A SNP marker associated with carotenoid content in sweet potato tubers, a primer set for detecting the marker, and its application

Abstract

The present invention relates to the technical field of sweet potato breeding. The present invention provides a SNP marker associated with the carotenoid content of sweet potato root tubers, a primer set for detecting the marker, and an application thereof. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1. The present invention utilizes KASP technology to obtain SNP typing, which can accurately and efficiently identify the carotenoid content of sweet potato root tubers, and can be used for sweet potato molecular marker-assisted selection breeding. The provided detection method and kit, through phenotypic identification of a natural sweet potato population, verify that the phenotypic selection efficiency of the developed SNP marker reaches 97.56%, and can quickly and accurately detect the carotenoid content of sweet potato root tubers. The method and kit have the advantages of simple operation and low cost, and can meet the needs of large-scale molecular marker-assisted selection.

Description

Technical Field

[0001] The present invention relates to the technical field of sweet potato breeding, in particular to a SNP marker related to the carotenoid content of sweet potato root tubers, a primer set for detecting the marker and applications thereof. Background Art

[0002] Carotenoids are widely present in chromoplasts in plant leaves, flowers, and fruits, playing a crucial role in photosynthesis and lipid peroxidation in chloroplasts. Carotenoids are essential nutrients for humans, but humans cannot synthesize them themselves and must obtain them through food. Carotenoids play an indispensable role in the growth and development of both plants and humans.

[0003] Sweet potatoes offer comprehensive and balanced nutritional value and significant health benefits. Sweet potato tubers are rich in starch, dietary fiber, polyphenols, and carotenoids, particularly β-carotene, reaching up to 20 mg per 100 g of fresh potatoes. This makes them an optimal food recommended by the World Health Organization. Vitamin A deficiency is a serious health problem in developing countries, leading to night blindness and premature death. Vitamin A-fortified sweet potatoes are one of the six major food crops included in the International Biofortification Program. Cultivated sweet potatoes are hexaploid, highly heterozygous genetically, and exhibit extensive hybridization and self-incompatibility. These physiological characteristics hinder the construction of sweet potato genetic populations. Consequently, the number of QTLs identified through linkage analysis is still relatively small, and most have large mapping intervals, making gene cloning and even precise mapping difficult. Relying solely on linkage analysis to uncover QTLs has limited further research and its application in breeding.

[0004] Genome-wide association study (GWAS) is a method for gene positioning in natural populations based on the principle of linkage disequilibrium. This method does not require the construction of genetic populations, has high positioning accuracy, a short cycle, and can discover a wide range of variants. It has been widely used in gene positioning in animals and plants, and has cloned many genes with significant application value. It is a powerful means of gene mining.

[0005] GWAS analysis is highly accurate, capable of pinpointing single SNPs and directly identifying causal mutations. Consequently, GWAS is now widely used to identify key genes for important agronomic traits in various crops. This significantly shortens gene mapping time and reduces labor intensity, providing new insights into the molecular mechanisms underlying key agronomic traits in sweet potatoes and driving the transition from traditional sweet potato breeding to efficient and precise molecular breeding.

[0006] Single nucleotide polymorphisms (SNPs) are a new generation of polymorphic genetic markers following restriction enzyme fragment length polymorphisms, variable number repeat sequences, and microsatellite polymorphisms. KASP technology (competitive allele-specific PCR) is one of the mainstream methods for SNP typing internationally, and can accurately determine the biallelic nature of SNPs. This technology types SNPs based on the specific matching of primer terminal bases. KASP technology is used for large-scale detection of SNP marker gene typing, shortening marker verification time and reducing marker detection costs. It is currently an important method for plant molecular marker positioning and large-scale population scanning. KASP typing technology is based on its own unique PCR principle, which allows all site detections to ultimately be amplified using universal fluorescent primers, which greatly reduces the reagent cost of KASP. It has both the accuracy of the gold standard and reduced usage costs, so KASP has very good application prospects in agricultural testing. Summary of the Invention

[0007] The present invention aims to provide a SNP marker associated with the carotenoid content of sweet potato root tubers, a primer set for detecting the marker, and its application. The SNP typing is obtained using KASP technology, which can accurately and efficiently identify the carotenoid content of sweet potato root tubers and can be used for sweet potato molecular marker-assisted selection breeding.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a SNP marker related to the carotenoid content of sweet potato root tubers. The nucleotide sequence of the SNP marker is shown as SEQ ID NO.1.

