Gene editing system and application thereof in efficient plant gene editing

Abstract

The invention discloses a gene editing system and application thereof in efficient editing of plant genes, gRNA delivered by TRV (transient receptor virus) enters most of tissues or cells of explants, a large number of copies can be generated by self-replication of the virus, subgenome promoters on the copies drive expression of the gRNA, and the expression of the gRNA is driven by the subgenome promoters on the copies. Compared with a conventional III type promoter integrated into a genome, the expression quantity of gRNA is qualitatively improved, and the gene editing efficiency can be remarkably improved.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and specifically to a gene editing system and its application in efficient editing of plant genes. Background Art

[0002] Gene editing technology represented by the CRISPR / Cas9 system can precisely modify the target genome sequence, and its emergence has greatly promoted the development and progress of basic theoretical research and crop genetic breeding technology. In the field of plants, the expression frames of Cas9, gRNA and selection marker genes in the same T-DNA framework are integrated into the genome of the host cell mainly through Agrobacterium transformation, and then the positive cells are screened out with a selection agent to regenerate and obtain gene-edited offspring.

[0003] At present, type II promoters are mainly used to drive the expression of Cas9 in plants, and type III promoters are used to drive the expression of gRNA. Since the editing efficiency is closely related to the expression efficiency of CRISPR elements, the transcriptional capacity of type III promoters is usually lower than that of type II promoters, and the versatility in different species is poor, which may reduce the editing efficiency of the CRISPR system in plants. In order to obtain a certain number of edited plants, researchers have to carry out genetic transformation in large quantities, resulting in a waste of manpower and material resources. In addition, due to the low editing efficiency, the edited plants obtained are often heterozygous or mosaic types, so the corresponding mutant phenotypes cannot be observed in the T0 generation. It is necessary to obtain homozygous edited offspring of the target gene through self-pollination and other means, which increases the breeding cycle. More importantly, for some crops with long reproductive cycles or asexual reproduction, it is basically impossible to obtain homozygous edited offspring. In addition, the continuous expression of gene editing elements integrated into the plant genome may lead to additional off-target effects, affecting the application of gene editing technology in commercial breeding. Therefore, it is of great significance to develop methods in plants that can efficiently edit target genes and avoid additional off-targets.

[0004] Viruses can replicate in host cells, thus producing very high copy numbers, and have the ability to migrate between different cells. Therefore, using viral vectors to deliver CRISPR elements is a very promising gene editing method. In the field of plants, researchers mainly deliver viruses carrying CRISPR elements into living plants. The viruses migrate to the meristem through vascular bundles and plasmodesmata to edit the location. The edited meristem can develop into reproductive cells, and then obtain gene-edited offspring through sexual reproduction. However, only a very small number of viruses have the ability to infect meristems, so currently a few model species can obtain gene-edited offspring in this way without tissue culture. In addition, CRISPR elements delivered by viruses can also edit somatic cells, and then regenerated edited plants can be obtained by in vitro tissue culture. However, after long-distance transportation, due to the unevenness of replication and movement, viruses that correctly carry CRISPR elements often cannot effectively enter the cells of the target tissue. These limit the effective application of viral vector delivery of CRISPR elements to achieve gene editing methods. Summary of the invention

[0005] The purpose of the present invention is to propose a gene editing system and its application in efficient editing of plant genes, so as to solve the defects of the prior art that the gene editing efficiency is low, resulting in a long cycle and difficult breeding.

[0006] The first aspect of the present invention is to propose a recombinant expression vector, which is a TRV virus recombinant vector TRV2-gRNA containing gRNA and a truncated Arabidopsis FT sequence; the gRNA is driven by the PEBV subgenomic promoter sgP, and the capsid protein of the TRV virus is replaced by the eYGFPuv fluorescent protein.

[0007] Furthermore, the recombinant expression vector comprises an expression cassette having a nucleotide sequence as shown in SEQ ID NO: 1, or an expression cassette having at least 90% homology to the sequence shown in SEQ ID NO: 1 and having the same function.

[0008] Furthermore, it is characterized in that the construction method comprises:

[0009] The 35S promoter, 5'UTR and CP of TRV2 vector were removed, and the remaining fragments were recovered;

[0010] Amplification primers were designed to specifically amplify eYGFPuv, PEBV subgenomic promoter sgP, gRNA framework and truncated Arabidopsis FT sequence, as well as 35S promoter and 5'UTR portion of TRV2; the amplified product was connected to the recovered fragment to obtain pTRV2-K-gRNA;

[0011] A single-stranded primer containing homology arms at both ends and a 20 bp target site was synthesized and homologous recombination was performed with the pTRV2-K-gRNA vector digested with KpnI to obtain the recombinant expression vector TRV2-gRNA.

