A male sterile mouse model constructed by mutating the NAMPT protein and its construction method

Abstract

The present invention relates to a male sterile mouse model constructed by mutating the NAMPT protein and a method for constructing the same, and discloses a method for constructing a male sterile mouse model with asthenospermia by mutating cysteine (Cys) at position 39 of the NAMPT protein to serine (Ser) (NAMPT C39S). The present invention solves the technical problems that affect the research on asthenospermia and mouse infertility, such as poor stability and low efficiency induced by drugs, and simultaneous changes in other reproductive phenotypes or physiological functions after perturbation of certain genes. The animal model disclosed in the present invention is consistent with the result that infertility caused by reduced sperm motility in clinical practice may result in failed fertilization by IVF, but successful fertilization can be achieved by ICSI, increasing the usability of this model, providing a reliable asthenospermia and infertile mouse model for reproductive medicine researchers, and providing new ideas for clinical exploration of the mechanism of action and drug targets of mouse infertility.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and particularly relates to a male sterile mouse model constructed by mutating NAMPT protein and a construction method thereof. Background Art

[0002] Infertility has become a major problem worldwide, affecting approximately 12% of couples of childbearing age. Male factors account for approximately 50% of the causes of infertility. In male infertility, the most common cause is spermatogenesis and dysfunction. According to the standards of the fifth edition of the "WHO Laboratory Manual for the Examination and Processing of Human Semen", when the total sperm motility is less than 40% or the sperm motility forward is less than 32%, it is called asthenozoospermia (AZS). AZS is an important factor causing male fertility disorders.

[0003] The asthenozoospermia mouse model is one of the models for studying mouse infertility. Currently, for the asthenozoospermia model, especially the male mouse infertility model, there are mainly methods of drug induction, including D-galactose, gossypol, estradiol, cyclophosphamide induction, etc. However, the asthenozoospermia model established by D-galactose can cause senescence symptoms of various organs in mice, including the testis; in addition to reducing sperm motility, gossypol-induced asthenozoospermia can also lead to an increase in sperm deformity and the number of sperm deaths; the method of subcutaneous injection of estradiol to construct an azoospermia model is slow to implement and the model is unstable; the oligozoospermia and asthenozoospermia model constructed by cyclophosphamide will also interfere with other physiological functions of mice; in addition, genetic methods including gene mutation, gene knockout, gene knock-in, etc. may also lead to phenotypic changes including, but not limited to, reduced sperm motility. For example, the knockout of Prrc2a can lead to a reduction in testicular volume and spermatogenesis disorders; the inactivation gene generated by deleting the Kif18a gene from the genome or inserting a foreign gene into the Kif18a gene can lead to atrophy of the seminiferous tubules in the mouse testis and the absence of spermatogenic cells. Therefore, none of these current methods can provide an ideal mouse infertility model caused by asthenozoospermia, which brings a lot of inconvenience and trouble to the study of male infertility caused by decreased sperm motility.

[0004] In view of this, the purpose of the present invention is to provide a stable and easily repeatable animal model with no obvious abnormalities in the development and physiological functions of other organs except for the infertility phenotype, so as to provide a reliable research tool for clinically exploring the mechanism of action and drug targets of male infertility. Summary of the Invention

[0005] Aiming at the deficiencies of the existing technology, the purpose of the present invention is to provide a male sterile mouse model constructed by mutating NAMPT protein and a construction method thereof.

[0006] In order to achieve the above invention purpose, the present invention provides the following technical solutions:

[0007] In the first aspect of the present invention, there is provided a gRNA for specifically targeting the NAMPT gene through the CRISPR-Cas9 system, and the sequence of the gRNA is: UGAAAGUUACGGCACUUU.

[0008] Furthermore, the guide RNA (gRNA), also known as single guide RNA (sgRNA), is a small non-coding RNA that can pair with pre-mRNA and insert some uracils (U) therein to generate a functional mRNA. The RNA molecule edited by the guide RNA is about 60-80 nucleotides in length, is transcribed from a separate gene, has a 3'-oligouracil tail, has a sequence in the middle that is precisely complementary to the mRNA to be edited, and has an anchoring sequence at the 5'-end that is complementary to the non-edited mRNA sequence.

[0009] In the second aspect of the present invention, there is provided a CRISPR-Cas9 gene targeting system for constructing a cell or animal model with a mutated NAMPT gene. The CRISPR-Cas9 gene targeting system includes the gRNA specifically targeting the NAMPT gene described in the first aspect of the present invention, Cas9 mRNA, and a donor DNA sequence containing the NAMPT mutation site.

[0010] Furthermore, the cells include eukaryotic cells and prokaryotic cells.

[0011] Furthermore, the mutation of the NAMPT gene is a gene mutation that causes the 39th amino acid of the NAMPT protein to mutate from cysteine to serine.

[0012] Furthermore, the target sequence of the gRNA specifically targeting the NAMPT gene is TTTCACGGCATTCAAAGTAGG, which includes the PAM sequence at the end.

[0013] Furthermore, the PAM sequence is AGG.

[0014] Furthermore, the donor DNA sequence containing the NAMPT mutation site is TAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0015] The third aspect of the present invention provides the use of the gRNA specifically targeting the NAMPT gene described in the first aspect of the present invention and / or the CRISPR-Cas9 gene targeting system described in the second aspect of the present invention in the preparation of a cell / animal model with NAMPT gene mutation or a male sterile animal model.

[0016] The fourth aspect of the present invention provides a method for constructing a male sterile animal model, wherein the animal model expresses a homozygous point mutant protein of the NAMPT gene, and the homozygous point mutant protein is a mutation of the 39th amino acid from cysteine to serine.

[0017] The fifth aspect of the present invention provides a method for constructing a male sterile animal model, the method comprising using the gRNA specifically targeting the NAMPT gene described in the first aspect of the present invention and / or the CRISPR / Cas9 gene targeting system described in the second aspect of the present invention.

[0018] Furthermore, the method comprises: microinjecting the CRISPR / Cas9 gene targeting system described in the second aspect of the present invention to obtain mutant DNA, transferring the fertilized eggs containing the mutant DNA into a female animal, and performing genotype identification on the newborn animals to obtain the chimeric animal F0 generation.

[0019] Furthermore, the mutant DNA sequence is TAGGTTACTCACTATAAACAATACCCACCAAATACAAGCAAAGTTTATTCATATTTTGAATCCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0020] Furthermore, the steps further comprise: crossing the chimeric animal F0 generation with a wild-type animal to obtain a heterozygous animal F1 generation, backcrossing the F1 generation with a wild-type animal to obtain a heterozygous animal F2 generation, and self-crossing the F2 generation to obtain a homozygous animal F3 generation, i.e., the male sterile animal model.

[0021] In some embodiments, the animal model is a rodent, rabbit, pig, cow (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, macaque); preferably, it is a rodent (e.g., mouse, rat and similar animals); particularly preferably, it is a mouse.

[0022] Furthermore, the animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, pigs, monkeys.

[0023] Furthermore, the animal is a mouse.

[0024] The sixth aspect of the present invention provides the application of the method described in the fourth or fifth aspect of the present invention for obtaining an animal model, and the application includes any one of the following:

[0025] 1) Application in constructing a model of male sterility-related diseases.

[0026] 2) Application in studying the pathogenesis of male sterility-related diseases.

[0027] 3) Application in screening candidate drugs for male sterility-related diseases.

[0028] Furthermore, the candidate drugs include protein analogs, antibodies, DNA, RNA, and small molecule compounds.

[0029] Furthermore, the source of the small molecule compound is selected from: newly synthesized or existing databases; where the existing databases include, but are not limited to, general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), traditional Chinese medicine natural product databases (TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industrial catalogs (Greenpharma, AnalytiConDiscovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases de-duplicated with MS data (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases de-duplicated with NMR data (NMRShiftDB, NAPROC-13), etc.

[0030] Furthermore, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and linker DNA.

[0031] Furthermore, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, catalytically active RNA, and various viral RNAs.

[0032] Furthermore, the candidate drug includes various pharmaceutically acceptable salt forms.

[0033] Furthermore, the candidate drug includes a drug used alone or a drug combination.

[0034] Furthermore, the pharmaceutical composition refers to a combination of a candidate drug and a pharmaceutically acceptable carrier.

[0035] As used herein, the term "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions and / or dosage forms that are suitable for use in contact with the tissues of humans and animals within the scope of reasonable medical judgment without excessive toxicity, irritation, allergic reaction or other problems or complications, and that meet a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids and amino acid copolymers. Such carriers are well known to those of ordinary skill in the art. The pharmaceutically acceptable carrier in the pharmaceutical composition can include fluids such as water, saline, glycerol and ethanol. Auxiliary substances such as wetting agents or emulsifying agents, pH buffering substances, etc. can also be present in such media.

[0036] Furthermore, the male sterility-related diseases include azoospermia, oligospermia, asthenospermia, asthenozoospermia and normospermic infertility.

[0037] Furthermore, the male sterility-related disease is asthenospermia.

[0038] The seventh aspect of the present invention provides a method for screening candidate drugs for male sterility-related diseases, the method comprising administering a drug to the animal model described in the fifth aspect of the present invention and / or cells derived from the animal model described in the fifth aspect of the present invention, and if the drug can improve the symptoms related to male sterility in the animal model or cells derived from the animal model, then the drug is a candidate drug for male sterility-related diseases.

[0039] In some embodiments, the improvement means that compared with before the administration of the drug, the symptoms of the animal model (such as sperm morphology, sperm number, sperm motility, etc.) or the cell phenotype derived from the animal model (such as the internal structure of sperm, etc.) are enhanced by at least about 10%, at least about 30%, at least about 50%, at least about 80% or more.

