothness Completeness Resolubility in conclusion Solution 6 3 3 3 3 qualified Solution 7 2 2 2 1 Failure Solution 11 3 3 3 3 qualified

[0274] The above results show that the CRISPR / Cas12a detection reagent lyophilized protectant screening schemes 6 and 11 have qualified appearance and can be used for further screening.

[0275] 8) Moisture content of CRISPR / Cas12a detection reagent freeze-dried pellets

[0276] The moisture content of the CRISPR / Cas12a detection reagent freeze-dried pellets that passed the above morphological inspection was measured using a cardiometer, and the results are shown in Table 30:

[0277] Table 30 Moisture content of CRISPR / Cas12a detection reagent freeze-dried pellets

[0278] plan Moisture content in conclusion Solution 6 1.86％ qualified Solution 11 1.93％ qualified

[0279] The above results show that the CRISPR / Cas12a detection reagent lyophilized protectant screening schemes 6 and 11 are qualified.

[0280] 9) Select the CRISPR / Cas12a detection reagent freeze-dried pellets with qualified moisture content for performance inspection

[0281] The performance test was performed according to the detection method 1 in Example 2. The color development results of the test strips of the above scheme were compared with the color development results of the test strips of the unfreeze-dried RPA detection system and the CRISPR detection system. The results are shown in Table 31:

[0282] Table 31 CRISPR / Cas12a detection reagent freeze-dried reagent ball color intensity

[0283] plan Color intensity Solution 6 powerful Solution 11 weak

[0284] The above results show that for the MPXV virus one-step test strip detection kit and detection method of the present invention, Scheme 6 is the optimal mixed lyophilized protective agent formula.

[0285] Experimental Example 6 Performance Verification of the One-Step Test Strip Detection Method for Freeze-dried MPXV Virus The detection method of this experimental example was performed according to Method 1 in Example 2.

[0286] 1. Sensitivity test

[0287] The performance test was carried out according to the detection method 1 in Example 2, wherein 10 -1 -10 5 aM of 2μL of the target to be tested, the results are as follows Figure 4 As shown, the lowest virus concentration that can be detected by the test strip detection method of the kit of Example 2 is 10aM, and the sensitivity is high.

[0288] 2. Specificity test

[0289] The performance test was performed according to the detection method 1 in Example 2, wherein the plasmid standards of monkeypox, smallpox, cowpox, and vaccinia viruses were used as samples to be tested. The results are as follows Figure 5As shown, the test strip detection method of the kit of Example 2 can only detect the plasmid standard of monkeypox virus, which shows that the detection method of the present invention has strong specificity.

[0290] Experimental Example 7 Performance Verification of Freeze-dried MPXV Virus One-War Test Strip Detection Method (Using Microfluidic Chip)

[0291] The detection method of this experimental example is performed according to method 2 in Example 2.

[0292] 1. Sensitivity test

[0293] The designed concentration gradient is 10 -1 -10 5 aM of the sample to be tested was operated according to the experimental steps in Example 2. Figure 6 As shown, the results show that the lowest virus concentration that can be detected by the test strip detection method (using a microfluidic chip) in Example 2 is 10aM, with high sensitivity.

[0294] 2. Specificity test

[0295] Select a concentration of 10 5 aM monkeypox, smallpox, cowpox, and vaccinia viruses were used as test samples. The experimental steps in Example 2 were followed. Figure 7 As shown, the results indicate that the test strip detection method (using a microfluidic chip) in Example 2 is specific for detecting the plasmid standard of monkeypox virus.

[0296] The above experimental results show that the MPXV virus one-step test strip detection kit and detection method provided in Example 2 have excellent detection performance and can meet the requirements of actual detection.

[0297] In summary, the present invention solves the problem of room temperature storage and transportation of one-step RPA / CRISPR detection reagents for MPXV virus, supports POCT (point-of-care testing) and home self-testing; and ensures high sensitivity and specificity of detection, realizes early, rapid, portable and simple operation of MPXV detection, overcomes the traditional method's dependence on expensive equipment and professionals, and provides an efficient and accurate solution for large-scale screening.