[0012] Furthermore, the gRNA targets several gene loci, and each target gene gRNA is used to construct TRV2-gRNA one by one, or each target gene gRNA is connected in series to construct TRV2-gRNA.

[0013] Preferably, the gRNA is linked to the tRNA and then integrated into the vector.

[0014] The second aspect of the present invention is to provide a gene editing system, including an engineered bacteria combination, which is obtained by separately transforming the auxiliary plasmid pTRV1, the Cas9 gene vector, and the recombinant expression vector described in the first aspect into Agrobacterium.

[0015] Furthermore, the ratio of each strain in the engineering bacteria combination is preferably 1:1:4 for Agrobacterium strain containing pTRV2-gRNA: Agrobacterium containing auxiliary plasmid pTRV1: Agrobacterium strain delivering Cas9 vector 35S-Cas9.

[0016] Furthermore, in the Cas9 gene vector, Cas9 is driven by a 35S promoter.

[0017] Furthermore, the gene editing system also includes a common infection solution, which is used with the engineered bacteria to dilute the concentration and infect the plant; preferably, the infection solution is adjusted to a final concentration of OD 600 =0.6.

[0018] The third aspect of the present invention is to propose the application of the recombinant expression vector described in the first aspect or the gene editing system described in the second aspect in the efficient editing of plant genes.

[0019] Furthermore, it is characterized in that the plant is tobacco.

[0020] The fourth aspect of the present invention is to propose a method for efficient plant gene editing, in which the gene editing system described in the second aspect is used to infect explants, and Cas9-positive regenerated plants are screened to obtain gene-edited plants.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The recombinant expression vector of the present invention provides a visual gene editing tool. During the genetic transformation process, factors such as the state of the explant and the culture environment strongly affect the genetic transformation efficiency, and then affect the editing efficiency. The present invention uses eYGFPuv fluorescent protein to replace the CP of TRV, and the replication and migration of the virus can be monitored by green fluorescence. The higher the brightness of green fluorescence, the larger the area on the explant, indicating that the infection of the virus is better. The infection of the virus determines the expression of gRNA, so it can be judged by observing the fluorescence intensity in the early stage of genetic transformation.

[0023] The gene editing method provided by the present invention allows the gRNA delivered by the TRV virus to enter the vast majority of tissues or cells of the explant through viral replication and migration. The self-replication of the virus can produce a large number of copies, and the subgenomic promoters on these copies drive the expression of the gRNA. Compared with the conventional type III promoter integrated into the genome, the expression amount of the gRNA is qualitatively improved. Therefore, this method can significantly improve the efficiency of gene editing.

[0024] The recombinant expression vector of the present invention provides a gene editing tool that reduces the possibility of off-target in future generations. In conventional gene editing vectors, the expression frame of CAS9 and the expression frame of gRNA are located in the same T-DNA region. After gene editing is completed, the continuous expression of gene editing elements in the plant may cause new off-target. The gRNA in the present invention is delivered by RNA virus TRV through transient expression. After gene editing is completed, during the regeneration of the explant, the TRV virus is removed due to the use of antiviral agents. There is no more expression of gRNA in the regenerated plant, so no new off-target will be generated. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of the structure of the vector pTRV2-K-gRNA constructed in Example 1 of the present invention.

[0026] Figure 2 This is a diagram showing the fluorescence state of the explant under ultraviolet irradiation in Example 1 of the present invention.

[0027] Figure 3 Schematic diagram of the PDS3 gene-edited plants and mutant genotypes in Example 1 of the present invention.

[0028] Figure 4 Schematic diagram of the structure of the 35S-Cas9-gRNA vector constructed in Example 2 of the present invention.

[0029] Figure 5This is a schematic diagram of the editing results of the transformed plants of 6 35S-Cas9-gRNA series vectors and 6 groups of transformed plants of pTRV2-gRNA series vectors in Example 2 of the present invention.