[0040] Advantages and beneficial effects of the present invention: 1. This model is a method for constructing an asthenospermia and mouse infertility model by targeting the NAMPT protein for amino acid mutation. The asthenospermia and mouse infertility effects are stable. The percentage of total motile sperm numbers, the percentage of sperm with forward motility, and sperm-related motility parameters in the NAMPT C39S homozygous mutant mouse model are significantly different from those of wild-type mice, with strong repeatability, and it is an ideal asthenospermia and infertile mouse model.

[0041] 2. The present invention overcomes the problems of poor drug-induced stability, low efficiency, and the difficulty that after certain gene perturbations, other reproductive phenotypes or physiological functions are simultaneously altered, affecting the study of asthenospermia and mouse infertility. Except for the reduced sperm motility and related movement parameters, there are no obvious abnormalities in other reproductive phenotypes and organ development of this model mouse.

[0042] 3. Homozygous point mutation of NAMPT C39S leads to IVF failure without affecting the ICSI result, which is consistent with the clinical result that infertility caused by reduced sperm motility may result in fertilization failure through IVF but can achieve successful fertilization through ICSI, increasing the usability of this model.

[0043] The establishment of this model can provide a reliable asthenospermia and infertile mouse model for reproductive medicine research scholars, and offer new ideas for clinically exploring the mechanism of action and drug targets of mouse infertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a diagram showing the effects of NAMPT C39S point mutation on NAMPT protein in the testis and on the organ development of mice. Figure 1 In [it], A is the overall appearance diagram of the mouse and the diagram of the comparison result of body weight; Figure 1 In [it], B is the appearance diagram of the mouse heart and the diagram of the comparison result of weight; Figure 1 In [it], C is the appearance diagram of the mouse liver and the diagram of the comparison result of liver weight; Figure 1 In [it], D is the appearance diagram of the mouse spleen and the diagram of the comparison result of spleen weight; Figure 1 In [it], E is the appearance diagram of the mouse lung and the diagram of the comparison result of lung weight; Figure 1 In [it], F is the appearance diagram of the mouse kidney and the diagram of the comparison result of kidney weight; Figure 1 In [it], G is the diagram of the expression of NAMPT protein in the testis of mice from P0 - P80 detected by Western blot and the quantification diagram of the protein expression situation; Figure 1 In [it], H is the diagram of the expression of NAMPT proteins in different polymerization forms in the mouse testis detected by BN - PAGE; Figure 1 In [it], I is the diagram of the expression of total NAMPT protein in the mouse testis; Figure 1 In [it], J is the quantification diagram of the expression of NAMPT dimer protein in the mouse testis; Figure 1 In [it], K is the quantification diagram of the ratio of NAMPT dimer and NAMPT monomer proteins in the mouse testis; Figure 1 In [it], L is the quantification diagram of the expression of NAMPT proteins of different sizes and the expression of multimers detected by Western blot and size - exclusion chromatography; Figure 1 In [it], M is the diagram of the expression of NAD + in the mouse testis.

[0045] Figure 2 Figure showing the effects of NAMPT C39S point mutation on mouse spermatogenesis and function Figure 2 A in [Figure] is a representative diagram of mouse testis and epididymis Figure 2 B in [Figure] is a diagram showing the comparison results of mouse testis weights Figure 2 C in [Figure] is a diagram showing the comparison results of mouse epididymis weights Figure 2 D in [Figure] is a diagram showing the localization of NAMPT protein in mouse testis detected by immunofluorescence, Scale bar = 100 μm Figure 2 E in [Figure] is a histological morphology diagram of mouse testis tissues from P0 - P80 detected by HE staining. Original scale bar = 300 μm, magnified detail scale bar = 900 μm Figure 2 F in [Figure] is a representative diagram of mouse sperm morphology detected by HE staining and a diagram of the percentage of normal sperm numbers. Observed under a 40 - fold microscope, Scale bar = 20 µm Figure 2 G in [Figure] is an internal structure diagram of mouse sperm detected by transmission electron microscopy, Scale bar = 300 nm Figure 2 H in [Figure] is a diagram showing the results of detecting mouse sperm numbers by manual counting Figure 2 I in [Figure] is a diagram showing the results of detecting the percentages of forward - moving and total motile sperm in mice by CASA Figure 2 J in [Figure] is a diagram showing the results of detecting VAP, VSL, and VCL of mouse sperm by CASA Figure 2 K in [Figure] is a diagram showing the results of detecting ALH of mouse sperm by CASA Figure 2 L in [Figure] is a diagram showing the results of detecting mouse serum T by ELISA Figure 2 M in [Figure] is a diagram showing the results of detecting mouse serum LH by ELISA Figure 2 N in [Figure] is a diagram showing the results of detecting mouse serum FSH by ELISA

[0046] Figure 3 Diagrams of mouse IVF and ICSI flowcharts and embryo development Figure 3 A in [Figure] is the IVF flowchart Figure 3 B in [Figure] is a diagram of IVF embryo development of WT, HE, and KI mice, Scale bar = 100 μm Figure 3 C in [Figure] is the IVF flowchart Figure 3 D in [Figure] is a diagram of ICSI embryo development of WT, HE, and KI mice, Scale bar = 100 μm

[0047] Figure 4 Figure showing the effects of NAMPT C39S point mutation on male mouse fertility Specific implementation methods

[0048] To enable those skilled in the art to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention.

[0049] Example 1 Construction and Verification of a Male Sterile Mouse Model

[0050] I. Experimental Reagents and Instruments

[0051] 1. Main reagents: (1) Mouse Genotype Identification Kit (B40015, Selleck, USA); (2) HE Staining Kit (C0105S, Beyotime Biotechnology Co., Ltd., China); (3) Hydrochloric Acid Ethanol Rapid Differentiation Solution (C0161S, Beyotime Biotechnology Co., Ltd., China); (4) Mouse Luteinizing Hormone (LH) Enzyme-Linked Immunosorbent Assay Kit (E-EL-M3053, Elabscience, USA); (5) Mouse Follicle-Stimulating Hormone (FSH) Enzyme-Linked Immunosorbent Assay Kit (E-EL-M0511c, Elabscience, USA); (6) Mouse Testosterone Enzyme-Linked Immunosorbent Assay Kit (E-OSEL-M0003, Elabscience, USA); (7) PBS (G4202, Solarbio Science & Technology Co., Ltd., China); (8) PMSG (The Second Hormone Factory of Ningbo, China); (9) HCG (Hangzhou Animal Pharmaceutical Factory, China); (10) M2 Culture Medium (M7167, Sigma-Aldrich, Germany); (11) KSOM Culture Medium (MR-106, Sigma-Aldrich, Germany); (12) Mineral Oil (M8410, Sigma-Aldrich, Germany); (13) HTF Sperm Capacitation Medium (MR-070, Sigma-Aldrich, Germany); (14) PVP (LifeGlobal, USA); (15) Hyaluronidase (M2215, Nanjing Aibei Biotechnology Co., Ltd., China); (16) HTF Sperm Capacitation Medium (MR-070, Sigma-Aldrich, Germany); (17) PBS (G4202, Solarbio Science & Technology Co., Ltd., China).

[0052] 2. Main instruments: (1) Pipettes: 2.5 μL, 10 μL, 20 μL, 200 μL, 1000 μL (Eppendorf, Germany); (2) Stereomicroscope (SZX10, Olympus, Japan); (3) Inverted microscope (IX71, Olympus, Japan); (4) Piezoelectric impact driver (PIEZO PMM4G, Sutter Instrument, USA); (5) Micromanipulator (TransferMan 4r, Eppendorf, Germany); (6) Carbon dioxide incubator (BB150, Thermo, Germany); (7) Ordinary PCR amplifier (TP600, TaKaRa, Japan); (8) Desktop room temperature centrifuge (Heraeus Tresco21, Thermo, USA); (9) Microplate reader (Cytation5, BioTek, USA); (10) Paraffin embedding machine (HistoStar, Thermo, Germany); (11) Microtome (RM2255, Leica, Germany); (12) Oven (HerathermOMS60, Thermo, Germany); (13) Sperm CASA motility analyzer (WLJY-9000, Beijing Weili Medical Company, China).

[0053] 3. Bioinformatics websites and computer analysis software: (1) NCBI website: http: / / www.ncbi.nlm.nih.gov / ; (2) Primer design website: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ; (3) Real-time fluorescence quantitative PCR result analysis software: BioRad CFX Manager; (4) Gel imaging software: Bio-Rad Image Lab Software; (5) Optical density analysis software: ImageJ software; (6) Graphing software: GraphPad Prism 8; Adobe Photoshop 2020; (7) Statistical analysis software: GraphPad Prism 8.

[0054] II. Model construction

[0055] 1. Mouse breeding: The male NAMPT Cys39 point mutant mice with C57BL / 6J background used in this experiment were donated by the Basic Medical College of Peking Union Medical College and then embryonically purified and raised in the Experimental Animal Department of China Medical University. The animal grade was SPF. Wild-type male and wild-type female mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., with an animal grade of SPF, and were raised in the Experimental Animal Department of China Medical University. Mice had free access to food and water during growth, and the experimental environment was maintained with a 12-hour light-dark cycle to simulate the conversion of day and night in the outside world.

[0056] 2. Construction of CRISPR-mediated NAMPT Cys39 point mutant chimeric mice: Microinject Cas9mRNA corresponding Nampt-C39S-gRNA (target sequence: TTTCACGGCATTCAAAGTAGG, where the PAM sequence is AGG) and the corresponding donor DNA.