Claims

1. A one-step fluorescence detection reagent for monkeypox virus, characterized in that: It includes RPA lyophilized reagent and / or CRISPR / Cas12a detection system lyophilized reagent; The RPA lyophilized reagent is a lyophilized reagent made from an RPA constant temperature amplification system, and the RPA constant temperature amplification system includes the following components: RPA constant temperature amplification reagent 1 / 20-25μL, Buffer A55.0-68.8% v / v, Forward primer 0.036-0.045μM, Post primer 0.036-0.045μM, Mixed lyophilized protective agent 20.0-25.0% v / v; The CRISPR / Cas12a detection system lyophilized reagent is a lyophilized reagent made from the CRISPR / Cas12a detection system, and the CRISPR / Cas12a detection system includes the following components: Cas12a 0.20-0.33μM, gRNA 0.20-0.33μM, ssDNA reporter molecule 1.2-2μM, Buffer 3.18.0-13.3% v / v, Mixed lyophilized protective agent 16-26.7% v / v; Wherein, the mixed lyophilization protective agent comprises the following components: Polyethylene glycol 8-24% w / v, Trehalose 2-28% w / v, Mannitol 28-56% w / v.

2. The one-step fluorescence detection reagent for monkeypox virus according to claim 1, characterized in that: The RPA isothermal amplification system includes the following components: RPA constant temperature amplification reagent 1 / 25μL, Buffer A 55% v / v, Forward primer 0.036μM, The rear primer is 0.036 μM, Mixed lyophilized protective agent 20% v / v; The CRISPR / Cas12a detection system includes the following components: Cas12a 0.25μM, gRNA 0.25μM, ssDNA reporter molecule 1.5μM, Buffer 3.110% v / v, Mixed lyophilized protective agent 20% v / v; Wherein, the mixed lyophilization protective agent comprises the following components: Polyethylene glycol 24% w / v, Trehalose 28% w / v, Mannitol 56% w / v.

3. A one-step test strip for monkeypox virus, characterized in that: It includes RPA lyophilized reagent and / or CRISPR / Cas12a detection system lyophilized reagent; The RPA lyophilized reagent is a lyophilized reagent made from an RPA constant temperature amplification system, and the RPA constant temperature amplification system includes the following components: RPA constant temperature amplification reagent 1 / 20-25μL, Buffer A55.0-68.8% v / v, Forward primer 0.036-0.045μM, Post primer 0.036-0.045μM, Mixed lyophilized protective agent 20-25% v / v; The CRISPR / Cas12a detection system lyophilized reagent is a lyophilized reagent made from the CRISPR / Cas12a detection system, and the CRISPR / Cas12a detection system includes the following components: Cas12a 0.20-0.33μM, gRNA 0.20-0.33μM, ssDNA reporter molecule 1.2-2μM, Buffer 3.18.0-13.3% v / v, Mixed lyophilized protective agent 16-26.7% v / v; Wherein, the mixed lyophilization protective agent comprises the following components: Sorbitol 8-15% w / v, Polyethylene glycol 4-20% w / v, Trehalose 35-48% w / v, Mannitol 20-40% w / v.

4. The monkeypox virus one-step test strip detection reagent according to claim 3, characterized in that: The RPA isothermal amplification system includes the following components: RPA constant temperature amplification reagent 1 / 25μL, Buffer A 55% v / v, Forward primer 0.036μM, The rear primer is 0.036 μM, Mixed lyophilized protective agent 20% v / v; The CRISPR / Cas12a detection system includes the following components: Cas12a 0.25μM, gRNA 0.25μM, ssDNA reporter molecule 1.5μM, Buffer 3.110% v / v, Mixed lyophilized protective agent 20% v / v; Wherein, the mixed lyophilization protective agent comprises the following components: Sorbitol 15% w / v, Polyethylene glycol 20% w / v, Trehalose 48% w / v, Mannitol 40% w / v.

5. The detection reagent according to any one of claims 1 to 4, characterized in that: The front primer includes at least one of the primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; The rear primer includes at least one of the primers having nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; The gRNA includes at least one of the RNAs having nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.

6.

6. The detection reagent according to any one of claims 1 to 4, characterized in that: The ssDNA reporter molecule is a single-stranded DNA reporter molecule modified with a fluorescent group and a quenching group.

7. Use of the detection reagent according to any one of claims 1 to 6 in the preparation of a monkeypox virus detection kit.

8. A one-step detection kit for monkeypox virus, characterized in that: include: Buffer B, glycerol and the detection reagent according to any one of claims 1 to 6.

9. A method for performing one-step detection of monkeypox virus for non-diagnostic purposes using the monkeypox virus one-step detection kit according to claim 8, characterized in that: The steps include: Step 1, respectively re-dissolve the RPA lyophilized reagent and the CRISPR / Cas12a detection system lyophilized reagent; Step 2, add glycerol to the solution of the reconstituted CRISPR / Cas12a detection system freeze-dried reagent and mix well; Step 3, adding the Buffer B and the test sample to the solution of the reconstituted RPA freeze-dried reagent, and incubating the solution obtained in step 2 for reaction; Step 4, detection by fluorescence detection or color development on a test strip.

Images