Primer set of molecular markers for identifying peanut stalk strength and its application

Abstract

The present invention belongs to the field of plant genetic breeding and specifically discloses a primer set of a molecular marker for identifying peanut stalk strength and its application. A site significantly associated with stalk strength is identified by whole-genome association analysis. The molecular marker is SNP site 2_31358672, located on peanut chromosome A02 at 31358672 bp. The sequence of 100 bp before and after the SNP site 2_31358672 is shown in SEQ ID NO. 1. When the genotype of the SNP site 2_31358672 is C / C, the corresponding peanut has high stalk strength, while when the genotype is A / C, the corresponding peanut has poor stalk strength. This molecular marker can be used to identify and screen peanut varieties with high stalk strength and suitable for mechanization at an early stage, thereby greatly saving production costs and improving production efficiency.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic breeding, in particular to a molecular marker primer set for peanut stalk strength identification and application thereof. Background Art

[0002] Peanuts are an important oilseed and cash crop cultivated worldwide. Peanuts are also a major source of protein, edible oil, and vitamins, and they occupy a prominent position in my country. Peanut stalks support the structure of the aboveground peanuts and transport nutrients. With the continuous expansion of peanut production areas, improving production efficiency is a key goal. Therefore, mechanized production has become a key development direction for peanut production. Stalk strength is a key factor influencing peanut mechanization. Stalk lodging is a serious problem that affects crop yield and quality. Recent studies have shown that strong stalks significantly reduce the frequency of lodging. Among rapeseed varieties, ZS11 is a highly adaptable, stable-yielding variety with strong lodging resistance. High stalk mechanical strength is the primary factor contributing to ZS11's excellent lodging resistance.

[0003] With the rapid development of high-throughput sequencing technology, genome-wide association studies (GWAS) are becoming increasingly widespread. GWAS link observable traits (phenotypes) to genotypes, thereby identifying genetic variants (markers) most likely to influence the trait and identifying genes associated with trait variation. Since the first GWAS study on age-related macular degeneration was reported in Science in 2005 (Klein et al. 2005), a series of related GWAS studies have been reported. In recent years, GWAS have been widely used in plant research. For example, Mazaheri et al. used a panel of 942 maize inbred lines and 899,784 RNA-Seq-derived single nucleotide polymorphism (SNP) markers to identify 16 candidate genes associated with four stalk traits through GWAS analysis (Mazaheri et al. 2019). GWAS has also been widely used in peanut research. Zhou et al. (Zhou et al. 2021) used peanut micro-core germplasm as material and used whole-genome association analysis to identify 57 SNP sites that were significantly associated with pod size traits.

[0004] The stem plays a vital role in plants, supporting their growth and transporting nutrients. However, for underground fruiting crops like peanuts, weak stems can easily break or bend, severely impacting yield. Therefore, research on stem strength is essential. However, no research on this topic has been conducted on peanuts.

[0005] Chinese patent application number CN201810060028.2 discloses a primer set for detecting the rice lodging resistance gene SCM3. The SCM3 gene includes three SNP molecular markers: K_030531, K_030532, and K_030533. The polymorphic bases of K_030531 are C or T, the polymorphic bases of K_030532 are T or C, and the polymorphic bases of K_030533 are C or G. Using these molecular markers, the lodging resistance SCM3 gene can be detected quickly and accurately, significantly improving the efficiency of gene transfer.

[0006] However, the above primer set is used for the rice lodging resistance gene SCM3, and the gene of rice is different from that of peanut. Therefore, the above primer set and molecular markers cannot be used to identify the stem strength of peanuts. Summary of the Invention

[0007] In order to solve the above technical problems, the present invention provides a primer set of molecular markers for identifying the strength of peanut stalks and its application.