[0057] Design of homologous recombination template (Donor plasmid): Green background: non-target mutation (synonymous mutation); yellow background: target mutation, position of point mutation, p.39 C->S; red background: approximate position of CRISPR cutting genomic DNA;

[0058] Genome: TAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0059] Mutant (Donor): TAGGTTACTCACTATAAACAATACCCACCAAATACAAGCAAAGTTTATTCATATTTTGAATCCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0060] The C base of the codon for cysteine at position 39 was mutated to G, thus mutating cysteine to serine. The fertilized eggs were transferred into pseudopregnant female mice, and the PCR products amplified from tail-derived DNA were sequenced. Newborn mice at two weeks old were genotyped. The CRISPR-mediated NAMPT Cys39 point mutant chimeric mice (F0 generation) were mated with wild-type C57BL / 6J mice to obtain heterozygous Nampt C39S mice (F1 generation).

[0061] 3. Mouse genotype identification: Cut off the toes of mice at 10 - 14 days after birth and place them in a 1.5 mL EP tube. After instantaneous centrifugation, the mouse claws sink to the bottom of the tube. Add the prepared tissue digestion solution to the EP tube, place it in a 55°C metal bath for digestion for 15 min, terminate the digestion at 95°C for 5 min to inactivate the protease in the digestion solution, and centrifuge at 12,000 rpm for 5 min. Take the supernatant as the PCR template.

[0062] III. Model verification

[0063] 1. Mouse mating experiment: Mate male WT, HE, and KI littermate mice with female WT mice at a ratio of 1:2 respectively. The experiment lasts for 3 months. Male mice that make one or more female mice pregnant are recorded as fertile male mice, and record the average number of offspring per female mouse mated with them.

[0064] 2. Mouse sperm counting: Add 5 g of NaHCO3 and 1 mL of 35% (v / v) formaldehyde solution to 100 mL of pure water to prepare the fixing solution. After anesthetizing the mice with 0.3% sodium pentobarbital (55 mg / kg), take out the cauda epididymis, place it in a Petri dish containing pre-warmed PBS at 37°C, use a 1 mL syringe needle to cut the cauda epididymis to allow sperm to swim out freely, incubate in a 37°C incubator for 5 min, and then dilute the sperm released in physiological saline with the fixing solution at a ratio of 1:5 - 1:10. Under a 400-fold optical microscope, count the sperm using a hemocytometer according to the traditional method.

[0065] 3. Mouse sperm morphology analysis: After anesthetizing the mice with 0.3% sodium pentobarbital (55 mg / kg), take out the cauda epididymis, place it in a Petri dish containing pre-warmed PBS at 37°C, use a 1 mL syringe needle to cut the cauda epididymis to allow sperm to swim out freely, incubate in a 37°C incubator for 5 min, and then dilute with PBS at a ratio of 1:5 - 1:10. Drop the liquid on a glass slide, spread it evenly, air dry naturally, fix in 95% ethanol for 20 min, stain with hematoxylin for 30 min, rinse with tap water, stain with eosin for 5 min, rinse with tap water, air dry, and count the number of normal and abnormal sperm.

[0066] 4. HE staining of mouse testicular tissue

[0067] (1) Deparaffinization: Place the testicular sections in xylene I for 15 min, xylene II for 15 min, xylene III for 15 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, 85% alcohol for 5 min, 75% alcohol for 5 min, and rinse with distilled water.

[0068] (2) Stain the cell nucleus with hematoxylin: Place the sections in hematoxylin for 3 - 8 min, rinse with tap water, differentiate with 1% hydrochloric acid alcohol for a few seconds, and rinse with tap water to turn blue.

[0069] (3) Stain the cytoplasm with eosin: Place the sections in eosin staining solution and stain for 1 - 3 min.

[0070] (4) Dehydration and mounting: Place the sections successively in 75% alcohol for 5 min, 85% alcohol for 5 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, and xylene II for 5 min for dehydration and clearing. Take the sections out of the xylene, let them dry slightly, and mount them with neutral balsam.

[0071] 5. Transmission electron microscopy analysis of mouse sperm:

[0072] (1) After anesthetizing the mice with 0.3% sodium pentobarbital (55 mg / kg), take out the cauda epididymidis and place it in a Petri dish containing pre - warmed PBS at 37°C. Scratch the cauda epididymidis with a 1 mL syringe needle to allow the sperm to swim out freely. Incubate at 37°C for 30 min, centrifuge at 1000 g for 10 min, discard the PBS supernatant, and retain the sperm pellet.

[0073] (2) Add 1 mL of electron microscopy fixative (3% paraformaldehyde + 3% glutaraldehyde, prepared with 0.1 M cacodylate buffer) to the EP tube containing the sperm pellet, and fix at 4°C for 24 h.

[0074] (3) Take it out from 4°C and fix at room temperature for 1 h.

[0075] (4) Take out the tissue from the electron microscopy fixative and wash it 3 times with 0.1 M cacodylate buffer, 10 min each time.

[0076] (5) Fix at room temperature for 1 h with 1% osmium tetroxide fixative.

[0077] (6) Dehydration with alcohol gradient: 30% ethanol, 50% ethanol, 70% ethanol, 90% ethanol, 100% ethanol, 15 min for each gradient.

[0078] (7) Embed the testicular tissue with epoxy resin mixture at 60°C for 24 h.

[0079] (8) Use an ultramicrotome to cut the testicular tissue into sections about 70 nm thick.

[0080] (9) Double - stain the sections with 3% uranyl acetate and lead citrate.

[0081] (10) Observe with a transmission electron microscope and take pictures.

[0082] 6. Mouse sperm motility analysis: After anesthetizing the mice with 0.3% sodium pentobarbital (55 mg / kg), the cauda epididymis was removed and placed in an HTF petri dish preheated to 37°C. The cauda epididymis was punctured with a 1 mL syringe needle to allow the sperm to swim out freely. Incubate in a 37°C incubator for 10 min, then add 10 µL to a sperm counting chamber and detect the sperm motility of the mice using a Beijing Weili CASA sperm analyzer.

[0083] 7. Mouse luteinizing hormone (LH) enzyme-linked immunosorbent assay: Use the kit from Elabscience (kit catalog number: E-EL-M3053), and the specific operation method is as follows:

[0084] 7.1 Reagent preparation and liquid configuration.

[0085] (1) Take out the kit from the refrigerator 20 min in advance and equilibrate to room temperature.

[0086] (2) Wash buffer: Dilute the concentrated wash buffer with double-distilled water (1:24).

[0087] (3) Standard working solution: Centrifuge the standard at 10000 g for 1 min, add 1 mL of the standard and sample diluent to the lyophilized standard, tighten the tube cap, let it stand for 10 min, invert it several times up and down, and gently mix it after it is fully dissolved, avoiding foaming, to prepare a 20 ng / mL standard working solution. Then perform serial dilutions as needed. Prepare the following concentrations: 20, 10, 5, 2.5, 1.25, 0.63, 0.31, 0 ng / mL. Serial dilution method: Take 7 EP tubes, add 500 μL of the standard & sample diluent to each tube. Pipette 500 μL from the 20 ng / mL standard working solution into the first EP tube and mix to prepare a 10 ng / mL standard working solution. Follow this step to pipette and mix successively. The last tube is directly used as the blank well and no liquid needs to be pipetted from the second-to-last tube. The serially diluted standard working solution needs to be prepared and used immediately.

[0088] (4) Biotinylated antibody working solution: Calculate the amount required for the current experiment before the experiment (calculated at 100 μL / well), and actually prepare 100 - 200 μL more. 15 min before use, centrifuge the concentrated biotinylated antibody at 800 g for 1 min, and dilute the 100× concentrated biotinylated antibody to 1× working concentration with the biotinylated antibody diluent, and prepare and use immediately.

[0089] (5)HRP Enzyme Conjugate Working Solution: The HRP enzyme conjugate is HRP enzyme conjugated with avidin. Calculate the required amount for the current experiment before the experiment (calculated at 100 μL / well), and actually prepare 100 - 200 μL more. 15 minutes before use, centrifuge the concentrated HRP enzyme conjugate at 800 g for 1 minute, and dilute the 100× concentrated HRP enzyme conjugate to 1× working concentration with the enzyme conjugate diluent, and prepare it immediately before use.

[0090] 7.2 Sample Detection.

[0091] (1)Set the standard wells, blank wells, and sample wells respectively. Add 100 μL of serially diluted standards to the standard wells, add 100 μL of standard & sample diluent to the blank wells, and add 100 μL of the sample to be tested to the remaining wells. Cover the enzyme-linked immunosorbent assay (ELISA) plate with a film and incubate at 37 °C for 90 minutes. Add the sample to the bottom of the ELISA plate, try not to touch the well walls, gently shake to mix evenly, and avoid generating bubbles. The sample addition time should be controlled within 10 minutes.

[0092] (2)Flick out the liquid in the wells, no washing is required. Add 100 μL of biotinylated antibody working solution to each well, cover the ELISA plate with a film, and incubate at 37 °C for 1 hour.

[0093] (3)Flick out the liquid in the wells and pat dry on a clean absorbent paper. Add 350 μL of washing solution to each well, soak for 1 minute, aspirate or flick out the liquid in the ELISA plate, and pat dry. Repeat this washing step 3 times. Immediately perform the next step after the washing is completed, and do not let the microplate dry.

[0094] (4)Add 100 μL of HRP enzyme conjugate working solution to each well, cover the ELISA plate with a film, and incubate at 37 °C for 30 minutes.