[0030] Figure 6 This is a map of the pTRV2-gRNA1-gRNA2-gRNA3 and pTRV2-gRNA4-gRNA5-gRNA6 vectors constructed in Example 3 of the present invention. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] In one embodiment, a method is provided for infecting an ex vivo tissue with a viral vector that delivers a CRISPR element, and then efficiently obtaining a gene-edited plant through plant tissue culture. Based on the TRV virus delivering gRNA to infect explants, the replication and movement of the virus are judged by the green fluorescence visible to the naked eye. The method can efficiently edit the endogenous genes of the model species Nicotiana benthamiana, and achieve 80% homozygous or biallelic editing of 4 copies of the PDS3 gene. Compared with the conventional editing method of simultaneously expressing gRNA and Cas9 in a T-DNA region, the method of using different Agrobacterium to deliver Cas9 and TRV viral vectors carrying gRNA separately, and then co-infecting explants has a higher editing efficiency, and the editing types are mostly homozygous or biallelic editing. In addition, in addition to being able to effectively edit a single target site of a plant gene, when the TRV vector delivers multiple gRNAs, the method can simultaneously perform efficient gene editing on multiple target sites. Most of the gene-edited offspring mediated by the TRV method of delivering gRNA can be successfully detoxified and thus do not contain the TRV2 component carrying gRNA, thereby avoiding the continuous expression of the CRISPR system and generating new off-target possibilities.

[0033] In the above embodiment, a gene editing system was used, which included an expression vector of gRNA, wherein the expression vector was a TRV viral recombinant vector in which the capsid protein was replaced by eYGFPuv, and contained a gRNA driven by the PEBV subgenomic promoter sgP and a truncated Arabidopsis FT sequence.

[0034] In some specific embodiments, the eYGFPuv replaces the capsid protein and contains a recombinant vector containing a gRNA driven by the PEBV subgenomic promoter sgP and a truncated Arabidopsis FT sequence. The empty vector used can be but is not limited to a TRV viral vector, and the constructed recombinant vector is pTRV2-gRNA.

[0035] In another embodiment, the gene editing system is applied to plant gene editing, which can significantly improve the efficiency of gene editing. Based on the virus-mediated efficient gene editing method, a TRV virus recombinant vector containing eYGFPuv replacing the capsid protein, gRNA driven by the PEBV subgenomic promoter sgP, and a truncated Arabidopsis FT sequence is constructed, the strain is transformed, and the explant is co-infected with the Cas9 vector, and then the Cas9-positive plant is screened for regeneration using a screening agent during tissue culture.

[0036] In some specific embodiments, the transformed strain is Agrobacterium; preferably, the plant is tobacco.

[0037] In some specific embodiments, the Cas9 gene-containing vector is 35S-Cas9 (i.e., pHSE401 vector), in which Cas9 is driven by the 35S promoter; the eYGFPuv replaces the capsid protein, contains a gRNA driven by the PEBV subgenomic promoter sgP, and a truncated Arabidopsis FT sequence in the TRV virus recombinant vector pTRV2-gRNA.

[0038] Specifically, after the Agrobacterium containing the TRV viral vector infects some cells of the explant, the viral mRNA is transcribed through transient expression, and then the replicase protein is translated, thereby mediating the replication of the virus. After the virus replicates, a large number of copies are produced, and these newly formed virus particles can be transferred to other cells of the explant through the vascular bundle or intercellular filaments. The virus particles replicate and migrate again in the new cells, and eventually infect most of the cells or tissues of the explant. The capsid protein is replaced by eYGFPuv through the modified TRV viral recombinant vector, and a large amount of fluorescent protein is expressed under the drive of the TRV viral subgenomic promoter. Therefore, the explants successfully infected by the virus show bright green fluorescence under 365nm ultraviolet light. The truncated Arabidopsis FT sequence is added to TRV2, which can promote the migration of the TRV virus. During the replication and migration process, the TRV virus delivers a large amount of gRNA to most cells of the explant, including cells stably transformed by 35S-Cas9 Agrobacterium. At this time, these cells contain both Cas9 expressed by the 35S-Cas9 vector and a large amount of gRNA delivered by the TRV virus, so these cells can be edited. In addition to the Cas9 expression frame, the T-DNA region of 35S-Cas9 also contains the expression frame of the selection marker gene HPT. Therefore, during the tissue culture process, 10 mg / L hygromycin can be used to screen out these cells for regeneration, and the regenerated plants are gene-edited plants.