[0008] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0009] One of the purposes of the present invention is to provide a primer set for molecular markers for identifying peanut stalk strength, the primer set comprising:

[0010] primer_X: GAAGGTGACCAAGTTCATGCTGCGCGAAATTGTGAACAATAC (SEQ ID NO. 2);

[0011] primer_Y: GAAGGTCGGAGTCAACGGATTGCGCGAAATTGTGAACAATAA (SEQ ID NO.3);

[0012] primer_C: GCTGGTTAGTTGTGCGAAGTT (SEQ ID NO.4);

[0013] Among them, the molecular marker is SNP site 2_31358672, located on peanut chromosome A02, at 31358672bp; the sequence of 100bp before and after the SNP site 2_31358672 is shown in SEQ ID NO.1.

[0014] A second object of the present invention is to provide a primer set for molecular markers for identifying peanut stalk strength and its application in identifying peanuts with high-strength peanut stalks, comprising the following steps:

[0015] S1. Extract DNA from the young leaves of the peanut to be identified, and perform polymerase chain reaction (PCR) identification using a molecular marker primer set;

[0016] S2. If the genotype of SNP site 2_31358672 is C / C, the stalk strength of the peanut to be identified is high; if the genotype of SNP site 2_31358672 is A / C, the stalk strength of the peanut to be identified is poor. Furthermore, the PCR reaction system consists of 5 μL DNA, 5 μL 2×KASP MasterMix, and 0.14 μL mixed primers (primer_X, primer_Y, and primer_C are mixed in a ratio of 1:1:2.5); the PCR reaction program is 94°C for 15 min; 94°C for 20 s, 61-55°C for 60 s, cooling at a rate of 0.6°C / cycle for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 26 cycles.

[0017] Compared with the existing technology, the present invention identified a site that is significantly correlated with stalk strength. This site is located at base 31358672bp on chromosome A02. When the genotype is C / C, the corresponding peanut stalk strength is high, and when the genotype is A / C, the stalk strength is poor. Through this molecular marker, peanut varieties with high stalk strength and suitable for mechanization can be identified and screened at an early stage, thereby greatly saving production costs and improving production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Normal distribution diagram of stem strength under different planting environments: A, ZC environment; B, ZJ environment; C, HN environment; D, BLUP environment.

[0019] Figure 2 For population structure analysis: A. Admixture calculates the optimal k value; B. Admixture performs population structure analysis and infers the population structure when k = 4 through analysis. A single vertical line represents a variety, and each color represents a population; C. Linkage disequilibrium plot.

[0020] Figure 3 is the distribution of SNPs across the entire genome.

[0021] Figure 4 Manhattan plot and QQplot of peanut culm strength obtained using the GLM method of TASSEL software for ZC environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0022] Figure 5Manhattan plot and QQplot of peanut culm strength obtained using the GLM method of TASSEL software for ZJ environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0023] Figure 6 Manhattan plot and QQplot of peanut culm strength obtained using the GLM method of TASSEL software for HN environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0024] Figure 7 The BLUP values (Best Linear Unbiased Predictors) calculated to correct the stalk strength were used. The Manhattan plot and QQplot of peanut stalk strength were obtained using the GLM method of TASSEL software: (a) Manhattan plot; (b) QQplot.

[0025] Figure 8 Manhattan plot and QQplot of peanut culm strength obtained using the mrMLM software package for ZC environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0026] Figure 9 Manhattan plot and QQplot of peanut culm strength using the mrMLM software package for ZJ environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0027] Figure 10 Manhattan plot and QQplot of peanut culm strength obtained using the mrMLM software package for HN environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0028] Figure 11 Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package: (a) Manhattan plot; (b) QQplot.

[0029] Figure 12 Manhattan plot of peanut culm strength obtained using the 3vmrMLM package for ZC environmental phenotypic data.

[0030] Figure 13 Manhattan plot of peanut culm strength obtained using the 3vmrMLM software package for the ZJ environmental phenotypic data.

[0031] Figure 14 Manhattan plot of peanut culm strength obtained using the 3vmrMLM package for HN environmental phenotypic data.

[0032] Figure 15To correct for stalk strength, the BLUP values (Best Linear Unbiased Predictors) were calculated using the Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package.

[0033] Figure 16 Haplotype analysis diagram of site 2__31358672: A, BLUP environment; B, ZC environment; C, HN environment.