[0095] (5)Flick out the liquid in the wells and wash the plate 5 times, with the method the same as in step (3).

[0096] (6)Add 90 μL of substrate solution (TMB) to each well, cover the ELISA plate with a film, and incubate at 37 °C in the dark for about 15 minutes. Hint: Shorten or extend as appropriate according to the actual color development situation, but do not exceed 30 minutes. When an obvious gradient appears in the standard wells (an obvious blue gradient appears in the first 4 colored wells), the reaction can be terminated. Turn on the microplate reader and preheat it 15 minutes in advance.

[0097] (7)Add 50 μL of stop solution to each well to terminate the reaction. The addition order of the stop solution should be as consistent as possible with the addition order of the substrate solution.

[0098] (8)Immediately measure the OD value of each well with a microplate reader at a wavelength of 450 nm.

[0099] 8. Mouse Follicle-Stimulating Hormone (FSH) Enzyme-Linked Immunosorbent Assay: Use the kit from Elabscience (Kit Catalog Number: E-EL-M0511). The reagent preparation, liquid configuration, and sample detection methods are the same as those in 7. Mouse Luteinizing Hormone (LH) Enzyme-Linked Immunosorbent Assay.

[0100] 9. Mouse Testosterone Enzyme-Linked Immunosorbent Assay: Use the kit from Elabscience (Kit Catalog Number: E-OSEL-M0003). The specific operation method is as follows:

[0101] The reagent preparation and liquid configuration methods are the same as those in 7. Mouse Luteinizing Hormone (LH) Enzyme-Linked Immunosorbent Assay.

[0102] (1) Set the standard wells, blank wells, and sample wells respectively. Add 50 μL of serially diluted standard product to the standard wells, 50 μL of standard product & sample diluent to the blank wells, and 50 μL of the sample to be tested to the remaining wells. Then immediately add 50 μL of HRP enzyme conjugate working solution to each well. Cover the microplate with a plastic film and incubate at 37 °C for 60 min. Note: When adding the sample, add it to the bottom of the microplate, try not to touch the well wall, gently shake to mix evenly, and avoid generating bubbles. The entire sample addition time should be controlled within 10 min.

[0103] (2) Drain the liquid in the wells and pat dry on a clean absorbent paper. Add 350 μL of washing solution to each well, soak for 1 min, aspirate or discard the liquid in the microplate, and pat dry. Repeat this washing step 5 times. Immediately perform the next step after washing the plate, and do not let the microplate dry.

[0104] (3) Add 90 μL of substrate solution (TMB) to each well. Cover the microplate with a plastic film and incubate at 37 °C in the dark for about 15 min. Note: Depending on the actual color development situation, shorten or extend the incubation time as appropriate, but do not exceed 30 min. When an obvious gradient appears in the standard wells (an obvious blue gradient appears in the first 4 colored wells), the reaction can be terminated. Turn on the microplate reader and preheat it 15 min in advance.

[0105] (4) Add 50 μL of stop solution to each well to terminate the reaction. Note: The addition order of the stop solution should be as consistent as possible with the addition order of the substrate solution.

[0106] (5) Immediately measure the OD value of each well with a microplate reader at a wavelength of 450 nm.

[0107] 10. Preparation of infertile male mice - Vasectomy.

[0108] (1) Anesthesia: Weigh the mouse and inject anesthetic intraperitoneally to anesthetize it. Place the mouse on the surgical tray with its abdomen facing up, spray and disinfect with 75% alcohol, and cut off the abdominal hair.

[0109] (2) cauterize the vas deferens: Cut open the skin, make a 1.5-cm transverse incision at the horizontal line of the upper end of the lower limb, make a transverse incision of the same size on the abdominal wall, clamp one side of the testicular fat pad and pull it out of the incision, pull out the testis, epididymis, and vas deferens together, use a red-hot forceps to cauterize about 1 cm of the vas deferens, clamp the fat pad with the forceps, put the testis back into the abdominal cavity, and repeat the same operation on the other side of the vas deferens.

[0110] (3) Suture: Suture the abdominal wall, and then suture the skin. Gently wipe the suture site with iodophor. Place the mouse on a warming plate until it wakes up.

[0111] 11. Embryo transfer into the oviduct of mice: Female mice over 6 weeks old and weighing 25 - 35 g are mated with male mice whose vas deferens have been excised in advance. The day when a vaginal plug appears is counted as pseudopregnancy 0.5 days. Female mice with pseudopregnancy 0.5 days can be used for embryo transfer into the oviduct.

[0112] (1) Anesthesia: Weigh the pseudopregnant female mouse and anesthetize the mouse by intraperitoneal injection of 0.3% sodium pentobarbital (55 mg / kg). Place the mouse on the operating tray with its abdomen upward.

[0113] (2) Aspirate the embryo into the transfer pipette: First aspirate a small amount of M2 culture medium, then aspirate a small air bubble, then aspirate M2 culture medium again, and then aspirate a second small air bubble. Fix the transfer pipette connected to the mouth control tube on the stereomicroscope stage with plasticine until embryo transfer into the oviduct.

[0114] (3) Transfer: Spray and disinfect with 75% alcohol, cut off the abdominal hair, make an incision on the back parallel or perpendicular to the spine to expose both oviducts and ovaries. Slide the skin around, observe the position of the ovaries through the body wall, clamp the body wall, make a small incision at the location of the ovaries, clamp the fat pad and pull out the ovaries, oviducts, and uterus. Under the microscope, find the opening of the oviduct and the enlarged ampulla of the oviduct under the ovarian bursa. Use forceps to tear a small hole in the ovarian bursa at the fimbria of the oviduct, insert the transfer pipette into the opening of the oviduct, and blow the embryo into the ampulla of the oviduct. Clamp the fat pad with forceps and put the uterus, oviducts, and ovaries back into the body cavity.

[0115] (4) Suture: Suture the abdominal wall, and then suture the skin. Gently wipe the suture site with iodophor. Place the mouse on a warming plate until it wakes up.

[0116] 12. In vitro fertilization experiment of mice:

[0117] (1) Superovulation: On the first day: Inject 10 IU of PMSG into each female mouse at 9 pm. On the third day: That is, 48 h later, inject 10 IU of HCG, and perform fertilization 12 - 16 h later.

[0118] (2) Preparation of culture dishes: Prepare fertilization medium and culture dishes on the afternoon of the day before fertilization. Take 35-mm embryo culture dishes to make drops. Sperm capacitation dish: 200 μL HTF, 1 drop; Fertilization dish: 200 μL HTF, 10 drops, covered with oil; Culture dish: 50 μL KSOM, 10 drops, covered with oil. All dishes are placed in a carbon dioxide incubator at 37 °C and 5% CO2.

[0119] (3) Sperm capacitation: On the fourth day: Make 5 200-μL drops in an embryo culture dish with M2 culture medium, cover with oil, and preheat the dish to 37 °C. After injecting HCG into female mice for 12 - 16 h, sacrifice the male mice, quickly cut off the cauda epididymidis with ophthalmic scissors and forceps, gently wash it in the M2 culture medium drop, transfer the cauda epididymidis to the HTF in the capacitation dish, pierce the cauda epididymidis with a syringe needle, and incubate it in a 37 °C incubator for 10 min after the sperm overflows. Take it out and observe under a stereomicroscope. After the sperm diffuses, put it back into the incubator and continue to incubate for 50 min.

[0120] (4) Egg collection: After completing sperm acquisition, anesthetize the mice with 0.3% sodium pentobarbital (55 mg / kg), then dissect the female mice. Quickly cut off the oviducts with ophthalmic scissors and forceps, gently wash them in M2 culture medium, and place the oviducts in the mineral oil between the HTF in the fertilization dish. Move the fertilization dish with the oviducts to under the stereomicroscope, use two 1-mL syringe needles to cooperate to cut open the ampulla of the oviduct, release the cumulus mass, and pick it into the HTF drop. Collect all the eggs into HTF for washing, pipette repeatedly, and then distribute the eggs into clean HTF drops in the fertilization dish, with 2 cumulus masses in each drop.

[0121] (5) Fertilization: Use a pipette to aspirate 5 μL of sperm from the sperm capacitation dish and add it to the fertilization drop, and start timing. After 6 h of fertilization, observe and record the number of pronuclei. Then use a pipette with a diameter of 100 μm pulled from a 1.5-mm frosted glass tube to transfer the fertilized eggs from the fertilization drop to the M2 culture dish drop, pipette repeatedly until there is basically no sperm residue on the zona pellucida, and transfer the fertilized eggs to the KSOM drop and continue to culture overnight in a 37 °C and 5% CO2 carbon dioxide incubator. Observe the 2-Cell fertilized eggs for transplantation 24 h after fertilization or observe the culture and development every 24 h, and take pictures for recording.

[0122] (6) Transplantation: Operate according to the aforementioned transplantation steps.

[0123] 13. Intracytoplasmic sperm injection experiment of mouse oocytes.

[0124] (1) Superovulation: The method is the same as the aforementioned superovulation steps.

[0125] (2)Preparation of culture dishes and solutions: Prepare culture dishes on the afternoon of the day before fertilization. Take 35-mm embryo culture dishes to make drops. Culture dishes: 50 μL of KSOM, 10 drops, covered with oil. Place the dishes in a carbon dioxide incubator at 37 °C and 5% CO2. Prepare MIN solution: 123.0 mM / L KCl, 2.6 mM / L NaCl, 7.8 mM / L NaH2PO4, 1.4 mM / L KH2PO4, 3 mM / L EDTA. Prepare PVP solution: Dissolve 1.2 g of PVP in 8 mL of physiological saline, filter through a 0.45-μm filter, dispense, and store at -20 °C.