[0010] Preferably, the SNP marker is located at base 21056206 of chromosome 5 of sweet potato. When the SNP genotype of the sample to be tested is C, the probability that the sample to be tested has a low carotenoid content is significantly higher than that of the genotype T.

[0011] When the SNP genotype is homozygous CC, the carotenoid content is low;

[0012] When the SNP genotype is homozygous TT, the carotenoid content is higher;

[0013] When the SNP genotype is heterozygous CT, the carotenoid content is intermediate.

[0014] The present invention also provides a primer set for detecting the SNP marker, the primer set comprising a forward primer F1, a forward primer F2 and a reverse primer R;

[0015] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2;

[0016] The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3;

[0017] The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.4.

[0018] The present invention also provides the use of the primer set in preparing a product for measuring the carotenoid content of sweet potato tubers, wherein the product is a kit.

[0019] The present invention also provides a kit for identifying the carotenoid content of sweet potato root tubers, which contains the primer set. The kit comprises a primer set reagent and a detection reagent.

[0020] Preferably, the preparation method of the primer set reagent comprises the following steps:

[0021] (1) Diluting forward primer F1, forward primer F2, and reverse primer R with water to 80-120 μM, respectively, to obtain forward primer F1 solution, forward primer F2 solution, and reverse primer R solution;

[0022] (2) Take 10-14 μL of forward primer F1 solution, 10-14 μL of forward primer F2 solution, and reverse primer R solution, mix them, and add water to 100 μL to obtain a primer set reagent;

[0023] The detection reagent is HiGeno 2×Probe MixA.

[0024] The present invention also provides a method for detecting the carotenoid content of sweet potato tubers using the kit, comprising the following steps: using genomic DNA of the sweet potato to be detected as a template, performing KASP PCR amplification on the template using the kit, and performing genotyping using the amplification result.

[0025] Preferably, the amplification system used in the KASP PCR amplification is: 20-50 ng template, 4-6 uL detection reagent, 0.12-0.16 uL primer set reagent, and sterile water to 10 uL;

[0026] The reaction procedure of the KASP PCR amplification was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C to 61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C to 40 s, 30 to 34 cycles.

[0027] The present invention also provides application of the kit or the method in sweet potato breeding.

[0028] The present invention also provides a method for increasing the carotenoid content of sweet potatoes using the kit or the method, comprising the following steps: performing genotype detection on a SNP marker located at position 21056206bp of chromosome 5 in a sweet potato sample, and selecting a sweet potato sample with a genotype of TT for cultivation.

[0029] The present invention provides a single-nucleotide polymorphism (SNP) marker associated with the carotenoid content of sweet potato root tubers, a primer set for detecting the marker, and applications thereof. The nucleotide sequence of the SNP marker is shown in SEQ ID NO. 1. The present invention utilizes KASP technology to obtain SNP typing, enabling accurate and efficient identification of carotenoid content in sweet potato root tubers, and can be used for molecular marker-assisted selection breeding of sweet potatoes. The provided detection method and kit, verified through phenotypic identification of natural sweet potato populations, demonstrate a phenotypic selection efficiency of 97.56% for the developed SNP marker. This allows for rapid and accurate detection of carotenoid content in sweet potato root tubers, offers advantages such as ease of operation and low cost, and can meet the needs of large-scale molecular marker-assisted selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the typing result diagram of the SNP marker in the natural population.

[0031] Figure 2 Box plot of the carotenoid content distribution of samples with different genotypes. DETAILED DESCRIPTION

[0032] The present invention provides a SNP marker related to the carotenoid content of sweet potato root tubers. The nucleotide sequence of the SNP marker is shown as SEQ ID NO.1.