[0039] In some specific embodiments, albino plants can be obtained in the T0 generation by editing tobacco PDS3, and second-generation sequencing of positive plants revealed that the editing frequency of the PDS3 gene was as high as 90%, and the co-editing frequency of the four copies was as high as 82%, indicating that this method can efficiently edit endogenous genes of Nicotiana benthamiana.

[0040] In some specific embodiments, the method is compared with a conventional gene editing system expressing gRNA and Cas9 in the same T-DNA region. The present method can edit the target gene more efficiently, and the editing results are mostly homozygous or biallelic mutations.

[0041] In some specific embodiments, the method can simultaneously express multiple sgRNAs to target multiple loci, and the gene editing efficiency from a single site on a multi-mutation vector is comparable to that of a single sgRNA, and can efficiently obtain plants whose offspring have mutations at two or three target loci.

[0042] In some specific embodiments, a virus-induced efficient gene editing method of the present invention comprises the following specific steps:

[0043] Step 1, construction of pTRV2-K-gRNA recombinant vector: Full gene synthesis including eYGFPuv, PEBV subgenomic promoter sgP, gRNA framework and truncated Arabidopsis FT sequence, design specific primers for amplification; design specific primers to amplify 35S promoter and 5'UTR of TRV2. The amplified product was connected to the pTRV2 vector treated with HindⅢ+SacI, the ligated product was transformed into Escherichia coli, and the plasmid was extracted after sequencing of the positive transformant to obtain pTRV2-K-gRNA.

[0044] Step 2, construction of PTRV2-gRNA recombinant vector: synthesize single-stranded primers containing homology arms at both ends and 20 bp of target site, perform homologous recombination with pTRV2-K-gRNA vector digested with KpnI, and transform Escherichia coli with ligated products. Extract the plasmid of the transformant, confirm the correctness by sequencing, and obtain the target vector, named pTRV2-gRNA.

[0045] Step 3, genetic transformation: The recombinant vector PTRV2-gRNA obtained in step 2 is transformed into Agrobacterium, and mixed with Agrobacterium containing the auxiliary vector pTRV1 and the Cas9 delivery vector 35S-Cas9 in a bacterial solution ratio of 1:1:4 to infect explants, and Cas9-positive regenerated plants are selected using a plant resistance screening agent to obtain gene-edited plants.

[0046] In some specific embodiments, in step 2, gRNA is designed for the target gene, and the gRNA is then integrated into the pTRV2-K-gRNA vector.

[0047] In some specific embodiments, in step 2, multiple gRNAs are designed for multiple target genes, and the multiple gRNAs are interactively connected through tRNA and then integrated into the pTRV2-K-gRNA vector.

[0048] In some specific embodiments, the nucleotide sequence of the expression frame of pTRV2-K-gRNA is as shown in SEQ ID NO: 1, or a sequence that has at least 90% homology and the same function as SEQ ID NO: 1.

[0049] In the above nucleotide sequences, homology refers to the identity of the nucleotide sequences. The identity of the nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage website.

[0050] The following are specific implementation examples to illustrate the above scheme and technical effects. Unless otherwise specified, the means used are methods that are well-known to those skilled in the art, and the reagents used are standard commercial products in the art.

[0051] Example 1

[0052] In this example, the capsid protein of the TRV virus was replaced with the green fluorescent protein eYGFPuv, which can be observed with the naked eye in green plants, to monitor the replication and movement of the virus. The subgenomic promoter sgP of the PEBV virus was used to drive the expression of sgRNA, and the truncated Arabidopsis FT sequence promoted the movement of the virus. The successfully constructed vector was named pTRV2-K-gRNA ( Figure 1 ).

[0053] The goal of this example is to use TRV virus to deliver gRNA to efficiently edit the endogenous genes of plants, so the chlorophyll synthesis-related gene PDS3 was first selected as the target gene for editing. Considering that Nicotiana benthamiana is an allotetraploid, there are 4 copies of the PDS3 gene, so the sequence "TTGGTAGTAGCGACTCCATG" present in all 4 copies was selected as the target. The relevant sequence of the PDS3 target was loaded into pTRV2-K-gRNA, and the obtained vector was named pTRV2-gRNA_PDS.

[0054] pTRV2-gRNA_PDS, the auxiliary vector pTRV1, and the donor vector 35S-Cas9 Agrobacterium of the Cas9 protein were mixed in a certain proportion and infected with leaf disc explants of Nicotiana benthamiana, and gene-edited plants were obtained through tissue culture.