[0126] (3)Tail removal of sperm by ultrasound: Cool a beaker containing 2 mL of NIM solution in a cold bath (0 - 1 °C) for 2 min. Anesthetize the mouse with 0.3% sodium pentobarbital (55 mg / kg), then dissect the mouse, take out the cauda epididymidis, cut the cauda epididymidis into pieces with scissors, and put the bilateral cauda epididymidis of the mouse into the beaker. Diffuse the sperm in the NIM solution by intermittently shaking the beaker for about 5 min. Filter the sperm suspension with tissue paper to remove epididymal tissue fragments. Put about 1 mL of the filtered sperm suspension into an ice-water bath, and ultrasonically treat the suspension with a sonicator at 60% power for 5 s. More than 95% of the sperm will have their tails removed. Add 9 mL of cold NIM to the beaker for dilution, centrifuge at 1000 g for 5 min, and discard the supernatant. Add 10 mL of NIM and centrifuge again. Mix the centrifuged sperm head suspension with an equal volume of NIM containing 10% glycerol, and store at 0 - 1 °C. Perform ICSI operation within 1 h.

[0127] (4)Ovum retrieval: Make 5 200-μL droplets of M2 culture medium in an embryo culture dish, cover with oil; make 5 200-μL droplets of hyaluronidase solution in an embryo culture dish, cover with oil, and preheat the above two dishes to 37 °C. After obtaining the sperm, sacrifice the female mouse, quickly cut off the oviduct with ophthalmic scissors and forceps, place it in M2 culture medium and wash gently, and put the oviduct into the mineral oil between the hyaluronidase droplets in the culture dish. Move the fertilization dish with the oviduct to a stereomicroscope, use two 1-mL syringe needles to cooperate to cut open the ampulla of the oviduct, release the cumulus mass, pick it into the hyaluronidase droplet, and pipette repeatedly (about 1 - 2 min). After the granulosa cells become loose, collect all the eggs into the M2 droplet for washing, pipette repeatedly to remove the hyaluronidase, and then distribute the eggs into the KSOM droplet.

[0128] (5) Injection: Install the injection needle and the fixation needle. Under a low-power microscope, adjust the position of the needle until it is clearly visible, and then slightly lift it. Determine the pulse intensity. Move the needle into the PVP droplet and observe the pulse at the interface between PVP and the operating fluid. Inhale the heads of 10 sperm at one time, with a 100-µm interval between two heads. Adjust the fixation needle and the injection needle near the egg cell, and set the microscope magnification to 200 times. Push the head of the first sperm to a position 50-100 µm away from the open end, adjust the clarity of the injection needle, move the opening to contact the zona pellucida of the egg cell, control the injection needle to be in the state of aspiration and move the injection needle towards the fixation needle, and give pulses (5-10). When the injection needle quickly penetrates the zona pellucida and enters the perivitelline space, stop moving. A part of the zona pellucida inside the injection needle is discharged into the perivitelline space. Push the sperm head near the needle tip and stop moving when the moving distance reaches 95% of the egg, and give a single pulse. Through the positive pressure of the injection needle, inject the sperm head into the cytoplasm and smoothly withdraw the needle. Release the egg through the positive pressure of the fixation needle, and repeat the above steps until the remaining eggs are processed. Transfer the eggs to a prepared KSOM dish, wash them several times, and place them in an incubator at 37°C with 5% CO2 for culture. Observe under a microscope 5-8 h later. Perform 2-Cell embryo transfer 24 h after fertilization and observe the culture and development every 24 h, and take pictures for record.

[0129] (6) Transplantation: Operate according to the aforementioned transplantation steps.

[0130] 14. Extraction of total tissue RNA:

[0131] (1) Take 30 mg of testicular tissue, wrap it with tin foil, put it in liquid nitrogen for 0.5 h, then take it out and quickly pound the tissue into a paste with a hammer. Collect the tissue in a sterile centrifuge tube, add 1 mL of RNAiso Plus, add grinding beads, select grinding conditions according to different tissues, and grind the tissue with a pre-cooled tissue grinder.

[0132] (2) Add 200 mL of chloroform to the centrifuge tube, vortex for 15 s, and let it stand at room temperature for 3 min.

[0133] (3) Centrifuge at 4°C and 12,000 rpm for 15 min, carefully aspirate the upper clear aqueous phase and transfer it to a new centrifuge tube.

[0134] (4) Add an equal volume of isopropanol to the centrifuge tube, invert it up and down to mix well, and let it stand at room temperature for 10 min.

[0135] (5) Centrifuge at 4°C and 12,000 rpm for 10 min, and a white precipitate can be seen at the bottom of the centrifuge tube. Discard the supernatant.

[0136] (6) Add 1 mL of ethanol prepared with 75% DEPC water to the centrifuge tube, invert it up and down to fully rinse.

[0137] (7) Centrifuge at 4 °C and 7500 rpm for 5 min, discard the supernatant, let it stand and dry for 15 min, and dissolve it in DEPC water according to the size of the precipitate.

[0138] (8) When detecting the concentration of the RNA sample, an OD260 / OD280 ratio between 1.8 and 2.0 indicates good RNA purity. The sample is stored in a -80 °C deep freezer for later use.

[0139] 15. cDNA synthesis and real-time quantitative fluorescence PCR reaction:

[0140] Step 1: Use the PrimeSciptTM RT regent Kit with gDNA Eraser kit to synthesize cDNA. The reaction system is as follows: Remove genomic DNA, and the reaction system is shown in Table 1.

[0141] Table 1. Reaction system for removing genomic DNA

[0142]

[0143] Reaction conditions: 42 °C for 2 min → 4 °C + ∞.

[0144] Step 2: Synthesis of cDNA strands. The reaction system is shown in Table 2.

[0145] Table 2. Reaction system for cDNA strand synthesis

[0146]

[0147] Step 3: Use the ChamQ Universal SYBR qPCR Master Mix kit to perform real-time quantitative fluorescence PCR amplification of cDNA. The primers required for the reaction are synthesized by Shanghai Sangon Biotech Co., Ltd., and the primer sequences are shown in Table 3.

[0148] Table 3. Primer sequences

[0149]

[0150] Note: F and R represent the forward primer and the reverse primer respectively.

[0151] Each group in the real-time quantitative fluorescence PCR experiment is set with 3 replicate wells, and the reaction system is shown in Table 4.

[0152] Table 4. Fluorescence quantitative PCR reaction system

[0153]

[0154] Reaction conditions: Pre-denaturation: 95°C for 30 s; Cycling reaction: 95°C for 5 s, 60°C for 34 s, 40 cycles; Dissolution curve temperature range: 72°C - 95°C.

[0155] 16. Total protein extraction from tissues.

[0156] 16.1 Total protein extraction.

[0157] (1) Weigh 50 mg of testicular tissue, wrap it with tin foil and put it into a liquid nitrogen tank. After taking it out 0.5 h later, quickly pound it with a hammer until the tissue becomes paste-like. Collect the tissue into a sterile centrifuge tube, add an appropriate amount of IP protein lysate containing protease inhibitor, add grinding beads, select grinding conditions according to different tissues, and place it in a pre-cooled tissue grinder for grinding.

[0158] (2) Let it stand on ice for 30 min, sonicate for 3 s, repeat 3 times, with an interval of 3 s each time.

[0159] (3) Centrifuge at 4°C and 12000 rpm for 20 min, collect the supernatant into a new centrifuge tube, and the supernatant is the protein.

[0160] 16.2 Protein concentration determination: Operate according to the instruction manual of the BCA Protein Concentration Assay Kit from Beyotime.

[0161] (1) Add 0, 1, 2, 4, 8, 12, 16, 20 μL of protein standards to a 96-well plate respectively, and make up to 20 μL with IP lysate.

[0162] (2) Take 2 μL of the protein to be tested and add it to the 96-well plate, make up to 20 μL with IP lysate.

[0163] (3) Prepare BCA reagent (A solution: B solution = 50:1), and add 200 μL to each well.

[0164] (4) Incubate in an incubator at 37°C for 30 min.

[0165] (5) Use an enzyme-linked immunosorbent assay reader to measure the absorbance values of the standards and samples at a wavelength of 562 nm. Calculate the protein concentration of the sample according to the standard curve and the absorbance value of the sample to be tested.

[0166] (6) Mix the protein sample and 5×loading buffer in a ratio of 4:1, boil in a 100°C metal bath for 5 min, and then store the sample in a -80°C deep freezer for later use.

[0167] 17. Western blot.

[0168] (1)Prepare the SDS-PAGE gel and liquid according to the instructions of the SDS-PAGE Gel Preparation Kit of Biyuntian Company. The gel preparation method is shown in Table 5.

[0169] Table 5. SDS-PAGE Gel Preparation

[0170]

[0171] The liquid preparation method is shown in Table 6.

[0172] Table 6. Liquid Preparation

[0173]

[0174] (2)Electrophoresis: Calculate the required protein loading amount according to the protein concentration. Add each sample protein and protein Marker to the loading wells in turn, perform vertical electrophoresis at a constant voltage of 80V for about 30 min until the bromophenol blue migrates to the separating gel, then adjust the voltage to 120V and continue electrophoresis for about 1 h until the bromophenol blue migrates near the lower end of the gel, and then terminate the electrophoresis.

