Application of bacteroides ovale and related products thereof in treatment of non-alcoholic fatty liver disease

Abstract

The invention discloses application of bacteroides ovatus and related products thereof in treatment of non-alcoholic fatty liver disease. The invention finds that the bacteroides ovatus can effectively improve the non-alcoholic fatty liver disease induced by high fat diet and the non-alcoholic fatty liver disease caused by bacteroides faecalis, and meanwhile, the bacteroides ovatus is combined with prebiotics fructooligosaccharide, or the bacteroides ovatus, fructooligosaccharide and bacteroides multiforme are combined, so that the non-alcoholic fatty liver disease caused by high fat diet can be effectively improved. The obtained compound can more effectively treat the non-alcoholic fatty liver disease, specifically, the levels of serum ALT and AST are reduced, the phenotypic abnormality of the liver is reduced, the intestinal flora structure is adjusted, the production of short-chain fatty acid is promoted, the levels of serum lipopolysaccharide (LPS), CD163, IL-1beta and TNF-alpha are reduced, liver macrophages are reduced, and the expression of lipid metabolism related genes is adjusted.

Description

Technical Field

[0001] The present invention relates to the technical field of functional microorganisms, and in particular to application of Bacteroides ovatus and related products thereof in treating non-alcoholic fatty liver disease. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) refers to a chronic liver disease that excludes alcohol and other clear causes. It is characterized by excessive lipid deposition in liver cells and chronic inflammatory response in the liver. If not intervened in time, it can further transform into fatty hepatitis, liver fibrosis, and even cirrhosis. With the improvement of people's living standards, the incidence rate has increased year by year, seriously threatening human health and has become an important global public health issue.

[0003] The pathogenesis of fatty liver is complex and is usually accompanied by dyslipidemia and lipid metabolism disorders. At present, lifestyle changes and drug therapy are two important treatment measures for non-alcoholic fat. For the drug treatment of this disease, the focus is mainly on adjusting drugs for metabolic diseases (insulin sensitizers, antioxidants, lipid-lowering drugs, etc.). At present, there are no specific drugs approved for clinical use. NAFLD is usually benign and reversible in the early stages, and NAFLD intervention drugs are usually ineffective and accompanied by side effects. Therefore, the development of safe and effective dietary supplements will be an important way to intervene in NAFLD diet.

[0004] The specific pathogenesis of NAFLD is still unclear, and more and more evidence supports that intestinal flora imbalance plays an important role in the occurrence and development of NAFLD. Intestinal flora imbalance can induce endotoxemia and the production of short-chain fatty acids, which are metabolites of intestinal flora, thereby affecting the mechanical barrier function of the intestinal mucosa and inducing liver inflammation through enterohepatic circulation, ultimately contributing to the occurrence and development of NAFLD. Intestinal microorganisms are composed of microorganisms such as bacteria, fungi, and viruses in the intestine, among which bacteria account for the highest proportion, up to 95% of the total.

[0005] Bacteroides ovatus is one of the common strains in the intestine. Because it can metabolize polysaccharides and cholesterol, it has broad application prospects for the treatment of diseases such as diabetes, inflammatory bowel inflammation, and cancer, and is considered to be one of the most promising probiotics. At present, multiple patents on the probiotic function of Bacteroides ovatus have been disclosed. For example, Chinese patent CN202311454948.X reports the role of Bacteroides ovatus in protecting neurons, CN202110557174.8 records the application of Bacteroides ovatus in products for the prevention and treatment of Alzheimer's disease, and CN202211167397.4 discloses the application of Bacteroides ovatus in products that reduce the side effects of metabolic anti-tumor drugs. CN201810397714.9 discloses the application of Bacteroides ovatus in alleviating endotoxin infection. CN201410522384.3 reports the application of Bacteroides ovatus in the treatment or prevention of rheumatoid arthritis or its related diseases. However, it is still unclear whether Bacteroides ovatus has strain screening indicators, the in vivo effect and mechanism of regulating blood lipids, and the effect of improving non-alcoholic fatty liver disease.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide application of Bacteroides ovatus and related products thereof in treating non-alcoholic fatty liver disease.

[0008] The present invention is achieved in that:

[0009] In a first aspect, the present invention provides use of a composition containing probiotics in the preparation of a medicament for treating non-alcoholic fatty liver disease, wherein the probiotics in the composition are Bacteroides ovatus.

[0010] In a second aspect, the present invention provides use of a composition containing probiotics in the preparation of a drug for treating non-alcoholic fatty liver disease, wherein the active ingredients in the composition are Bacteroides ovatus and fructooligosaccharide.

[0011] In a third aspect, the present invention provides use of a probiotic-containing composition in the preparation of a medicament for treating non-alcoholic fatty liver disease, wherein the active ingredients in the composition are Bacteroides ovatus, Bacteroides thetaiotaomicron and fructooligosaccharide.

[0012] In a fourth aspect, the present invention provides a probiotic-containing composition, wherein the active ingredient of the composition is selected from at least one of Bacteroides ovatus, Bacteroides thetaiotaomicron and fructooligosaccharide.