[0055] 1. Construction of vector pTRV2-K-gRNA

[0056] 1) The pTRV2 vector was digested with HindIII+SacI to remove the 35S promoter, 5'UTR of TRV2 and CP, leaving only the 3'UTR and Nos terminator sequence. The remaining vector fragment was recovered by gel recovery.

[0057] 2) The whole gene synthesis includes eYGFPuv, PEBV subgenomic promoter sgP, gRNA framework and truncated Arabidopsis FT sequence (KpnI restriction site is reserved between PEBV subgenomic promoter and gRNA framework), and specific primers are designed for amplification; specific primers are designed to amplify the 35S promoter and the 5'UTR part of TRV2. The primer sequences are as follows (SEQ ID NO: 2-5):

[0058]

[0059] Connection of pTRV2-K-gRNA vector: The above PCR product and the recovered vector fragment are connected by homologous recombination to obtain a connection product, and the connection product is transformed into Escherichia coli to obtain a transformant. The plasmid of the transformant is extracted, and the transformant that is consistent with the expected sequence is sequenced, which is the target vector and named pTRV2-K-gRNA. The DNA sequence of the pTRV2-K-gRNA expression frame is shown in SEQ ID NO: 1.

[0060] 2. Construction of pTRV2-gRNA_PDS vector targeting PDS3 gene

[0061] The vector pTRV2-K-gRNA was digested with kpnI, and the digestion product was cut into gel to recover the linearized vector fragment. The single-stranded primer "ccgagttaacgagtctagaTTGGTAGTAGCGACTCCATGgttttagagctagaaatagc" (SEQ ID NO: 6) with homology arms added 20bp upstream and downstream of the PDS3 target was used to connect the recovered vector fragment by homologous recombination to obtain a connection product, which was transferred into Escherichia coli to obtain a transformant. The plasmid of the transformant was extracted and sequenced to confirm its correctness, and was named pTRV2-gRNA_PDS.

[0062] 3. Genetic transformation targeting the PDS3 gene

[0063] pTRV2-gRNA_PDS, auxiliary plasmid pTRV1 and Cas9 delivery vector 35S-Cas9 were transformed into Agrobacterium, and the strains were mixed in a ratio of 1:1:4. The final concentration was adjusted to OD 600 =0.6. According to the conventional method, the above-mentioned infection solution containing mixed Agrobacterium was used to infect Nicotiana benthamiana leaf disk explants. After culturing for 3 days at 22°C, transgenic plants were selected on a selection medium containing 10 mg / L hygromycin. When the regenerated plants reached 2 cm in length, they were cut from the callus and transferred to a rooting medium for cultivation. After about a month, transgenic plants with dense root systems were obtained. The transgenic plants were transferred to nutrient soil for planting (i.e., T0 generation plants), and seeds were harvested after maturity.

[0064] 4. Editing Type Identification

[0065] Hi-TOM sequencing technology was used to detect the mutation efficiency of each target site in the resistant transgenic plant T0. The specific primers used are as follows (SEQ ID NO: 7-10):

[0066]

[0067] The sequencing results were compared with the reference sequence, and the mutation frequency was 0-15% as wild type, 15-35% as mosaic, 35%-85% as heterozygous, and 85-100% as homozygous. Wild type and mosaic were recorded as unedited in the statistics.

[0068] 5. Experimental Results

[0069] 1) Five days after infection, under dark conditions, the leaf disc explants showed bright green fluorescence under 365nm ultraviolet light, such as Figure 2 As shown in Figure 2, all explants had bright green fluorescence, and the fluorescence covered most of the explants. This result indicated that the TRV virus replicated in the explants, produced a large number of copies, and was able to migrate between different cells.

[0070] 2) Some albino plants were observed in the regenerated plants. Sequencing of these plants revealed that all four copies of the PDS3 gene had frameshift mutations. Figure 3 shown.

[0071] 3) Sequencing was performed on the positive plants with green leaves and normal morphology, and it was found that most of them were also homozygous mutants with 4 copies. However, because some copies had base deletions that were integer multiples of 3, the normal function of the protein was retained, and the leaves of the plants were green. Figure 3 shown.

[0072] 4) The editing frequency of PDS3 was statistically analyzed. About 82% of the regenerated plants were homozygous mutants with 4 copies, and 90% of the plants had at least one copy of the mutation, as shown in Table 1. This indicates that the method used in this example has a very high editing efficiency on the endogenous gene of Nicotiana benthamiana.