[0034] Figure 17 It is a sequencing fragment containing 2__31358672 variable sites. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0036] Example 1: Identification of sites significantly associated with culm strength

[0037] 1. Field trial design

[0038] A total of 122 peanut accessions were planted in 2022 and 2023 at the Zengcheng Teaching and Research Base of South China Agricultural University in Zengcheng, Guangzhou, China (denoted as ZC), the Zhanjiang Academy of Agricultural Sciences (denoted as ZJ), and the Nanbin Farm in Hainan (denoted as HN). Details are shown in Table 1. A completely randomized block design was used for field planting in the three environments. Fifteen individual plants were planted for each variety, with 80 cm row spacing and 15 cm plant spacing. Field management was consistent with conventional field management.

[0039] Table 1: Field planting number, sequencing number and planting environment of 1122 peanut materials

[0040]

[0041]

[0042]

[0043] 2. Stem strength measurement

[0044] According to the method published in previous literature, the peanut stalk strength was measured at the second internode of the peanut stalk using a stalk strength tester during the peanut harvest period. The "break method" was selected and repeated three times. Figure 1 and as shown in Table 2.

[0045] Table 2 Statistical analysis of stem strength phenotype

[0046]

[0047] 3. Phenotypic Data Processing

[0048] The raw data were organized using Microsoft Office Excel, and the phenotypic data were statistically analyzed using SPSS Statistics Version 24 (IBM SPSS, IBM Corp, Armonk, NY, USA). The variance analysis was performed using a one-way ANOVA test to compare the mean values. The estimated variance components were calculated using the formula: 2 =σ 2 g / (σ 2 g+σ 2 e / r) to determine the broad-sense heritability of culm strength, where σ 2 g、σ 2 e represents the genotypic variance and environmental variance, respectively, and r is the number of environmental experiments.

[0049] 4. Genotype Data Analysis

[0050] Genotype data were obtained from the Shandong Academy of Agricultural Sciences. Genomic DNA was extracted from young leaves using a plant genomic DNA extraction kit, and library construction and amplification were performed according to standard protocols specified for the Illumina HiSeq 4000 sequencer and the BGISEQ500 sequencer. Using the Tifrunner genome as the reference genome, 122 peanut accessions were resequenced. Figure 2Figure 1 is a population structure analysis, where A is the optimal k value calculated using Admixture software; B is a population structure analysis using Admixture software, with the inferred population structure of k = 4. Each vertical line represents a variety, and each color represents a population; C is a linkage disequilibrium plot. Cultivated peanut (Arachis hypogaea L.) is an allotetraploid. Aracis hypogaea L. belongs to the Leguminosae family and is morphologically divided into two subspecies and six varieties: var. fastigiata, var. vulgaris, var. peruviana, and var. aequatoriana belong to the ssp. fastigiata, while var. hypogaea and var. hirsuta belong to the ssp. hypogaea. In this study, 122 peanut germplasm accessions were divided into four biological types: Valencia type (var. fastigiata), Spanish type (var. vulgais), Virginia type (var. peruviana), and Peruvian type (var. hypogaea). Population structure analysis also showed that 122 cultivated peanut accessions were divided into four subpopulations. SOAPnuke (v1.6.0) was used to filter the data, and the data removed included: (1) sequencing adapter; (2) low-quality base ratio (base quality ≤ 12) of > 50%; (3) N (unknown base) ratio of > 10%. After data filtering, SNPs were detected using Sentieon DNAseq software. First, the filtered data were mapped to the genome sequence of cultivated peanut (https: / / www.peanutbase.org / data / v2 / Arachis / hypogaea / genomes / Tifrunner.gnm1.KYV3). The Sentieon BWA model was used for alignment, and then the Sentieon Haplotyper model (the same algorithm as GATK) was used to name SNPs; finally, we used GATK to integrate multiple individual SNP sets of gVCF files into the final overall SNP set with VCF format. The distribution of SNPs across the whole genome is shown in Figure 2. Figure 3For SNP quality control, the SelectVariables model in GATK was used to remove low-quality SNPs. The SelectVariables model parameters included: QualByDepth (QD ≥ 2), FisherStrand (FS ≤ 60), RMSMappingQuality (MQ ≥ 40), MappingQualityRank SumTest (MQRankSum ≥ -12.5), ReadPosRankSum (ReadPosRankSum ≥ -8.0), and StrandOddsRatio (SOR > 3.0). TASSEL was used to further screen for high-quality SNPs, with the criteria of Miss < = 0.2 and minor allele frequency (Maf) > = 0.05. A total of 463,256 high-quality SNPs were obtained for subsequent association analysis.