[0033] In the present invention, the SNP marker is located at base 21056206 of chromosome 5 of sweet potato. When the SNP genotype of the sample to be tested is C, the probability that the sample to be tested has a low carotenoid content is significantly higher than that of the genotype T.

[0034] When the SNP genotype is homozygous CC, the carotenoid content is low;

[0035] When the SNP genotype is homozygous TT, the carotenoid content is higher;

[0036] When the SNP genotype is heterozygous CT, the carotenoid content is intermediate.

[0037] The present invention also provides a primer set for detecting the SNP marker, the primer set comprising a forward primer F1, a forward primer F2 and a reverse primer R;

[0038] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2;

[0039] The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3;

[0040] The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.4.

[0041] The present invention also provides the use of the primer set in preparing a product for measuring the carotenoid content of sweet potato tubers, wherein the product is a kit.

[0042] The present invention also provides a kit for identifying the carotenoid content of sweet potato root tubers, which contains the primer set. The kit comprises a primer set reagent and a detection reagent.

[0043] In the present invention, the preparation method of the primer set reagent preferably includes the following steps:

[0044] (1) Diluting forward primer F1, forward primer F2, and reverse primer R with water to 80-120 μM, respectively, to obtain forward primer F1 solution, forward primer F2 solution, and reverse primer R solution;

[0045] (2) Take 10-14 μL of forward primer F1 solution, 10-14 μL of forward primer F2 solution, and reverse primer R solution, mix them, and add water to 100 μL to obtain a primer set reagent;

[0046] The detection reagent is preferably HiGeno 2×Probe MixA.

[0047] The present invention also provides a method for detecting the carotenoid content of sweet potato tubers using the kit, comprising the following steps: using the genomic DNA of the sweet potato to be detected as a template, performing KASPPCR amplification on the template using the kit, and performing genotyping using the amplification result.

[0048] In the present invention, the amplification system used in the KASP PCR amplification is preferably: 20-50 ng template, 4-6 uL detection reagent, 0.12-0.16 uL primer set reagent, and sterile water to 10 uL, more preferably: 30-40 ng template, 5 uL detection reagent, 0.14 uL primer set reagent, and sterile water to 10 uL;

[0049] The reaction procedure of the KASPPCR amplification is preferably: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C to 61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, 30 to 34 cycles, more preferably: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 58°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, 32 cycles.

[0050] The present invention also provides application of the kit or the method in sweet potato breeding.

[0051] The present invention also provides a method for increasing the carotenoid content of sweet potatoes using the kit or the method, comprising the following steps: performing genotype detection on a SNP marker located at position 21056206bp of chromosome 5 in a sweet potato sample, and selecting a sweet potato sample with a genotype of TT for cultivation.

[0052] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0053] Example 1: Using genome-wide association analysis to locate SNP sites associated with carotenoid content in sweet potato roots

[0054] Using resequencing technology, 314 sweet potato germplasm resources collected from around the world were sequenced. Using a subgenome of the cultivated variety "Xushu 18" as a reference, the resulting short reads were aligned to this reference genome. After quality control and further screening, a genome-wide sweet potato genome-wide variation profile, comprising 4,599,509 single-nucleotide polymorphisms (SNPs), was obtained. A GWAS analysis, combined with phenotypic data related to root carotenoid content, identified the associated SNP locus Ib5CA (P = 2.47 × 10-11). The Ib5CA locus is located at base 21,056,206 on chromosome 5 of sweet potato (genome version XUSHU18-IBA_r1.0).

[0055] Example 2 KASP technology is used to detect genotyping of carotenoids in sweet potato roots

[0056] Based on the above-mentioned Ib5CA site, 100bp of nucleotide sequences upstream and downstream of Xushu 18 were retrieved as shown in SEQ ID NO.1 (the underlined bold part is the SNP site), and a specific primer pair for amplifying the above-mentioned SNP site was designed, including two allele forward primers with different terminal bases and a reverse primer R. The 5' ends of the two forward primers were respectively connected to different detection adapter sequences; the nucleotide sequence of this group of specific primer pairs is shown in SEQ ID NO.2-3.