[0073] Table 1:

[0074]

[0075]

[0076] Example 2

[0077] The goal of this example is to use TRV virus to deliver gRNA to achieve efficient gene editing of plant endogenous genes. In addition to the demonstration of efficient editing of endogenous genes in Example 1, this example further confirms that the method of TRV virus delivery of gRNA can efficiently edit endogenous genes in plants by comparison with conventional gene editing methods.

[0078] In this example, six genes in Nicotiana benthamiana were selected as targets, and one target was designed for each gene for gene editing. Two vectors were constructed for each target, one of which was constructed with the 35S-Cas9 vector as the backbone, and the AtU6 promoter was used to drive the expression of gRNA. The vector was named 35S-Cas9-gRNA; the other was a vector for delivering gRNA by TRV virus. After the vector construction was completed, genetic transformation was performed, and gene-edited plants were obtained by tissue culture.

[0079] 1. Target selection

[0080] Use the CRISPR-P 2.0 online website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) to select the corresponding plant genome database, such as tobacco, select the Nicotiana bentham iana genome for target design. The gene name and target information are shown in Table 2 (SEQ ID NO: 11-16).

[0081] Table 2:

[0082]

[0083] 2. Construction of 35S-Cas9-gRNA related vectors

[0084] The 35S-Cas9 vector was digested with BsaI, and the digested product was cut into gel to recover the linearized vector fragment. Specific primers were designed to amplify the tRNA element, and the PCR product and the recovered vector fragment were connected together by homologous recombination, so that a KpnI restriction site was retained between the tRNA and gRNA frameworks. The ligation product was transferred into Escherichia coli to obtain a transformant. The plasmid of the transformant was extracted and sequenced to prove its correctness, and was named 35S-Cas9-tRNA-K-gRNA. The DNA sequence of the gRNA expression frame sequence of the 35S-Cas9-tRNA-K-gRNA vector is shown in SEQ ID NO: 17.

[0085] The 35S-Cas9-tRNA-K-gRNA vector was digested with KpnI, and the digested product was cut on gel to recover the linearized vector fragment. A long-chain primer containing upstream and downstream homology arms and target information was synthesized, and connected to the recovered vector fragment by homologous recombination. The connection product was transferred into Escherichia coli to obtain a transformant. The plasmid of the transformant was extracted and sequenced to prove its correctness. According to different targets, they were named 35S-Cas9-gRNA1, 35S-Cas9-gRNA2, 35S-Cas9-gRNA3, 35S-Cas9-gRNA4, 35S-Cas9-gRNA5, and 35S-Cas9-gRNA6. The structure of the 35S-Cas9-gRNA vector is shown in the figure. Figure 4 shown.

[0086] The primer sequences are as follows (SEQ ID NO: 18-25):

[0087]

[0088] 3. Construction of pTRV2-gRNA related vectors

[0089] The vector pTRV2-K-gRNA constructed in Example 1 was digested with KpnI, and the digestion product was cut into gel to recover the linearized vector fragment. A long-chain primer containing upstream and downstream homologous arms and target information was synthesized, and the recovered vector fragment was connected together using homologous recombination. The connection product was transferred into Escherichia coli to obtain a transformant. The plasmid of the transformant was extracted and sequenced to prove that it was correct. According to the different targets, they were named pTRV2-gRNA1, pTRV2-gRNA2, pTRV2-gRNA3, pTRV2-gRNA4, pTRV2-gRNA5, and pTRV2-gRNA6. The primer sequences containing upstream homologous arms and target information are shown below (SEQ ID NO: 26-31):

[0090]

[0091] 4. Genetic Transformation

[0092] The six vectors pTRV2-gRNA1 to pTRV2-gRNA6, the auxiliary plasmid pTRV1, and the vector 35S-Cas9 for delivering Cas9 were transformed into Agrobacterium, and then the six Agrobacterium pTRV2-gRNA1 to pTRV2-gRNA6 were mixed with the Agrobacterium strains containing the auxiliary plasmid pTRV1 and the vector 35S-Cas9 for delivering Cas9 at a ratio of 1:1:4, and the final concentration was adjusted to OD 0. 600=0.6; transform the six vectors 35S-Cas9-gRNA1 to 35S-Cas9-gRNA6 into Agrobacterium tumefaciens respectively, and then adjust the bacterial solution concentration to OD 600 =0.6. According to the conventional method, the above-mentioned Agrobacterium was used to infect the Nicotiana benthamiana leaf disk explants respectively, and after culturing for 3 days at 22°C, the transgenic plants were screened on a selection medium containing 10 mg / L hygromycin. When the regenerated plants reached 2 cm in length, they were cut from the callus and transferred to a rooting medium for cultivation. After about a month, transgenic plants with dense root systems were obtained. The transgenic plants were transferred to nutrient soil for planting (i.e., T0 generation plants), and the seeds were harvested after maturity.