[0175] (3)Transfer membrane: Cut a PVDF membrane of appropriate size, soak it in methanol for 5 min to activate the surface positive charge. Soak the PVDF membrane, gel and filter paper in the transfer buffer for 10 min to equilibrate. Place the sponge, filter paper, gel, PVDF membrane, filter paper, and sponge on the cathode plate (black) in turn, cover the anode plate (white), clamp it and put it into the transfer tank. Add ice around the transfer tank and transfer the membrane at 4°C with a constant current of 200 mA for 1 h.

[0176] (4)Blocking: Wash with 1×TBST 3 times, 5 min each time. Put the PVDF membrane into the blocking solution and block it at room temperature on a shaker for 1 h.

[0177] (5)Primary antibody incubation: Take out the PVDF membrane, wash it with 1×TBST 3 times, 5 min each time. Dilute the primary antibody according to the antibody instruction manual, put the PVDF membrane into it, and hybridize overnight at 4°C on a shaker. The dilution ratios of the primary antibodies are as follows: NAMPT is 1:2000; GAPDH is 1:2000.

[0178] (6)Secondary antibody incubation: Wash the membrane with 1×TBST 3 times, 10 min each time. Dilute the secondary antibody according to the instruction manual ratio (1:10000), incubate it at room temperature on a shaker for 1 h, and then wash the membrane with 1×TBST 3 times, 10 min each time.

[0179] (7)Color development: Prepare an appropriate amount of ECL chemiluminescent color development solution (A solution:B solution = 1:1), drop the luminescent solution on the PVDF membrane, perform exposure and photography with a chemiluminescent imaging system, and perform optical density analysis using Image J software.

[0180] 18. Blue-Native PAGE。

[0181] (1)Prepare the gels and liquids for Blue-Native PAGE. The gel preparation is shown in Table 7.

[0182] Table 7. Blue-Native PAGE Gel Preparation

[0183]

[0184] The liquid preparation is shown in Table 8.

[0185] Table 8. Blue-Native PAGE Liquid Preparation

[0186]

[0187] (2)Loading and electrophoresis: Connect the electrophoresis apparatus, keep at 4°C, constant current of 20 mA, pre-electrophorese for 30 min to ensure the pH in the whole system is consistent. Mix the protein sample and 5×loading buffer in a ratio of 4:1. Add the mixed sample and protein Marker to the sample wells after pre-electrophoresis, and perform electrophoresis at 4°C with a constant current of 20 mA. Observe the positions of the bands in the gel and the electrophoresis solution every 15 min, and stop electrophoresis when the 70 kDa Marker electrophoreses to the middle of the gel.

[0188] (3)Transfer membrane: Remove the gel after electrophoresis from the glass plate, place it in the electrophoresis solution containing SDS and incubate with shaking at room temperature for 30 min. Prepare the transfer membrane solution according to the formula in the WB method. Cut a PVDF membrane of appropriate size, activate it in methanol for 5 min. After the gel incubation with shaking is completed, soak the gel, PVDF membrane and filter paper in the transfer membrane solution for equilibration. Lay the sponge, filter paper, PVDF membrane and gel in the order in the WB method. Clamp the transfer membrane clip, insert it into the transfer membrane rack, pour in the pre-cooled transfer membrane solution and place ice cubes around the transfer membrane rack, perform transfer at 4°C with a constant current of 300 mA for 30 min.

[0189] (4)Blocking, primary antibody hybridization, secondary antibody hybridization, chemiluminescent imaging, the methods are as described in 17. Western blot.

[0190] 19. Size exclusion chromatography.

[0191] (1)Sample preparation: Weigh 30 mg of tissue into an EP tube, add 0.8 mL of PBS (1× Cocktail, 1× PMSF), and place it in a tissue grinder for grinding (the temperature of the grinder is maintained at 4°C). Use a contact ultrasonic disruptor to ultrasonicate the tissue homogenate at a power of 40% for 15 s and a stop time of 45 s, ensuring that the total ultrasonic duration of each tube in the same batch of samples is the same. After the solution becomes clear, centrifuge at 4°C and 12,000 g for 10 min, and transfer the supernatant to a new 1.5 mL EP tube. The prepared protein solution can be loaded onto the machine after filtering through a 0.22 µm filter membrane. Take 50 µL of the sample as Input.

[0192] (2)Separate proteins using an AKTA protein purifier and a GE Superdex200 liquid chromatography column: First, exhaust the system and set the alarm parameters, and then connect the column. Slowly rinse the alcohol in the chromatography column with water and then replace it with PBS, and equilibrate the chromatography column with one column volume of solution. Inject 5 mL of PBS into the sample loop to wash the sample loop.

[0193] (3)Aspirate the prepared protein solution into a 1 mL syringe and inject it into the sample loop (at least 600 µL), taking care not to have air bubbles.

[0194] (4)Record the liquid flow rate at this time after performing the Inject operation, and start collecting the protein solution after 11.43 mL has flowed out. Collect 1 tube every 600 µL, and label the first tube of protein solution collected at this time as tube No. 1, and collect a total of 11 tubes.

[0195] (5)Take out 50 µL from each tube of the collected protein solution and mix them, denoted as mix, as a reference for comparing the total protein amount between samples.

[0196] (6)Take 200 µL from each of the remaining tubes and place them into new 1.5 mL EP tubes, add 50 µL of SDS loading, and boil at 100°C for 10 min.

[0197] (7)Detect the content of the obtained protein samples using the method described in 17. Western blot.

[0198] 20. Immunofluorescence.

[0199] (1)Deparaffinization: Xylene Ⅰ for 15 min, Xylene Ⅱ for 15 min, Xylene Ⅲ for 15 min, absolute ethanol Ⅰ for 5 min, absolute ethanol Ⅱ for 5 min, 85% alcohol for 5 min, 75% alcohol for 5 min, and wash with distilled water.

[0200] (2) Antigen retrieval: The sections were placed in citrate buffer and repaired by microwave, high fire for 8 min, medium and low fire for 20 min, cooled at room temperature for 1 h, washed with PBS 3 times, 5 min each time.

[0201] (3) Incubate the section tissues with PBST containing 0.05% TritonX-100 at room temperature: Incubate the section tissues with PBST containing 0.05% TritonX-100 at room temperature for 10 min for punching, 5 min each time, and draw a histochemical circle around the tissue with a histochemical pen.

[0202] (4) Block with 1% BSA: Drop the blocking solution and block at room temperature for 1 h.

[0203] (5) Primary antibody: Gently shake off the blocking solution on the section, drop about 50 μL of the primary antibody prepared by mixing 1% BSA in a certain proportion on the section, and incubate the section flat in a wet box at 4 °C overnight. The dilution ratio of the NAMPT antibody is 1:500. The next day, wash with PBS 3 times, 5 min each time.

[0204] (6) Secondary antibody: Dilute the fluorescent secondary antibody with PBS containing 1% BSA and incubate with the section tissues at room temperature for 30 - 50 min, wash with PBS 3 times, 5 min each time.

[0205] (7) Nuclear staining: Stain the nucleus with DAPI for 5 min at room temperature, protected from light, wash with PBS 3 times, 5 min each time.

[0206] (8) Mounting: Mount with an anti-quenching agent and observe under a fluorescence microscope.

[0207] 21. Targeted metabolomics mass spectrometry analysis: Weigh about 120 mg of the mouse testis and quickly freeze it in a liquid nitrogen tank; Take the sperm from the cauda epididymis on both sides and culture them in pre-warmed PBS at 37 °C in a 37 °C incubator for 10 min, then centrifuge at 1000 g for 10 min. Transport to the company on dry ice for sample extraction and mass spectrometry detection. Non-targeted metabolomics was entrusted to Shanghai Baipu Biotechnology Co., Ltd. for detection and identification, and the specific information is as follows.

[0208] (1) Extraction of metabolites: After weighing each sample, add 200 μL of pre-cooled 80% methanol to each, add 3 medium-sized steel beads, homogenize and grind in a tissue homogenizer, then add 800 μL of pre-cooled 80% methanol, vortex and mix well, sonicate in an ice bath for 20 min, let stand for 1 h, centrifuge at 16000 g at 4 °C for 20 min, take the supernatant, add the internal standard L-Glutamate-D5, and evaporate the supernatant to dryness in a high-speed vacuum concentrator. The samples were re-dissolved in 50% methanol solution according to the ratio, centrifuged at 20000 g at 4 °C for 15 min, and the supernatant was taken for mass spectrometry injection analysis.

[0209] (2)LC-MS / MS analysis: Separation was performed using a Shimadzu Nexera X2 LC-30AD high-performance liquid chromatography. Mobile phase: Solution A was an aqueous solution of 5% acetonitrile containing 20 mM ammonium acetate at pH 9.45, and solution B was 100% acetonitrile. The sample was reconstituted in an aqueous solution of 50% methanol in proportion and placed in an autosampler at 4°C. The column temperature was 40°C, the flow rate was 300 μL / min, and the injection volume was 5 μL. The relevant liquid phase gradient was as follows: from 0 to 1 min, solution B was maintained at 95%; from 1 to 12 min, solution B linearly changed from 95% to 55%; from 12 to 13 min, solution B linearly changed from 55% to 40%; from 13 to 15 min, solution B was maintained at 40%; from 15 to 15.1 min, solution B linearly changed from 40% to 95%; from 15.1 to 18 min, solution B was maintained at 95%. Mass spectrometry analysis was performed using a QTRAP5500 mass spectrometer (AB SCIEX) in positive / negative ion modes.

[0210] 22. Statistical data analysis.