[0013] The present invention has the following beneficial effects:

[0014] The present invention uses Bacteroides ovatus and a complex prepared therefrom to regulate non-alcoholic fatty liver disease. The results show that Bacteroides ovatus can effectively improve non-alcoholic fatty liver disease induced by a high-fat diet and non-alcoholic fatty liver disease caused by Bacteroides faecalis. At the same time, the complex obtained by combining Bacteroides ovatus with prebiotic fructooligosaccharides, or combining Bacteroides ovatus, fructooligosaccharides and Bacteroides thetaiotaomicron can more effectively treat non-alcoholic fatty liver disease, which is specifically manifested in reducing serum ALT and AST levels, reducing phenotypic abnormalities of the liver, regulating the structure of intestinal flora, promoting the production of short-chain fatty acids, reducing serum lipopolysaccharide (LPS), CD163, IL-1β and TNF-α levels, reducing liver macrophages, and regulating the expression of genes related to lipid metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0016] Figure 1 The figure is a graph showing changes in body weight and hyperlipidemia indexes of mice in different experimental groups in Example 4;

[0017] Figure 2 The figure is a comparison of the changes in serum ALT and AST levels and liver phenotypes of mice in different experimental groups in Example 4;

[0018] Figure 3 The effect of Bacteroides ovatus on the intestinal flora of NAFLD mice in Example 4;

[0019] Figure 4 The composition of the flora at the family and genus level in Example 4;

[0020] Figure 5 The evolutionary diagram of LEfSe multi-level species difference discriminant analysis (LDA>3) from phylum to family and from phylum to genus in Example 4;

[0021] Figure 6 The effect of Bacteroides ovatus treatment on SCFAs levels in Example 4;

[0022] Figure 7 The effect of Bacteroides ovatus treatment on inflammation in Example 4;

[0023] Figure 8 The effect of Bacteroides ovatus on lipid metabolism related genes in Example 4;

[0024] Fig. 9The effects of each treatment in Example 5 on the body weight, food intake, liver weight and liver index of mice;

[0025] Fig.10 Comparison of HE staining and ORO staining results of mouse liver tissue in Example 5;

[0026] Fig.11 Comparison of body weight and food intake of mice in different experimental groups in Example 6;

[0027] Fig.12 The results of serum biochemical analysis of mice in different experimental groups in Example 6;

[0028] Fig.13 HE staining analysis of mouse liver tissues in different experimental groups in Example 6;

[0029] Fig.14 The effects of different treatments on SCFAs levels in mice in Example 6;

[0030] Fig.15 Comparison of the body weights of mice in different experimental groups in Example 7;

[0031] Fig.16 The results of serum biochemical analysis of mice in different experimental groups in Example 7;

[0032] Fig.17 This is an analysis of liver pathology in Example 7. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0034] Studies have shown that Bacteroides plays an important role in the prevention of NAFLD, and is therefore considered an important candidate for a new probiotic. The strains reported include Bacteroides fragilis, Bacteroides uniformis, Bacteroides thetaiotaomicron, Bacteroides xylanisolvens, and Bacteroides acidifaciens. As one of the main microorganisms in the intestine, Bacteroides ovatus can reduce inflammatory bowel disease and lipopolysaccharide-induced inflammation in mice. At the same time, Bacteroides ovatus can enhance intestinal barrier function, improve inflammation, regulate immune response homeostasis (such as promoting the proliferation and metabolism of immune cells), and produce beneficial metabolites such as short-chain fatty acids (SCFAs). However, there are no studies reporting whether Bacteroides ovatus can prevent or treat NAFLD.

[0035] Based on existing research, the present invention verifies the effect of Bacillus ovatus on non-alcoholic fatty liver disease, and the results show that Bacillus ovatus can effectively treat non-alcoholic fatty liver disease.

[0036] Based on this, the present invention provides the use of Bacteroidetes ovata in the preparation of a drug for treating non-alcoholic fatty liver disease.

[0037] In the present invention, compared with the model group, the Bacteroides ovatus group can effectively reduce the weight gain and hyperlipidemia of mice caused by a high-fat, high-sugar, and high-cholesterol diet (HFHC) with almost no obvious side effects.

[0038] In the model group, the occurrence of spherical degeneration, inflammation and fat deposition in the liver and the liver weight increased significantly. The ovatus group was able to significantly reduce the above phenotypic abnormal changes; it was also able to effectively improve the abnormal increase in serum ALT (P<0.001) and AST (P<0.001) levels.

[0039] Compared with the model group, the Bacteroides ovatus group can cause significant changes in the diversity and composition of intestinal microorganisms, reducing the ratio of Firmicutes to Bacteroidetes (F / B ratio), which is considered an important indicator of intestinal homeostasis. The increase in the F / B ratio is often associated with NAFLD. Therefore, the change in this ratio can indicate the potential role of Bacteroides ovatus in affecting intestinal homeostasis and obesity.

[0040] Compared with the model group, the Bacteroides ovatus group was able to significantly change the production of short-chain fatty acids (SCFAs), including acetate, propionate, isobutyrate, butyrate, and overall short-chain fatty acids. SCFAs help control body weight, including effects on appetite regulation and energy intake, energy expenditure, and lipid oxidation.

[0041] Compared with the model group, the Bacteroides ovatus group could reduce the levels of serum lipopolysaccharide (LPS), CD163, IL-1β and TNF-α, affect the polarization of liver macrophages, and increase M2 polarized macrophages.

[0042] Compared with the model group, the Bacteroides ovatus group was able to downregulate genes related to lipogenesis (such as Srebfl, Acaca, Scd1, and Fasn) and upregulate genes related to fatty acid oxidation (such as Ppara).

[0043] At the same time, the present invention also found in the experimental process that Bacteroides ovatus can not only effectively treat non-alcoholic fatty liver disease induced by a high-fat diet, but also reverse non-alcoholic fatty liver disease caused by Bacteroides stercoris.