[0093] 5. Editing Type Identification

[0094] Hi-TOM sequencing technology was used to detect the mutation efficiency of each target site in the resistant transgenic plant T0. The specific primers used (SEQ ID NO: 32-43, gRNA1 forward and reverse primers are SEQ ID NO: 32-33, and so on) are shown in Table 3. The sequencing results were compared with the reference sequence. The mutation frequency was 0-15% and the genotype was defined as wild type, 15-35% as mosaic, 35%-85% as heterozygous, and 85-100% as homozygous. Wild type and mosaic were recorded as unedited in statistics.

[0095] Table 3:

[0096]

[0097] 6. Experimental Results

[0098] 1) The editing results of the transformed plants of 6 35S-Cas9-gRNA series vectors and 6 groups of transformed plants of pTRV2-gRNA series vectors are as follows Figure 5 As shown, "T-DNA" represents the editing results of the 35S-Cas9-gRNA series, and "TRV" represents the editing results of the pTRV2-gRNA series vectors. Both methods obtained gene-edited plants at 6 target sites. The editing efficiencies of the T-DNA control group vs. TRV experimental group at different targets were: gRNA1, 81.3% vs. 82.9%; gRNA2, 46.9% vs. 87.5%; gRNA3, 65.6% vs. 87.5%; gRNA4, 43.8% vs. 87.5%; gRNA5, 90.6% vs. 93.8%; gRNA6, 84.4% vs. 94.6%. At the 6 target sites, the editing efficiency of the virus-mediated gRNA method of this embodiment was significantly higher than that of the conventional vector 35S-Cas9-gRNA.

[0099] 2) Homozygous edited plants can observe the corresponding phenotype of gene editing in the T0 generation, so it is of great significance to improve the efficiency of homozygous editing. The method of the present invention is significantly higher in efficiency of homozygous editing than conventional vectors. The T-DNA control group vs TRV experimental group is: gRNA1, 56.3% vs 82.9%; gRNA2, 9.4% vs 81.3%; gRNA3, 31.3% vs 75.0%; gRNA4, 18.8% vs 84.4%; gRNA5, 75.0% vs 93.8%; gRNA6, 68.8% vs 94.6%.

[0100] Example 3

[0101] The goal of this example is to use TRV virus to deliver gRNA to achieve efficient gene editing of plant endogenous genes. In addition to the efficient editing of a single target of plant endogenous genes demonstrated in Examples 1 and 2, this example also uses TRV virus to deliver multiple gRNAs in series, further confirming that the method of TRV virus delivery of gRNA can simultaneously and efficiently edit multiple genes in plants.

[0102] In this example, the six genes in Example 2 were selected as targets, the same six gRNAs were selected, and three gRNAs were constructed into one vector, and two vectors were constructed to deliver three gRNAs each. TRV virus delivered three gRNA vectors connected in series for genetic transformation, and gene-edited plants were obtained by tissue culture.

[0103] 1. Construction of pTRV2-gRNA1-gRNA2-gRNA3 and pTRV2-gRNA4-gRNA5-gRNA6

[0104] The vector pTRV2-K-gRNA in Example 1 was digested with KpnI, and the digestion product was recovered by gel cutting to linearize the vector fragment. The gRNA1-gRNA2-gRNA3 and gRNA4-gRNA5-gRNA6 sequences were synthesized in full sequence, and the different gRNAs were divided by tRNA structures. Specific primers were designed for amplification, and the PCR product was connected with the digested and recovered vector fragments by homologous recombination to obtain a connection product, which was transferred into Escherichia coli to obtain a transformant. The plasmid of the transformant was extracted and sequenced to prove its correctness, and was named pTRV2-gRNA1-gRNA2-gRNA3 and pTRV2-gRNA4-gRNA5-gRNA6. The vector map is shown in Figure 6 shown.