[0057] SEQ ID NO.1:

[0058] TGTAGTATGTTCATACATACTTTCCCAACCTACCGAAGCACAATGAATTAACCGTCGCCTCCACTGAGGCGAGAAATCCACTCCCATTAATGTTGGAGTGTAAATCAGGTGCTACTAAATCACCAAATTATTGTCTGAGCACCTTGTACT [C / T] AATTAACATCTCTATATTTATTCTCGAGAAAAGGTAACAT GATCAAATCGAAATAATATCTTACAATACCGTCGATAGTACTAAAAAAG AAAAAAGGGACGTTAAAAGAATTTGTTATTGAGCATCTGAGCTCAACCATCCGAACCAGCG.

[0059] Forward primer F1 (SEQ ID NO. 2) (the underlined portion is the FAM tag sequence):

[0060] GAAGGTGACCAAGTTCATGCT CAAATTATTGTCTGAGCACCTTGTA CTC.

[0061] Forward primer F2 (SEQ ID NO. 3) (the underlined portion is the HEX tag sequence):

[0062] GAAGGTCGGAGTCAACGGATT CAAATTATTGTCTGAGCACCTTGT ACTT.

[0063] Reverse primer RR (SEQ ID NO. 4): CGATTTGATCATGTTACCTTTTCTCG.

[0064] The KASP reaction system is specifically as follows: DNA (1 uL, 50 ng), HiGeno 2×Probe MixA (5 uL), mixed primers (0.14) uL, sterile water 3.86 uL, and a total reaction system of 10 uL.

[0065] The KASP PCR reaction program was as follows: pre-denaturation at 95°C for 10 min; 10 cycles of denaturation at 95°C for 20 s, annealing / extension at 61°C for 40 s; and 34 cycles of denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s.

[0066] After PCR, QuantStudio Real-Time PCR was used to read and analyze the fluorescence signal, resulting in a clear and intuitive genotyping diagram. Samples of the same genotype were clustered together in the same color. The homozygous TT genotype was located near the X-axis (red dot FAM), indicating a high-carotenoid variety. The homozygous CC genotype was located near the Y-axis (blue dot HEX), indicating a low-carotenoid variety. The green dot between the two was the heterozygous CT genotype, with an intermediate carotenoid content.

[0067] Example 3 KASP marker validation in natural populations

[0068] Based on the resequencing results, 41 cultivars with genotypes of TT, CC, and CT were randomly selected from 314 natural populations and grown in Xuzhou, Jiangsu Province and Naiman Banner, Inner Mongolia Autonomous Region, respectively. Genomic DNA of the 41 sweet potato varieties was extracted and the carotenoid content was determined (as shown in Table 1). Among them, 6 samples were high in carotenoids and 25 samples were low in carotenoids. To confirm the detection accuracy of the molecular markers screened by the invention, genotyping was performed using the above-mentioned KASP markers. The typing results are shown in Table 1 and Figure 1 As shown. Individuals with extremely low carotenoid content cluster near the Y-axis (homozygous CC, blue dots), individuals with extremely high carotenoid content cluster near the X-axis (homozygous TT, red dots), and the intermediate type is in the middle. The minimum carotenoid content in sweet potato root tubers of the CC genotype was 0.62 mg / 100 g, the maximum was 3.75 mg / 100 g, and the average was 1.76 mg / 100 g. The minimum carotenoid content in sweet potato root tubers of the TT genotype was 16.17 mg / 100 g, the maximum was 24.37 mg / 100 g, and the average was 20.23 mg / 100 g. The minimum carotenoid content in sweet potato root tubers of the CT genotype was 2.02 mg / 100 g, the maximum was 14.61 mg / 100 g, and the average was 6.58 mg / 100 g. Only Ganyu 3 tested homozygous for the TT KASP marker, with intermediate carotenoid content, inconsistent with the resequencing result of the CT genotype. The results for the remaining varieties were consistent with the sequencing results, with an accuracy rate of 97.56%. The mean carotenoid content in the root tubers of sweet potatoes with the TT genotype was significantly higher than that of the CC genotype, while the mean carotenoid content in the root tubers of sweet potatoes with the CT genotype was significantly higher than that of the CC genotype.