[0211] All experimental data were statistically analyzed using Graphpad Prism 8 and were expressed as mean ± standard error. Unpaired two-tailed Students’ t-tests were used for statistical analysis of differences in mouse organ weights, sperm morphology, quantity, motility, serum hormones, protein gray scale statistics, and mass spectrometry results. Fisher's exact test was used for statistical analysis of mouse fertility and embryonic cell culture conditions. A P value less than 0.05 was considered statistically significant.

[0212] IV. Experimental results

[0213] 1. The NAMPT C39S point mutation leads to the dissociation of dimers in the testes of homozygous mice and has no obvious effect on the organ development of mice.

[0214] To explore whether the NAMPT C39S point mutation has an impact on the basic development of mice, genotype identification was performed on mice after birth (the NAMPT C39S homozygous point mutation was designated as KI, and wild-type mice were designated as WT). The appearance of 6-month-old mice was observed as a whole. As shown in A of Figure 1 , there was no obvious difference in the appearance between KI and WT mice; the mice were weighed. As shown in A of Figure 1 , there was no significant difference in the body weights between KI and WT mice (P > 0.05). Next, after dissecting the mice, the hearts, livers, spleens, lungs, and kidneys of the mice were observed for appearance. As shown in Figure 1As shown in B, C, D, E, and F in [reference], there were no obvious differences in the appearance of the organs of KI and WT mice; the organs of the mice were weighed, and there were no significant differences in the organ weights of KI and WT mice (P>0.05). The above results suggest that the NAMPTC39S point mutation has no significant effect on the organ development of homozygous mice. Western blot experiments were used to detect the expression of NAMPT protein during the first cycle of spermatogenesis in the testes of WT mice, that is, from the 1st day to the 80th day after birth (Post-birth: P0-P80), as Figure 1 shown in G in [reference]. On the 1st day after birth (P0: the stage of formation of spermatogonia), the 4th day (P4: the stage of formation of spermatogonial stem cells), the 10th day (P10: the stage of formation of primary spermatocytes), the 14th day (P14: the stage of formation of secondary spermatocytes), the 20th day (P20: the stage of formation of round spermatids), the 42nd day after birth (P42: the stage of formation of elongated and mature spermatids), and the 80th day (P80: the stage of formation of mature sperm), NAMPT was expressed throughout the spermatogenesis process in the testes of mice, and there were no significant differences among the groups (P>0.05). At the same time, Western blot was used to detect the expression of total NAMPT protein in the testes of KI and WT mice. The results were as Figure 1 shown in H and I in [reference]. There was no significant difference in the total protein level of NAMPT in the testes of KI and WT mice (calculated according to the Figure 1 second and third bands in H in [reference]) (P>0.05). BN-PAGE was used to detect the polymerization changes of NAMPT protein in the testes of NAMPT C39S point mutant mice. The molecular weight of the NAMPT monomer was about 52KDa, and the molecular weight was about 104KDa when it formed a dimer, as Figure 1 shown in H, J, and K in [reference]. Compared with WT mice, the dimer content of NAMPT protein in the testes of KI mice was significantly reduced (calculated according to the Figure 1 upper and third bands in the first row of H in [reference]) (P<0.01). At the same time, the dimer-to-monomer ratio also decreased (calculated according to the Figure 1 lower and third bands in the first row of H in [reference]) (P<0.05); further, size exclusion chromatography was used to screen proteins with different molecular weights, as Figure 1 shown in L in [reference]. We found an obvious protein band at the 158KDa position, which may be the non-specific binding of the NAMPT monomer to other proteins to form a relatively large polymer, and this non-specific binding cannot be detected by non-denaturing gel. Compared with WT, the expression of NAMPT protein at the 158KDa position in the testes of KI mice was increased (P<0.01). Mass spectrometry was used to detect the expression of NAD + in the testes after NAMPT C39S point mutation, as Figure 1As shown by M in [the figure], compared with WT, NAD in the testes of KI mice + was significantly decreased (P>0.05). The above results indicate that the NAMPT C39S point mutation leads to the dissociation of dimers and a decrease in NAD + content in the testes of homozygous mice, but there is no obvious abnormality in the development of the mice.

[0215] 2. The NAMPT C39S point mutation causes a decrease in sperm motility in male mice without significant effects on spermatogenesis and other sperm parameters.

[0216] To investigate the effects of the NAMPT C39S point mutation on spermatogenesis and sperm function in mice, 12-week-old mice were taken. First, the testes and epididymides of the mice were observed and weighed. As Figure 2 shown by A-C in [the figure], we found that the testes and epididymides of WT and KI mice were both smooth on the surface, without congestion, and not surrounded by other foreign bodies, with normal appearance. Moreover, there were no significant differences in the weights of the testes, epididymides, and seminal vesicles between KI and WT mice (P>0.05). Immunofluorescence experiments were used to detect the localization of NAMPT protein in the testes. As Figure 2 shown by D in [the figure], the NAMPT protein was expressed in germ cells at all stages in the seminiferous tubules of the testes of KI and WT mice, including spermatogonia, spermatocytes, round sperm, and elongated sperm. It was also expressed in myoid cells, Sertoli cells at the base of the seminiferous tubules of the testes, and interstitial cells in the testicular interstitium, and showed higher expression than germ cells. Moreover, there was no obvious difference in the expression position of the NAMPT protein. To clarify whether the NAMPT C39S point mutation affects the development of mouse testicular tissue and spermatogenesis, testes were collected during the first cycle of mouse sperm production, i.e., from day 1 to day 80 after birth (Post-birth: P0-P80), and histological sections were stained with HE. The results are as Figure 2As shown in E, on the 1st day after birth (P0: prespermatogonia formation stage), the 4th day (P4: spermatogonial stem cell formation stage), the 10th day (P10: primary spermatocyte formation stage), the 14th day (P14: secondary spermatocyte formation stage), the 20th day (P20: round sperm formation stage), the 42nd day (P42: elongated sperm formation stage), and the 80th day (P80: mature sperm formation stage) in the testis lumen of KI and WT mice, the cells were arranged orderly, and cells at each developmental stage were visible. The elongated sperm were regularly arranged around the lumen waiting for release. The testicular tissue morphology of KI mice was normal. The above results suggest that the NAMPT C39S point mutation has no significant effect on the testicular tissue morphology and spermatogenesis of mice. The tail of sperm is the motility apparatus of sperm, which is divided into four parts: the neck segment, the middle segment, the principal segment, and the end segment. The neck segment is short and contains a centriole. The longitudinal microtubules emitted from the centriole form the axoneme at the center of the tail. The microtubules are arranged in groups of 2 around the periphery, 9 groups in total, and 1 group in the middle. To clarify whether the NAMPT C39S point mutation affects the morphology and structure of mouse sperm, the sperm from the cauda epididymis of 12-week-old mice were collected for HE staining, and the sperm morphology of mice was observed under a 40× microscope. The experimental results are as Figure 2 shown in F. The head, middle segment, principal segment, and tail segment of KI mouse sperm were normal. After statistics, the percentage of normal morphology was not significantly different from that of the WT group (P>0.05). To further explore whether the NAMPT C39S point mutation affects the internal structure of the mouse sperm tail, the mouse sperm were fixed with an electron microscope fixative and then prepared into slides, and the internal structure of the mouse sperm tail was detected by transmission electron microscopy. The results are as Figure 2 shown in G. The middle segment of the sperm tails of both KI and WT mice contained a "9+2 microtubule" structure, with the microtubules surrounded by outer dense fibers, and the dense fibers surrounded by mitochondria; the principal segment contained a "9+2 microtubule" structure, with the microtubules surrounded by outer dense fibers, and the two dense fibers replaced by a fibrous sheath; the end segment had no dense fibers and fibrous sheath but contained a "9+2 microtubule" structure, indicating that there was no obvious difference in the internal structure of the sperm tails of KI and WT mice. To explore the cause of male KI mouse infertility, the sperm from the cauda epididymis of 12-week-old mice were collected in HTF culture medium and incubated at 37°C for 10 min. The sperm count of mice was detected by manual counting. The experimental results are as Figure 2 shown in H. Compared with the control group of WT mice, the sperm count of KI mice did not change significantly (P>0.05). The sperm motility of mice was detected by CASA, as Figure 2 shown in I. The percentage of forward motile sperm decreased significantly (P<0.01), and the percentage of total motile sperm decreased significantly (P<0.001). At the same time, the sperm motility-related parameters, such as Figure 2As shown by J in [reference], the average path velocity (VAP) decreased significantly (P < 0.001); the straight-line velocity (VSL) decreased significantly (P < 0.01); the curvilinear velocity (VCL) decreased significantly (P < 0.001); meanwhile, as shown by Figure 2 K in [reference], the amplitude of lateral head displacement (ALH) of sperm decreased significantly (P < 0.05). The above results indicate that compared with WT mice, there was no significant difference in the sperm count of KI mice, but the sperm motility and sperm movement ability of KI mice were decreased. According to the above results, it can be observed that the NAMPT C39S point mutation affects the sperm movement ability of mice. The process of spermatogenesis requires sufficient exogenous sex hormones provided by the hypothalamic-pituitary-gonadal axis. In order to detect the hormone-producing function of the testis and exclude the influence of hormone changes on sperm motility, the levels of luteinising hormone (LH), follicle-stimulating hormone (FSH) and testosterone (T) in the sera of KI and WT mice were detected. The experimental results are shown by Figure 2 L - N in [reference], and there was no significant difference in the serum hormone levels between KI and WT mice (P > 0.05). The above results indicate that the NAMPT C39S point mutation leads to a decrease in sperm motility in mice, but does not affect spermatogenesis and other sperm-related parameters.