[0105] 2. Genetic transformation

[0106] The pTRV2-gRNA1-gRNA2-gRNA3 and pTRV2-gRNA4-gRNA5-gRNA6 vectors, the auxiliary plasmid pTRV1, and the vector 35S-Cas9 for delivering Cas9 were transformed into Agrobacterium, and then the pTRV2-gRNA1-gRNA2-gRNA3 or pTRV2-gRNA4-gRNA5-gRNA6 vectors were mixed with the auxiliary plasmid pTRV1 and the vector 35S-Cas9 for delivering Cas9 in a ratio of 1:1:4, and the final concentration was adjusted to OD using tobacco infection solution. 600 =0.6, transformed Nicotiana benthamiana leaf disc explants, and after tissue culture process, positive plants were finally obtained.

[0107] 3. Analysis of gene editing efficiency

[0108] The editing efficiency of the offspring transformed with pTRV2-gRNA1-gRNA2-gRNA3 was detected using the primers for detecting gRNA1, gRNA2, and gRNA3 in Example 2, and the editing efficiency of the offspring transformed with pTRV2-gRNA4-gRNA5-gRNA6 was detected using the primers for detecting gRNA4, gRNA5, and gRNA6 in Example 2. The sequencing results were compared with the reference sequence, and the mutation frequency was 0-15%, and the genotype was defined as wild type, 15-35% as mosaic, 35-85% as heterozygous, and 85-100% as homozygous. Wild type and mosaic were recorded as unedited in statistics.

[0109] The test results are shown in Table 4. The results show that when the TRV virus delivered the three tandem gRNAs gRNA1-gRNA2-gRNA3, very high editing efficiencies were obtained, which were 97.7%, 100.0%, and 88.6%, respectively, and the frequency of simultaneous editing of the three genes was 86.4%. When the TRV virus delivered the three tandem gRNAs gRNA4-gRNA5-gRNA6, very high editing efficiencies were also obtained, which were 87.5%, 87.5%, and 90.6%, respectively, and the frequency of simultaneous editing of the three genes was 84.4%. This result shows that TRV delivery of multiple tandem gRNAs can efficiently edit multiple genes in plants.

[0110] Table 4:

[0111]

[0112] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant expression vector, characterized in that: It is a TRV virus recombinant vector TRV2-gRNA containing gRNA and truncated Arabidopsis FT sequence; the gRNA is driven by the PEBV subgenomic promoter sgP, and the capsid protein of the TRV virus is replaced by the eYGFPuv fluorescent protein.

2. The recombinant expression vector according to claim 1, characterized in that The recombinant expression vector comprises an expression frame having a nucleotide sequence as shown in SEQ ID NO: 1, or an expression frame having at least 90% homology with the sequence shown in SEQ ID NO: 1 and having the same function.

3. The recombinant expression vector according to claim 1, characterized in that The build methods include: The 35S promoter, 5'UTR and CP of TRV2 vector were removed, and the remaining fragments were recovered; Amplification primers were designed to specifically amplify eYGFPuv, PEBV subgenomic promoter sgP, gRNA framework and truncated Arabidopsis FT sequence, as well as 35S promoter and 5'UTR portion of TRV2; the amplified product was connected to the recovered fragment to obtain pTRV2-K-gRNA; A single-stranded primer containing homology arms at both ends and a 20 bp target site was synthesized and homologously recombined with the pTRV2-K-gRNA vector digested with KpnI to obtain the recombinant expression vector TRV2-gRNA.

4. The recombinant expression vector according to claim 1, characterized in that The gRNA targets several gene loci, and each target gene gRNA is used to construct TRV2-gRNA one by one, or each target gene gRNA is used in series to construct TRV2-gRNA.

5. The recombinant expression vector according to claim 4, characterized in that: The gRNA is linked via tRNA interaction and then integrated into the vector.

6. A gene editing system, characterized in that: The engineered bacteria combination is obtained by transforming the auxiliary plasmid pTRV1, the Cas9 gene vector, and the recombinant expression vector according to any one of claims 1 to 5 into Agrobacterium separately.

7. The gene editing system according to claim 6, characterized in that: In the Cas9 gene vector, Cas9 is driven by a 35S promoter.

8. Use of the recombinant expression vector according to claim 1 or the gene editing system according to claim 6 in efficient editing of plant genes.

9. The use according to claim 8, characterized in that: The plant is tobacco.

10. A method for efficient plant gene editing, characterized in that: The gene editing system described in claim 6 is used to infect explants, and Cas9-positive regenerated plants are screened to obtain gene-edited plants.

Images