[0044] On the basis of the above experiments, the present invention also combines Bacteroides ovatus with prebiotics to prepare compositions containing Bacteroides ovatus, and verifies the therapeutic effects of these compositions on non-alcoholic fatty liver disease. The results show that the composition of Bacteroides ovatus and fructooligosaccharides has better therapeutic effect on non-alcoholic fatty liver disease than Bacteroides ovatus alone.

[0045] Therefore, the present invention also provides the use of a composition consisting of Bacteroides ovatus and fructooligosaccharide in the preparation of a medicament for treating non-alcoholic fatty liver disease.

[0046] In order to improve the therapeutic effect of non-alcoholic fatty liver disease, the present invention optimizes the active ingredients on the basis of the above-mentioned composition. Experiments have proved that when Bacteroides ovatus, fructooligosaccharides and Bacteroides thetaiotaomicron are combined, the therapeutic effect of the composition is better than that of a composition consisting of Bacteroides ovatus and fructooligosaccharides, and a composition consisting of Bacteroides ovatus and Bacteroides thetaiotaomicron.

[0047] According to the above, the present invention can also provide a probiotic-containing composition, wherein the active ingredient of the composition is selected from at least one of Bacteroides ovatus, Bacteroides thetaiotaomicron and fructooligosaccharide.

[0048] In some embodiments, the active ingredient in the probiotic composition is Bacteroides ovatus, and its content is 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL.

[0049] In some embodiments, the active ingredients in the probiotic composition are Bacteroides ovatus and fructooligosaccharide, wherein the content of Bacteroides ovatus is 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL, the content of fructooligosaccharide is 200mg / mL~400mg / mL.

[0050] In some embodiments, the active ingredients in the probiotic composition are Bacteroides ovatus, Bacteroides thetaiotaomicron and fructooligosaccharide, wherein the content of Bacteroides ovatus is 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL, the content of fructooligosaccharide was 200mg / mL~400mg / mL, and the content of Bacteroides thetaiotaomicron was 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL.

[0051] The composition can be used to prepare a medicine for treating non-alcoholic fatty liver disease, wherein the medicine comprises Bacteroides ovatus, preferably, the medicine further comprises fructooligosaccharide, and more preferably, the medicine further comprises Bacteroides thetaiotaomicron.

[0052] In some embodiments, the above-mentioned drugs may further include pharmaceutically acceptable excipients.

[0053] In some embodiments, the above-mentioned drug can be prepared as an oral preparation, specifically, can be prepared as a powder, granules, tablets, oral liquid or granules.

[0054] The present invention does not limit the selection and content of excipients and the preparation method of the drug. The drug excipients and their addition amounts and preparation methods known in the art can be used.

[0055] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0056] The Bacteroides ovatus ATCC 8483, Bacteroides thetaiotaomicron and Bacteroides faecalis involved in the embodiments of the present invention are all existing strains, among which Bacteroides ovatus ATCC 8483 is derived from the American Type Culture Collection (ATCC), and Bacteroides thetaiotaomicron and Bacteroides faecalis are derived from Beina Biotechnology.

[0057] Example 1

[0058] This embodiment provides a composition containing probiotics, wherein the active ingredient is Bacteroides ovatus ATCC 8483, and the content is 1×10 10 CFU / mL.

[0059] Example 2

[0060] This embodiment provides a composition containing probiotics, wherein the active ingredients are Bacteroides ovatus ATCC 8483 and fructooligosaccharide, wherein the content of Bacteroides ovatus is 1×10 10 CFU / mL, and the content of fructooligosaccharide was 300mg / mL.

[0061] Example 3

[0062] This embodiment provides a composition containing probiotics, wherein the active ingredients are Bacteroides ovatus ATCC 8483, fructooligosaccharide and Bacteroides thetaiotaomicron, wherein the content of Bacteroides ovatus is 1×10 10 CFU / mL, the content of fructooligosaccharide was 300 mg / mL, and the content of Bacteroides thetaiotaomicron was 1×10 10 CFU / mL.

[0063] Example 4

[0064] This example is a verification of the therapeutic effect of Bacteroides ovatus on non-alcoholic fatty liver disease, as follows:

[0065] 1. Strain Cultivation

[0066] Bacteroides ovatus ATCC 8483 was strictly cultured anaerobically on blood agar at 37°C. The strain was then anaerobically washed twice with sterile phosphate-buffered saline (PBS), resuspended and adjusted to 1×10 10 CFU / mL sterile PBS. The desuspension of Bacteroides ovatus ATCC 8483 was cultured on brain heart infusion agar medium to ensure good growth to confirm the viability of the bacteria.

[0067] In the in vivo experiment, C57BL / 6J mice were orally administered 0.2 mL of the above-mentioned Bacteroides ovatus PBS suspension 3 times a week for a total of 8 weeks. Each dose contained 2×10 9 Bacteroides ovatus.

[0068] 2. Establishment of Animal Model

[0069] All animal experimental procedures in this study were approved by the Ethics Committee of Sichuan Academy of Medical Sciences People's Hospital (approval number 2023-311). Male C57BL / 6J mice (4–5 weeks old) were purchased from Shanghai South Model Organisms Company (Shanghai, China).

[0070] Housing conditions: Animals were allowed to eat and drink freely, the temperature was maintained at 23℃~25℃, the humidity was 55%±5%, and the day and night cycle was 12h per day.

[0071] First, they were fed with ordinary feed, and after 1 week of adaptive feeding, the mice were randomly divided into 3 groups, namely:

[0072] Normal diet (NCD);

[0073] a high-fat and high-cholesterol (HFHC) diet (group M);

[0074] High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483 (M_Bo group).