[0051] 5. Genome-wide Association Analysis

[0052] Population genetic structure of 122 peanut core accessions was analyzed based on polymorphic SNPs using ADMIXTURE software. Principal component analysis and phylogenetic tree construction were performed using TASSEL 5.0 software. Genome-wide association analysis (GLM) analysis was performed using the general linear model (GLM) in TASSEL 5.0, the R packages mrMLM, and 3vmrMLM. Manhattan plots and QQ plots of the TASSEL 5.0 GLM were generated using the R package qqman. The TASSEL method used a genome-wide significance threshold of 0.05 / 463256 = 1.09e-7, with a -log10 P value of 6.96. The genome-wide recommendation threshold was 1 / 463256 = 2.16e-6, with a -log10 P value of 5.67. Both the mrMLM and 3vmrMLM thresholds were set at a level of 3. PopLDdecay (http: / / github.com / BGI-shenzhen / PopLDdecay) software was used to estimate the LD parameter (r) between two SNPs. 2 ). See Figure 4-Figure 15 The Manhattan plot and QQplot of peanut stalk strength obtained using the GLM method of TASSEL software for ZC environmental phenotypic data are shown in Figure 2. Figure 4 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained by using the GLM method of TASSEL software for ZJ environmental phenotypic data are shown in Figure 5As shown; the Manhattan plot and QQplot of peanut stalk strength obtained by using the GLM method of TASSEL software for HN environmental phenotype data are shown in Figure 6 As shown; the BLUP value (Best Linear Unbiased Prediction Value) was calculated by correcting the stalk strength. The Manhattan plot and QQplot of peanut stalk strength obtained by the GLM method of TASSEL software are shown as follows: Figure 7 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package for ZC environmental phenotypic data are shown in Figure 8 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package for ZJ environmental phenotypic data are shown in Figure 9 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package for HN environmental phenotypic data are shown in Figure 10 As shown; the BLUP value (best linear unbiased prediction value) was calculated by correcting the stalk strength. The Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package are shown in Figure 11 The Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package for ZC environmental phenotypic data is shown in Figure 12 As shown; the Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package for ZJ environmental phenotypic data is shown as follows Figure 13 As shown; the Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package for HN environmental phenotypic data is shown as follows Figure 14 As shown; the BLUP value (Best Linear Unbiased Prediction Value) was calculated for the stalk strength. The Manhattan plot of the peanut stalk strength obtained using the 3vmrMLM software package was as follows: Figure 15 shown.

[0053] Depend on Figure 4-Figure 15 As can be seen, the second environment (ZJ) did not produce good results, so it was removed for subsequent analysis. Summarizing the results, a total of 92 loci were screened using the TASSEL results, with 13, 65, and 14 loci detected in the ZC, HN, and BLUP environments, respectively. A total of 41 loci were screened using the mrMLM software package, with 15, 12, and 15 loci detected in the ZC, HN, and BLUP environments, respectively. A total of 45 loci were screened using the IIIvmrMLM software package, with 15, 15, and 16 loci detected in the ZC, HN, and BLUP environments, respectively.

[0054] 6. Haplotype Analysis of QTL Loci for Culm Strength

[0055] Through association analysis, combining three methods, we obtained significant SNP loci associated with peanut culm strength (see Table 3).

[0056] Table 3 SNPs co-localized by different methods

[0057]

[0058]

[0059] Haplotype analysis of these loci revealed that the genotype of 2__31358672 was distinct, and the genotype with high phenotypic values was C / C, while the genotype with low phenotypic values was A / C. This indicates that locus 2__31358672 (chromosome A02, position 31358672bp) has distinct genotyping. When the genotype is C / C, the peanut stalk strength is better, and when the genotype is A / C, the stalk strength is poor ( Figure 16 ).