[0069] Table 141 Carotenoid content of natural sweet potato populations and detection results of Ib5CA labeling

[0070]

[0071]

[0072] As can be seen from the above examples, the present invention provides a SNP marker associated with the carotenoid content of sweet potato root tubers, a primer set for detecting the marker, and its application. The nucleotide sequence of the SNP marker is shown in SEQ ID NO. 1. The present invention utilizes KASP technology to obtain SNP typing, which can accurately and efficiently identify the carotenoid content of sweet potato root tubers and can be used for sweet potato molecular marker-assisted selection breeding. The provided detection method and kit, through phenotypic identification of natural sweet potato populations, verified that the developed SNP marker has a phenotypic selection efficiency of 97.56%. This allows for rapid and accurate detection of carotenoid content in sweet potato root tubers, has the advantages of simple operation and low cost, and can meet the needs of large-scale molecular marker-assisted selection.

[0073] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A SNP marker associated with the carotenoid content of sweet potato root tubers, characterized in that: The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1; The SNP marker is located at position 151 of SEQ ID NO. 1, and the base is C / T.

2. A primer set for detecting the SNP marker according to claim 1, characterized in that: The primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3; The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.

4.

3. Use of the primer set according to claim 2 in preparing a product for identifying the carotenoid content of sweet potato root tubers, characterized in that: The product is a test kit.

4. A kit for identifying the carotenoid content of sweet potato root tubers comprising the primer set according to claim 3, characterized in that: The kit includes a primer set reagent and a detection reagent.

5. The kit according to claim 4, characterized in that The preparation method of the primer set reagent comprises the following steps: (1) Dilute forward primer F1, forward primer F2, and reverse primer R with water to 80-120 μM, respectively, to obtain forward primer F1 solution, forward primer F2 solution, and reverse primer R solution; (2) Take 10-14 μL of forward primer F1 solution, 10-14 μL of forward primer F2 solution, and reverse primer R solution, mix them, and add water to 100 μL to obtain the primer set reagent; The detection reagent is HiGeno 2× Probe Mix A.

6. A method for detecting the carotenoid content of sweet potato root tubers using the kit according to claim 4 or 5, characterized in that: The method comprises the following steps: using the genomic DNA of the sweet potato to be tested as a template, performing KASP PCR amplification on the template using the kit according to claim 4 or 5, and performing genotyping using the amplification result.

7. The method according to claim 6, characterized in that The amplification system used in the KASP PCR amplification is: 20-50 ng template, 4-6 μL detection reagent, 0.12-0.16 μL primer set reagent, and sterile water to 10 μL; The reaction procedure of the KASP PCR amplification was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 30-34 cycles.

8. Use of the kit according to claim 4 or 5 or the method according to claim 6 or 7 in sweet potato breeding; When the SNP genotype of the sample to be tested is C, the probability that the sample to be tested has a low carotenoid content is significantly higher than when the genotype is T; When the SNP genotype is homozygous CC, the carotenoid content is low; When the SNP genotype is homozygous TT, the carotenoid content is higher; When the SNP genotype is heterozygous CT, the carotenoid content is intermediate; Sweet potato samples with genotype TT were selected for cultivation.

9. A method for increasing the carotenoid content of sweet potato using the kit according to claim 4 or 5 or the method according to claim 6 or 7, characterized in that: The method comprises the following steps: performing genotype detection on a SNP marker located at position 151 of SEQ ID NO.1 in a sweet potato sample, and selecting a sweet potato sample with a genotype of TT for cultivation.

Images