[0217] 3. The NAMPT C39S point mutation causes male infertility in mice.

[0218] Male wild-type WT mice, heterozygous HE mice (the NAMPT C39S homozygous point mutation is denoted as HE), and homozygous KI mice can be obtained through genotype identification. In this study, the fertility of mice was detected. Male WT, HE, and KI littermate mice at 8 weeks of age were respectively mated with female WT mice at 8 weeks of age in a ratio of 1:2. The experiment lasted for 3 months. Male mice that made 1 or more female mice pregnant were recorded as fertile male mice, and the average number of offspring per female mouse mated with them was recorded. The experimental results show that male HE, KI, and WT mice all had normal mating behaviors with WT female mice, and vaginal plugs were found in the vaginas of WT female mice mated with them. As shown by Figure 4As shown in Table 9, female WT mice mated with HE and WT mice could all become pregnant and give birth normally, and there was no difference in litter size (P>0.05). However, only one WT female mouse mated with the KI group became pregnant and gave birth to only one pup, but this pup died on the second day after birth. Compared with the WT group, the fertility was significantly reduced (P<0.001). This indicates that although KI mice have normal mating behavior with WT female mice, their ability to make WT female mice conceive naturally is blocked, suggesting that KI male mice may have fertility disorders. Except for the experiments involving embryonic development, littermate WT and KI mice were used for research and discussion below.

[0219] Table 9. Effects of NAMPT C39S point mutation on male mouse fertility

[0220]

[0221] Note: P values were obtained using Fisher's exact test and unpaired two-tailed Students’ t test. *** represents P<0.001 compared with the WT group; represents P<0.001 compared with the HE group; ns represents no statistical significance compared with the WT group. WT: n = 8; HE: n = 10; KI: n = 15; Data are expressed as mean ± standard error.

[0222] 4. NAMPT C39S leads to in vitro fertilization failure in mice but does not affect the results of intracytoplasmic sperm injection.

[0223] Fertilization of sperm and eggs requires a process including sperm capacitation, dissolution of the zona pellucida of oocytes by sperm acrosomal enzymes, fusion of sperm and oocyte cell membranes, entry of sperm into the cytoplasm of oocytes to activate oocytes, and formation of a two-pronuclear fertilized egg by the combination of sperm and eggs. Subsequently, the fertilized egg divides and proliferates into 2-Cell, 4-Cell, 8-Cell, morula, and finally forms a blastocyst. Another previous result showed that there were no changes in the sperm count, morphology, and testicular tissue morphology of KI mice, but the total motility percentage and forward motility percentage of mouse sperm decreased, and the mice were infertile. We conducted in vitro fertilization experiments on mice. The experimental procedure is as shown in Figure 3 A in it. Sperm from 12-week-old KI male mice were co-cultured with eggs from 4-week-old WT female mice to observe sperm-egg binding and embryonic development. The fertilization and embryonic development were observed. The appearance of pronuclei is a sign of completed fertilization, and the presence of two pronuclei (2 Primitivenucleus, 2PN) indicates normal fertilization. The formation of 2PN was used to record the fertilization rate. As shown in Table 10, it was found that 6 hours after fertilization, compared with WT mice, the number of 2PN formed in KI mice was significantly reduced (P<0.001), indicating that the fertilization rate of KI mice was reduced.

[0224] Table 10. Effects of NAMPT C39S point mutation on the formation of 2PN cells in mice n, (%)

[0225]

[0226] Next, we recorded the embryonic development at each stage. As shown in B of Figure 3 , the embryonic cells formed from the sperm of WT and HE mice developed evenly, were plump, had fewer cell debris, and the nuclei were of uniform size; by the blastocyst stage on the 6th day, the blastocoel almost filled the embryo, the number of cells in the inner cell mass was large, the cells were arranged tightly, and the number of trophoblast cells was large, forming a compact layer; although the sperm from KI mice could form embryos with eggs, only 8 two-cells were formed after 147 eggs were fertilized with the sperm of KI mice. We counted the number of embryos developed at each stage. To avoid ambiguity about whether the developed two-cells were derived from "parthenogenetic" cells or 2PN cells, we still used the total number of eggs retrieved as the starting cell number to count the number of cell developments at the two-cell stage. The statistical results are shown in Table 11. At 24 h after fertilization, compared with WT mice, the number of two-cells formed by KI mice was significantly reduced (P < 0.001); at 96 h after fertilization, compared with WT mice, the number of blastocysts formed by KI mice was significantly reduced (P < 0.05); there was no significant difference in the number of embryos developed at each stage between WT and HE mice (P > 0.05). The in vitro fertilization experiment was carried out twice, and it was found in both experiments that the number of 2PNs formed by the sperm and eggs of KI mice was significantly reduced, the number of two-cells formed was significantly reduced, and the number of blastocysts formed was significantly reduced. It is speculated that the sperm of mice with NAMPT C39S point mutation may have poor motility, and the process of swimming to the oocyte, contacting, recognizing, and penetrating the oocyte is blocked in one or all of these processes, resulting in infertility due to the inability to complete normal fertilization.

[0227] Table 11. Effects of NAMPT C39S point mutation on the culture of mouse IVF embryos n, (%)

[0228]

[0229] Note: The P value was obtained using Fisher's exact test. *** represents P < 0.001; * represents P < 0.05; ns represents no statistical significance; the statistical differences were all compared with the WT group. The numbers in the table represent the number of embryos at that stage, and the numbers in "()" represent the embryonic development rates at each stage. The embryonic development rate = the number of embryos at that stage / the number of eggs retrieved.

[0230] To investigate whether the sperm of KI mice has the ability to fertilize oocytes after activation, 16-week-old WT, HE, and KI mice and 4-week-old WT female mice were selected for intracytoplasmic sperm injection (ICSI) experiments. The experimental procedure is as shown in C of Figure 3 . The experimental results are as shown in D of Figure 3 . For WT, HE, and KI mice, the 2-Cell and 4-Cell morphological development was uniform and plump, with fewer cell debris and uniform nuclear sizes. By the blastocyst stage on the 6th day, the blastocoel was filled with the embryo, the number of inner cell mass cells was relatively large, the cells were arranged tightly, and the number of trophoblast cells was relatively large, forming a compact layer. Next, the number of embryos developed at each stage was counted. As shown in Table 12, although the percentage of 2-Cell in KI mice was lower than that in WT mice (P<0.01), more than 50% of the embryos in WT, HE, and KI mice developed into 2-Cells. Moreover, there was no significant difference in the percentage of normal embryo development at the 4-Cell, morula, and blastocyst stages formed by sperm from KI mice compared with WT (P>0.05). Although the IVF experiment on KI mice failed, it was found through the ICSI experiment that the sperm could bind to the oocytes after being injected into the eggs and the embryos developed normally.

[0231] Table 12. Effects of NAMPT C39S point mutation on the culture of mouse ICSI embryos n, (%)

[0232]

[0233] Note: P values were obtained using Fisher's exact test. ** represents P<0.01, ns represents no statistical significance, and the statistical differences were all compared with the WT group; the numbers in the table represent the number of embryos at that stage, and the numbers in "()" represent the embryo development rate at each stage. The embryo development rate = the number of embryos at that stage / the number of eggs obtained.

[0234] Thus, it can be seen that the construction method of the embodiment of the present application can well construct asthenospermia and mouse infertility models, with high experimental biological repeatability, stable results, and a mouse mortality rate of 0% during the modeling process, indicating that this method is effective, safe, and feasible.

[0235] The sequences involved in the present invention are shown in Table 13.

[0236] Table 13. Sequence Listing

[0237]

[0238] The description of the above embodiments is only for understanding the method of the present invention and its core idea. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. Application of CRISPR-Cas9 gene targeting system in preparing male sterility animal model, characterized in that: The CRISPR-Cas9 gene targeting system includes a gRNA specifically targeting the NAMPT gene, a Cas9 mRNA, and a donor DNA sequence containing a NAMPT mutation site; The sequence of the gRNA is: UGAAAGUUACGGCACUUU; The target sequence of the gRNA specifically targeting the NAMPT gene is TTTCACGGCATTCAAAGTAGG, which includes the PAM sequence at the end; The PAM sequence is AGG; The donor DNA sequence containing the NAMPT mutation site is TAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG; The male infertility animal model is an asthenozoospermia mouse model.

2. A method for constructing a male sterile animal model, characterized in that: The method comprises using the CRISPR-Cas9 gene targeting system described in claim 1; The male infertility animal model is an asthenozoospermia mouse model.

3. The method according to claim 2, characterized in that The method comprises the following steps: microinjecting the CRISPR-Cas9 gene targeting system described in claim 1 to obtain mutant DNA, transferring fertilized eggs containing the mutant DNA into female animals, performing genotyping on newborn animals, and obtaining chimeric animal F0 generations; The sequence of the mutant DNA is TAGGTTACTCACTATAAACAATACCCACCAAATACAAGCAAAGTTTATTCATATTTTGAATCCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG; The chimeric animals F0 generation are crossed with wild-type animals to obtain heterozygous animals F1 generation, the F1 generation is backcrossed with wild-type animals to obtain heterozygous animals F2 generation, and the F2 generation is self-pollinated to obtain homozygous animals F3 generation, that is, the male sterile animal model.

4. The use of the animal model obtained by the method according to any one of claims 2 to 3, characterized in that: The application is any of the following: 1) Application in constructing disease models related to male sterility; 2) Application in the study of the pathogenesis of male infertility-related diseases; 3) Application in screening candidate drugs for male infertility-related diseases; The male infertility-related disease is asthenozoospermia.

Images