[0075] The mice in the NCD group were fed a standard chow diet, while the mice in the M and M_Bo groups were fed a high-fat, high-cholesterol diet (HFHC) (containing 40% coconut oil, 20% fructose, and 2% cholesterol) for 4 weeks. They were then given PBS (vehicle group) and Bacteroides ovatus ATCC 8483 (1×10 10 Each mouse was orally administered with 0.2 mL of the above-mentioned Bacteroides ovatus PBS suspension (containing 2×10 9 CFU). 3 times a week for a total of 8 weeks. Food intake and body weight were monitored weekly.

[0076] The specific dosage is as follows:

[0077] Table 1. Drug administration methods in different experimental groups

[0078] Experimental Group 4 weeks 8 weeks NCD Group Normal diet Normal diet Group M High-fat, high-cholesterol diet High-fat, high-cholesterol diet M_Bo group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483

[0079] 3. Sample Collection

[0080] At the end of the experiment, each mouse was placed in a sterilized empty cage without any food for 10-15 minutes, and fecal specimens were collected and stored at -80°C. After anesthesia with ether, blood was collected from the portal vein. The blood samples were coagulated in microcentrifuge tubes for 30 minutes and centrifuged at 12,000×g for 2 minutes at 4°C. Serum samples were taken and stored at -80°C for further examination. After euthanasia by cervical dislocation, the liver was removed, weighed, and partly fixed in 4% neutral paraformaldehyde for histological examination, and partly fixed in liquid nitrogen for further analysis.

[0081] (1) Liver index

[0082] After the experiment, the mice were weighed, and the whole liver was taken out and weighed after the mice were killed. The liver index of the mice was calculated according to the formula: liver index = liver weight / body weight × 100%.

[0083] (2) Biochemical analysis

[0084] The levels of serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), total triglyceride (TG) and total cholesterol (TC) were measured using an automatic biochemical analyzer (Siemens ADVIA 1650).

[0085] (3) Detection of LPS, CD163 and serum cytokine levels

[0086] ELISA kits were used to detect LPS (InvivoGen, USA), CD163 (BD ​​Biosciences Pharmigen CA), and serum cytokine levels, including IL-1β, tumor necrosis factor α (TNF-α), IL-6 (Biolegend CA), and IL-22 (Nanjing Jiancheng Bioengineering Institute, China), according to the kit instructions of the biological company.

[0087] (4) Histological examination of liver in experimental mice

[0088] 1) Preparation of tissue paraffin sections and HE staining

[0089] S1. Preparation of tissue paraffin sections: Mouse liver tissue was fixed in 4% paraformaldehyde solution for 24 hours and then dehydrated in 70% ethanol (24 hours), 80% ethanol (2 hours), 90% ethanol (2 hours), 95% ethanol (4 hours), and 100% ethanol (2 hours) in a gradient manner.

[0090] Finally, the tissue was immersed in xylene for 20 min × 2 times to make the tissue transparent. Then the tissue was embedded: the wax-immersed tissue was placed in melted solid paraffin and quickly cooled, trimmed, sliced ​​(4 μm) with a paraffin microtome, and dried.

[0091] S2.HE staining: paraffin sections were dewaxed by soaking in xylene, anhydrous ethanol, 95%, 85%, and 75% alcohol in turn, and then stained in hematoxylin and eosin staining solution to make them transparent. The sections were air-dried and sealed with neutral gum.

[0092] S3. Reading: Take pictures under an optical microscope.

[0093] 2) Oil Red O (ORO) detection of lipids

[0094] Liver tissue was cut with a frozen microtome, rewarmed and dried, fixed with fixative, and stained with Oil Red O at 37°C for 10 min. Finally, the sections were stained with hematoxylin, rinsed, and observed under a microscope. The NAFLD activity scoring system (NAS) was used to assess the histological severity.

[0095] (5) Immunofluorescence staining

[0096] Double immunofluorescence staining was used to detect the fluorescence intensity of F4 / 80 and CD163 in the liver. Liver tissue sections were incubated in F4 / 80 (diluted at 1:50) and CD163 specific antibodies at 4°C overnight. After washing three times, the tissue sections were incubated in 1:200 secondary antibodies at room temperature for 1 hour. After washing three times again, the nuclei were counterstained with DAPI-Fluoromount-G (Southern Biotech, USA). Finally, the stained liver sections were analyzed using a fluorescence microscope (Olympus BX51, Japan).

[0097] (6) Analysis of intestinal flora diversity

[0098] Six mice were selected from each group for intestinal flora analysis. Total genomic DNA was extracted from mouse feces using the PF mago-bind fecal total DNA extraction kit (Omega Biotek, Georgia, USA). Primers 338F-5′-actcctacgggaggcagag-3′ (SEQ ID NO: 1) and 806R-5′-GGACTACHVGGGTWTCTAAT-3′ (SEQ ID NO: 2) were selected to amplify the V3-V4 hypervariable region of the bacterial 16S rRNA gene. The amplified products were extracted and purified from 2% agarose gel, and the purified amplified products were sequenced on the Illumina PE300 / PE250 platform (Illumina, San Diego, USA) of Meiji Biotechnology Co., Ltd. (Shanghai, China). The original FASTQ sequencing files were denoised, quality filtered, and merged using QIIME software (version 1.8.0). Then, the optimized sequences with a similarity of 97% were clustered into operational taxonomic units (OTUs) using UPARSE 11. After normalization of the samples with the least sequences, relative OTU abundance was used for diversity analysis. Based on OTU counts, community structure and alpha diversity indices (Simpson diversity index and Shannon diversity index) were calculated to evaluate the composition of the sample community. Principal coordinate analysis (PCoA) and non-metric multidimensional scaling analysis (NMDS) were used to evaluate beta diversity. The representative sequences of each OTU were classified using RDP Classifier version 2.13 against the 16S rRNA gene database (Silva v138). The community composition was displayed as a bar graph at the genus, family, and phylum levels. Phylogenetic maps of LEfSe multi-level species discriminant analysis (LDA>3) from phylum to genus and phylum to family were also performed.