[0060] Example 3: Verification of associated sites

[0061] Sequences of 100 base pairs before and after locus 2__31358672 in the reference genome were extracted. KASP markers (KASP) were designed using competitive allele-specific PCR (KASP) technology and amplified and sequenced in 122 accessions. The following KASP primers were used to amplify and sequence the DNA sequences of peanut samples. A C / C genotype at locus 2__31358672 correlated with better culm strength, while an A / C genotype correlated with poorer culm strength.

[0062] The sequence is as follows:

[0063] CATAAGCTTCTTCCTCAGATGAAGCTTCCTTAGTACTGCTTGGGTGCATT

[0064] TTGCATTTTGATTATTAACAAAAACTTGGTGCCGAAATTGTGAACAATA C T

[0065] TTTCACAACTCTCATAATCCCCGGTCATGAACCCCAAAAACATGGTAGCTC

[0066] AATACCATGGCATTACACAACTTCGCACAACTAACCAGCAAGTGCAC

[0067] (SEQ ID NO.1, the position of the site is underlined), see Figure 17 .

[0068] Primers were designed based on the above sequences using Primer 5.0 software (http: / / www.premierbiosoft.com / index.html) and synthesized by Bioengineering (Shanghai) Co., Ltd.

[0069] primer_X: GAAGGTGACCAAGTTCATGCTGCGCGAAATTGTGAACAATA C (SEQ ID NO. 2);

[0070] primer_Y: GAAGGTCGGAGTCAACGGATTGCGCGAAATTGTGAACAATA A (SEQ ID NO.3);

[0071] primer_C: GCTGGTTAGTTGTGCGAAGTT (SEQ ID NO.4);

[0072] The PCR amplification reaction system consisted of 5 μL DNA, 5 μL 2× KASP MasterMix, and 0.14 μL of mixed primers (primer_X, primer_Y, and primer_C, mixed at a ratio of 1:1:2.5). The PCR reaction program was 94°C for 15 min; 10 cycles of 94°C for 20 s, 61-55°C for 60 s (touch-down, 0.6°C decrease per cycle); and 26 cycles of 94°C for 20 s, 55°C for 60 s.

[0073] Among them, 2×KASP Master Mix is a universal kit from LGC (Laboratory of the Government Chemist), which is applicable to all KASP tests and should be operated according to the product instructions.

[0074] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A molecular marker primer set for identifying peanut stalk strength, characterized in that: The primer set includes: primer_X: GAAGGTGACCAAGTTCATGCTGCGCGAAATTGTGAACAATAC; primer_Y:GAAGGTCGGAGTCAACGGATTGCGCGAAATTGTGAACAATAA; primer_C: GCTGGTTAGTTGTGCGAAGTT; Among them, the molecular marker is SNP site 2_31358672, located on peanut chromosome A02, with the Tifrunner genome as the reference genome, and the position is 31358672 bp; the sequence of 99 bp before and after the SNP site 2_31358672 is shown in SEQ ID NO.

1.

2. A use of the molecular marker primer set for identifying peanut stalk strength according to claim 1 in identifying peanut breeders with high-strength peanut stalks, characterized in that: The following steps are involved: S1. Extract DNA from young leaves of peanuts to be identified and perform PCR identification using a molecular marker primer set; S2. If the genotype of the SNP site 2_31358672 is C / C, the stalk strength of the peanut to be identified is high; if the genotype of the SNP site 2_31358672 is A / C, the stalk strength of the peanut to be identified is poor.

3. Use of the molecular marker primer set for identifying peanut stalk strength according to claim 2 in identifying peanut breeding with high-strength peanut stalks, characterized in that: The PCR reaction system consisted of 1 μL DNA, 5 μL KASP Mix, 0.08 μL MgCl2, 2.52 μL ddH2O, 0.7 μL forward primer, and 0.7 μL reverse primer. The PCR reaction program was 94°C for 15 min; 94°C for 20 s, 61-55°C for 60 s, cooling at a rate of 0.6°C / cycle for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 35 cycles.

Images