[0099] (7) Detection of short-chain fatty acids

[0100] 1) Sample processing: Weigh the fecal sample, add 500 μL PBS, freeze grind, then sonicate and centrifuge, take 200 μL supernatant into a centrifuge tube, then add 200 μL n-butanol solvent for extraction, and after low-temperature sonication, take the supernatant solution into a sample injection vial and put it on the machine.

[0101] 2) GC-MS detection: Agilent's 8890B-5977B / 7000D gas chromatograph-mass spectrometer was used to perform GC-MS targeted metabolomics analysis on the samples (Shanghai Meiji Biopharmaceutical Technology Co., Ltd.).

[0102] Gas phase conditions: HP FFAP capillary column (30m×0.25mm×0.25μm, Agilent J&W Scientific, Folsom, CA, USA), carrier gas is high-purity helium (purity not less than 99.999%), flow rate is 1.0mL / min, and the injection port temperature is 180℃. Injection volume is 1μL, split injection, split ratio is 10:1, and solvent extension is 2.5min. Program temperature rise: The initial temperature of the column oven is 80℃, and the temperature is raised to 120℃ at 20℃ / min, and then raised to 160℃ at 5℃ / min, and then maintained at 220℃ for 3min.

[0103] Mass spectrometry conditions: electron impact ion source (EI), ion source temperature 230°C, quadrupole temperature 150°C, transfer line temperature 230°C, electron energy 70 eV. The scanning mode is selected ion scanning mode (SIM).

[0104] Masshunter quantitative software (Agilent, USA, version number: v10.0.707.0) was used with default parameters to automatically identify and integrate the target short-chain fatty acid fragments, and to assist in manual inspection. The detection concentration of each sample was calculated using the standard curve to convert the actual content of short-chain fatty acids in the sample.

[0105] (8) Real-time quantitative PCR detection:

[0106] Total RNA from liver tissue was extracted using a total RNA kit (Vazyme, China) according to the manufacturer's instructions. The primers for Srebfl, Acaca, Scd1, Fasn, Eef2, and Ppara used are shown in the table. Real-time quantitative reverse transcription PCR (qRT-PCR) analysis was performed.

[0107] Table 2 Primer information

[0108] Gene name Forward primer (5′-3′) Reverse primer (5′-3′) Sequence number Srebfl ACTTCTGGAGACATCGCAAAC GGTAGACAACAGCCGCATC SEQ ID NO: 3-4 Acaca GAAGGGACAGTAGAAATCAA CTCCAGTAGAAGAAGGTGC SEQ ID NO: 5-6 SCD1 CTGACCTGAAAGCCGAGAA GCGTTGAGCACCAGAGTGT SEQ ID NO: 7-8 Fasn CTGAGGACTTCCCAAACGG TGGCCTGATGAAACGACAC SEQ ID NO: 9-10 Eef2 CCGTAGGCTTTGGTTCTGG CTGGGCTATTGGCTGACTT SEQ ID NO: 11-12 Ppara ACGGCAATGGCTTTATCAC CCCTCCTGCAACTTCTCAA SEQ ID NO: 13-14 GAPDH AGGCCGGTGCTGAGTATGTC TGCCTGCTTCACCACCTTCT SEQ ID NO: 15-16

[0109] 4. Statistical analysis

[0110] All data are shown as mean ± SEM. Unpaired t-test was used for comparison between two groups; Kruskal-Wallis H test was used for comparison between multiple groups. Statistical analysis was performed using GraphPad Prism software (version 8.0, GraphPad software Inc., USA) and SPSS (SPSS Inc., Chicago, IL, USA). When the P value was less than 0.05 (P < 0.05), the difference was statistically significant.

[0111] 5. Experimental Results

[0112] (1) Figure 1 The figure shows the changes in body weight and hyperlipidemia indexes of mice in different experimental groups. Figure 1 A is the graph of mouse weight changes. Figure 1 B and 1C are the changes in serum TC and TG levels. Data are shown as mean ± SEM (n = 6). *P < 0.05; ***P < 0.001 vs. model (M) group; ns, not significant. As can be seen from the figure, the experimental group of oral administration of Bacteroides ovatus can effectively reduce the weight gain and hyperlipidemia of mice caused by a high-fat, high-sugar, and high-cholesterol diet, and there are almost no obvious side effects.

[0113] (2) Figure 2 The following are the changes in serum ALT and AST levels and liver phenotype comparison of mice in different experimental groups. 2A is serum ALT activity, 2B is serum AST activity, 2C is liver weight, 2D is liver index, 2E is representative liver appearance, liver section H&E and Oil Red O (ORO) staining, and 2F is the quantification of NAFLD activity score (NAS), including liver steatosis score (0-3), hepatocyte ballooning (0-2) and lobular inflammation (0-2). Data are shown as mean ± SEM (n = 6). *P < 0.05; ***P < 0.001 vs model (M) group; ns, not significant. It can be concluded from the figure that the Bacteroides ovatus group can effectively improve the abnormal increase in serum ALT (P < 0.001) and AST (P < 0.001) levels in mice in the M group. Compared with the NCD group, the occurrence of spherical degeneration, inflammation, and fat deposition in the liver, as well as the liver weight, were significantly increased in the M group. Oral administration of Bacteroides ovatus significantly reduced these phenotypic abnormal changes in the liver, as quantified by the NAS histological system.

[0114] (3) Figure 3The effect of Bacteroides ovatus on the intestinal flora of NAFLD mice. Among them, 3A is the Sobs index, 3B is the PcoA analysis, 3C is the NMDS analysis, 3D is the changes in microbial diversity reflected by the Chao and Shannon indices, 3F is the relative abundance of bacteria at the phylum level, and 3G is the ratio of Firmicutes to Bacteroidetes. Data are shown as mean ± SEM (n = 6). *P < 0.05; ***P < 0.001 vs model (M) group; ns, not significant.

[0115] The results of 16s rRNA high-throughput sequencing showed that there were significant differences in taxonomic units (OTUs) between M_Bo and M mice. Both Shannon and Chao's analyses showed that B.ovatus treatment led to a significant increase in OTU diversity. PCoA and NMDS analyses showed that the intestinal microbiota structure of M_Bo group mice was significantly different from that of M group mice. Subsequently, the relative abundance of bacteria was further detected at the phylum, family, and genus levels, respectively. At the phylum level, Firmicutes and Bacteroidetes were the dominant bacteria. The ratio of Firmicutes to Bacteroidetes (F / B ratio) is considered an important indicator of intestinal homeostasis, and an increase in the F / B ratio is often associated with NAFLD. Compared with M group mice, oral administration of B.ovatus resulted in a decrease in the F / B ratio, suggesting a potential role for B.ovatus in affecting intestinal homeostasis and obesity.

[0116] Figure 3 (F, G) are the bacterial community compositions at the phylum level. Figure 4 The left picture shows the bacterial community composition at the genus level, and the right picture shows the bacterial community composition at the family level. It can be seen from the figure that the abundance of Proteobacteria and Verrucomicrobiota at the phylum level and Ruminococcus_torques_group, Ruminococcus_gauvreauii_group, and Erysipelatoclostridium at the genus level decreased, while the fecal abundance of Lachnospiraceae_NK4A136_group, norank_f__Oscillospiraceae, and Colidextribacter increased significantly.

[0117] Figure 5 The left picture shows the evolutionary diagram of LEfSe multi-level species differential discriminant analysis (LDA>3) from phylum to family, and the right picture shows the evolutionary diagram of LEfSe multi-level species differential discriminant analysis (LDA>3) from phylum to genus. Nodes of different colors show that the microbial community is significantly enriched in the corresponding groups.

[0118] Figure 6The effect of Bacteroides ovatus treatment on SCFAs levels can be seen from the figure that oral administration can induce a significant increase in total SCFA compared with the M group. In addition, the contents of acetate, propionate, isobutyrate and butyrate in the M_Bo group were significantly increased (P<0.05), and the levels of butyrate, valeric acid, isovaleric acid and hexanoic acid in mice treated with Bacteroides ovatus also increased, but there was no significant difference compared with the M group. These results indicate that Bacteroides ovatus has a significant regulatory effect on the metabolites of intestinal microbiota, SCFAs.

[0119] Figure 7 7A is the effect of Bacteroides ovatus treatment on inflammation, where 7A is the result of serum IL-6, IL-1β, TNF-α, LPS, IL-22, and CD163 level detection. The figure shows that Bacteroides ovatus treatment can significantly inhibit serum LPS, CD163 and proinflammatory cytokines (such as TNF-α and IL-1β) levels, but has no significant effect on IL-22 or IL-6 levels. 7B is a representative fluorescence microscopy image of liver sections. The results show that the number of F4 / 80 positive cells in mice in the M group was significantly higher than that in the NCD group, and Bacteroides ovatus treatment significantly reduced the number of F4 / 80+ cells in mice in the M_Bo group. As assessed by CD163 immunostaining, the number of M2 macrophages in the liver of mice in the M group increased significantly after 12 weeks of feeding the HFHC diet; however, the CD163 staining density of mice in the M_Bo group was enhanced after treatment with Bacteroides ovatus, indicating that Bacteroides ovatus affects the polarization of liver macrophages and increases M2 polarized macrophages.

[0120] Figure 8 The effect of Bacteroides ovatus on lipid metabolism-related genes (Srebfl, Acaca, Scd1, Fasn, Ppara, Eef2) was studied. The results showed that Bacteroides ovatus could downregulate genes related to lipogenesis (Srebfl, Acaca, Scd1, Fasn) and upregulate genes related to fatty acid oxidation (Ppara).

[0121] Example 5

[0122] This example verifies the therapeutic effect of the combination of Bacteroides ovatus + fructooligosaccharide on non-alcoholic fatty liver disease. The dosage regimen of this experiment is as follows:

[0123] The mice in the NCD group were fed with a standard food diet, while the mice in the M group were fed with a high-fat and high-cholesterol diet (HFHC) (containing 40% coconut oil, 20% fructose and 2% cholesterol); the mice in the M_F group, M_O group and M_F_O group were fed with a high-fat and high-cholesterol diet (HFHC) for 4 weeks and were given FOS (2000 mg / kg, kg is the body weight of each mouse), 0.2 mL of Bacteroides ovatus PBS suspension (containing 2×10 9CFU), and 0.2 mL of PBS suspension of Bacteroides ovatus (containing 2×10 9 CFU) + FOS (2000 mg / kg, kg is the weight of each mouse). 3 times a week for a total of 8 weeks.

[0124] Table 3 Dosage regimen

[0125] Experimental Group 4 weeks 8 weeks NCD Group Normal diet Normal diet Group M High-fat, high-cholesterol diet High-fat, high-cholesterol diet M_F Group High-fat, high-cholesterol diet High-fat, high-cholesterol diet + FOS M_O Group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483 M_F_O Group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483 + FOS

[0126] The test contents include: body weight, food intake, liver weight and liver index; HE staining and ORO staining of liver tissue. The detection method is the same as that of Example 4. The test results are as follows:

[0127] (1) Fig. 9 The effects of each treatment on mouse body weight, mouse food intake, liver weight and liver index show that the combination of Bacteroides ovatus and FOS showed good synergistic effect and significantly reduced mouse body weight and liver index without affecting the mouse food intake.

[0128] (2) Fig.10 Comparison of HE staining and ORO staining results of mouse liver tissue. In the figure, the liver lobule structure of the hepatocytes of mice in the NCD group was normal, with no fat vacuoles and no lipid infiltration. However, the liver of the model group (M group) mice showed obvious fatty degeneration, and the volume of most hepatocytes in the liver lobule increased, with a large number of fat vacuoles and severe lipid infiltration. All intervention groups were able to reduce the fatty degeneration of mouse hepatocytes caused by the HFHC diet to varying degrees, among which the M_F_O combined intervention group had the best improvement effect, with only a small amount of fatty degeneration and fat deposition.

[0129] The above results all indicate that the combination of Bacteroides ovatus (O) + fructooligosaccharide (F) is better than that of Bacteroides ovatus (O) alone.

[0130] Example 6

[0131] This example verifies the therapeutic effect of the combination of Bacteroides ovatus + fructooligosaccharide + Bacteroides thetaiotaomicron on non-alcoholic fatty liver disease. The dosage regimen of this experiment is as follows:

[0132] The mice in the NCD group were fed a standard chow diet, while the mice in the M group were fed a high-fat, high-cholesterol diet (HFHC) (containing 40% coconut oil, 20% fructose, and 2% cholesterol). The mice in the M_O, M_O_A, and M_O_A_F groups were fed a high-fat, high-cholesterol diet (HFHC) for 4 weeks and then given 0.2 mL of PBS suspension of Bacteroides ovatus (containing 2×10 9 CFU), 0.2 mL mixed Bacteroides PBS suspension (containing 2×10 9CFU, where the ratio of Bacteroides ovatus to Bacteroides thetaiotaomicron was 1:1), and 0.2 mL of mixed Bacteroides PBS suspension (containing 2×10 9 CFU, the ratio of Bacteroides ovatus and Bacteroides thetaiotaomicron was 1:1) + FOS (2000 mg / kg, kg is the body weight of each mouse).

[0133] 3 times a week for a total of 8 weeks. Evaluate the therapeutic effect of the formula strain on NAFLD. The specific plan is as follows:

[0134] Table 4 Dosage regimen

[0135] Experimental Group 4 weeks 8 weeks NCD Group Normal diet Normal diet Group M High-fat, high-cholesterol diet High-fat, high-cholesterol diet M_O Group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483 M_O_A group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483 + Bacteroides thetaiotaomicron M_O_A_F Group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus ATCC 8483 + Bacteroides thetaiotaomicron + FOS

[0136] The test contents include: body weight, food intake, serum biochemical test; liver tissue HE staining; short-chain fatty acids. The detection method is the same as in Example 4. The test results are as follows:

[0137] (1) Fig.11 Comparison of body weight and food intake of mice in different experimental groups. Compared with M_O group and M_O_A group, M_O_A_F group can significantly reduce the body weight and food intake of mice.

[0138] (2) Fig.12 The results of serum biochemical tests of mice in different experimental groups. It can be seen from the figure that the M_O_A_F group can more significantly improve the abnormal increase of serum ALT, AST, TC and TG levels of mice in the M group.

[0139] (3) Fig.13 HE staining analysis of mouse liver tissue in different experimental groups: Obvious fatty degeneration was observed in the liver of mice in the model group (M group), and the volume of most hepatocytes in the liver lobules increased, with a large number of fat vacuoles and severe lipid infiltration. Each intervention group was able to reduce the fatty degeneration of mouse liver cells caused by the HFHC diet to varying degrees, among which the M_A_O_F combined intervention group had the best improvement effect, with only a small amount of fatty degeneration and fat deposition. Although the therapeutic effect of the combined use of Bacteroides ovatus and Bacteroides thetaiotaomicron was better than that of Bacteroides ovatus alone, the difference was not significant. Therefore, after the addition of FOS, the probiotic combination formula was further optimized.

[0140] (4) Fig.14 This is the effect of different treatments on the SCFAs level of mice. It can be seen from the figure that after FOS was added, compared with M_O and M_A_O, the intestinal acetic acid and total short-chain fatty acids in the M_A_O_F group increased significantly, compared with M_A_O, the production of pyruvate in the M_A_O_F group increased significantly, and compared with M_O, the production of valeric acid in the M_A_O_F group increased significantly.

[0141] The above results all indicate that the combination of Bacteroides ovatus (O) + Bacteroides thetaiotaomicron (A) + fructooligosaccharide (F) is better than that of Bacteroides ovatus (O) alone, and Bacteroides ovatus + Bacteroides thetaiotaomicron.

[0142] Example 7

[0143] This example is to verify the therapeutic effect of Bacteroides ovatus on non-alcoholic fatty liver disease caused by Bacteroides septicagen (Bs). The experimental scheme of this experiment is as follows:

[0144] Prepare phosphate-buffered saline (PBS) and adjust the concentration of Bacteroides faecalis and Bacteroides ovalis to 1 × 10 10 CFU / mL. In the in vivo experiment, C57BL / 6J mice were orally administered with 0.2 mL of the above-mentioned PBS suspension of Bacteroides ovalis and PBS suspension of Bacteroides feces, 3 times a week, for a total of 8 weeks. The therapeutic effect of the formulated strain on NAFLD was evaluated. The specific scheme is as follows:

[0145] Table 5 Experimental plan

[0146] Experimental Group 2 weeks 11 weeks HFD group High-fat, high-cholesterol diet High-fat, high-cholesterol diet HFD_Bs Group High-fat, high-cholesterol diet High-fat, high-cholesterol diet + fecal Bacteroides HFD_Bs_O group High-fat, high-cholesterol diet High-fat and high-cholesterol diet + Bacteroides ovatus + Bacteroides faecalis

[0147] The test contents include: body weight, serum biochemical determination; liver tissue HE staining and Oil Red O staining; flow cytometry analysis. The following are the steps for flow cytometry:

[0148] Prepare a single cell suspension of mouse liver tissue and count the cells. Select a fluorescently labeled antibody specific for CD11b and F4 / 80. Add the antibody CD11b F4 / 80 to the single cell suspension at the concentration recommended in the antibody manual, incubate at 37°C for 30 minutes, allow the antibody to fully bind to the antigen, and then wash. Use flow cytometry to detect the expression of CD11b and F4 / 80 on the cell surface, and analyze the data.

[0149] The detection method is the same as in Example 4, and the detection results are as follows:

[0150] (1) Fig.15 To compare the weight of mice in different experimental groups, all three groups of mice were given a high-fat diet (HFD) and were gavaged with Bs and Bacteroides ovatus (O) starting from the second week. It can be seen from the figure that Bs can significantly promote the weight gain of mice, while Bacteroides ovatus can reverse the weight gain of mice caused by Bs.

[0151] (2) Fig.16 The results of serum biochemical tests of mice in different experimental groups show that Bacteroides ovatus can significantly reverse the increase of AST, ALT, TC and TG caused by Bs.

[0152] (3) Fig.17The results of H&E staining and Oil Red O staining showed that the liver tissue structure of the model group was severely abnormal, and the situation became more serious after the administration of fecal Bacteroides. Some hepatocytes were severely edematous, the cells were swollen, and the cytoplasm was vacuolated. The addition of Bacteroides ovalis significantly improved the effect of Bacteroides ovalis on the liver tissue structure. The liver tissue structure of the reorganized mice was slightly abnormal, and some liver sinuses were slightly dilated and congested. No fatty degeneration and obvious inflammatory cell infiltration were observed. Therefore, Bacteroides ovalis can alleviate liver damage and has a protective effect on the liver. Oil Red O staining showed that Bs caused a significant increase in lipid droplets in the liver, and the addition of Bacteroides ovalis greatly reduced liver lipid accumulation. At the same time, flow cytometry analysis showed that Bacteroides ovalis could significantly reduce the increase of macrophages.

[0153] The above results all indicate that Bacteroides faecalis can significantly promote non-alcoholic fatty liver disease, and Bacteroides ovatus can reverse non-alcoholic fatty liver disease caused by Bacteroides faecalis.

[0154] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of a composition containing probiotics in the preparation of a drug for treating non-alcoholic fatty liver disease, characterized in that: The probiotic in the composition is Bacteroides ovatus.

2. The use according to claim 1, characterized in that: The non-alcoholic fatty liver disease is induced by a high-fat and high-cholesterol diet.

3. The use according to claim 1, characterized in that: The non-alcoholic fatty liver disease is induced by the combination of Bacteroides faecalis and a high-fat, high-cholesterol diet.

4. The use according to claim 2 or 3, characterized in that: The content of Bacteroides ovatus in the composition is 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL.

5. Use of a composition containing probiotics in the preparation of a drug for treating non-alcoholic fatty liver disease, characterized in that: The active ingredients in the composition are Bacteroides ovatus and fructooligosaccharide.

6. Use of a composition containing probiotics in the preparation of a drug for treating non-alcoholic fatty liver disease, characterized in that: The active ingredients in the composition are Bacteroides ovatus, Bacteroides thetaiotaomicron and fructooligosaccharide.

7. A composition containing probiotics, characterized in that: The active ingredients of the composition are Bacteroides ovatus and fructooligosaccharide.

8. The composition according to claim 7, characterized in that The content of Bacteroides ovatus in the composition is 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL, the content of fructooligosaccharide is 200mg / mL~400mg / mL.

9. A composition containing probiotics, characterized in that: The active ingredients of the composition are Bacteroides ovatus, Bacteroides thetaiotaomicron and fructooligosaccharide.

10. The composition according to claim 9, characterized in that The content of Bacteroides ovatus in the composition is 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL, the content of Bacteroides thetaiotaomicron was 0.8×10 10 CFU / mL~1.2×10 10 CFU / mL, the content of fructooligosaccharide is 200mg / mL~400mg / mL.

Images