Functional marker for melon gummy stem resistance and use thereof

By cloning the melon vine blight resistance gene WRKY and designing the functional marker WRKY-197, the problems of time-consuming, labor-intensive and inaccurate phenotypic identification in melon vine blight breeding were solved, achieving early accurate screening and improving breeding efficiency.

CN119372368BActive Publication Date: 2025-10-24HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411862791.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-17
Publication Date
2025-10-24
Estimated Expiration
2044-12-17

AI Technical Summary

Technical Problem

Phenotypic identification in existing melon vine blight resistance breeding is easily affected by the environment, is time-consuming and labor-intensive, and conventional methods are inaccurate, affecting breeding efficiency.

Method used

A functional marker WRKY-197 for melon vine blight resistance was developed. The WRKY resistance gene was cloned through high-throughput sequencing and BSA fine positioning, and specific primers were designed for PCR amplification and gel electrophoresis detection to achieve accurate identification of melon vine blight resistance.

Benefits of technology

It has achieved early and accurate screening of melon vine blight resistance, shortened breeding time, improved breeding efficiency, and reduced the impact of environmental factors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372368B_ABST
    Figure CN119372368B_ABST
Patent Text Reader

Abstract

The application discloses a functional marker for identifying resistance to melon vine blight, and belongs to the technical field of molecular marker assisted breeding. The marker is located in the CDS region of a melon vine blight resistance gene, is an InDel molecular marker, and has a nucleotide sequence as shown in SEQ ID NO:1, and has a total length of 197 bp. The marker has a 9 bp base insertion sequence difference with a susceptible material. The application further discloses a method for identifying resistance to melon vine blight by using the functional marker. The application can be used for identifying melon vine blight resistant germplasm materials, and has important application value in melon vine blight resistance breeding and functional marker assisted selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to a functional marker for identifying resistance to melon vine blight and an application thereof. Background Art

[0002] melon( Cucumis melo L . ) is an annual climbing herbaceous plant of the Cucurbitaceae family, Cucumber. China, one of the secondary origins of melon, has a long history of melon cultivation and a large consumer market. Gummy stemblight (GSB) is a major melon disease, and its severity has increased in recent years, severely affecting melon yield and quality, and hindering the healthy development of the melon industry. Currently, chemical agents are the main control method for melon stemblight. However, in areas of high temperature and humidity, chemical agents are ineffective in controlling severe cases, and chemical control is highly polluting and costly. Using melon varieties resistant to stemblight is the most cost-effective measure for controlling stemblight. Therefore, breeding high-quality, disease-resistant melon varieties is particularly important.

[0003] Conventional breeding of varieties resistant to vine blight requires artificially creating disease-prone conditions to identify resistance traits, followed by hybridization and backcrossing. This cumbersome and time-consuming process results in low efficiency in resistance breeding. Marker-assisted selection (MAS) technology, which uses molecular markers closely linked to resistance genes or specific primers for corresponding genes, can improve the efficiency of disease-resistant selection and accelerate the breeding of resistant varieties. Currently, widely used molecular marker technologies include InDel (insertion-deletion) markers, KASP (kompetitive allele-specific PCR) markers, and CAPS (cleaved amplified polymorphic sequences) markers.

[0004] Based on the physical distance between the molecular marker and the target gene on the genome, molecular markers can be divided into linkage markers, co-segregation markers, and functional markers. Linkage markers show a linkage-segregation relationship with the target gene. They are physically far away from the target gene, and the linkage relationship is easily interrupted, resulting in inaccurate assisted selection. Co-segregation markers appear to be genetically co-segregated with the target gene and are relatively close to the target gene physically, but they are not the target gene. In a large segregating population, the co-segregation relationship between the marker and the target gene may also be interrupted, resulting in inaccurate selection. Functional markers refer to markers developed based on allele sequence differences. They are located inside the gene and can directly select the target gene. Therefore, the selection accuracy is the highest. SUMMARY

[0005] In order to solve the problems of phenotype identification being affected by environment and time-consuming and labor-intensive in breeding of melon resistance to gummy stem blight, the application provides a functional marker and a method for identifying melon resistance to gummy stem blight.

[0006] The disease-resistant material 'R63' carries a dominant gene for resistance to gummy stem blight, but the gene has not been cloned. Based on this, the applicant cloned the melon resistance gene to gummy stem blight by using high-throughput sequencing technology, combining BSA and fine mapping, on the basis of using 'R63' and susceptible material 'S49' to construct a RIL population, and annotated the gene as a WRKY transcription factor, with a full length of 1575 bp, containing a complete open reading frame (ORF). When the gene was silenced in the disease-resistant material 'R63' by using the virus-induced gene silencing (VIGS) technology, it was found that the disease-resistant material showed susceptible, which preliminarily proved that the gene is the resistance gene of melon to gummy stem blight. At present, the applicant is carrying out stable overexpression experiment and further functional verification analysis.

[0007] One of the purposes of the application is to provide a functional marker for identifying melon resistance to gummy stem blight by using the discovered WRKY resistance gene, which is located in the CDS region of the WRKY resistance gene, is an InDel molecular marker, has a nucleotide sequence as shown in SEQ ID NO. 1, and has a total length of 197 bp. The marker is named WRKY-197. Within the sequence of the marker, 9 bp of base insertion mutation occurs in the susceptible parent relative to the disease-resistant parent. Specifically, the InDel molecular marker is a marker in the sequence of the melon resistance gene to gummy stem blight, and can be directly used for assisted selection in breeding of melon resistance to gummy stem blight. The marker can be used to effectively distinguish the resistance of strains to gummy stem blight in a segregating population, thereby providing an efficient genetic tool for molecular breeding of disease-resistant melons.

[0008] The second purpose of the application is to provide a primer for amplifying the functional marker, which comprises an upstream primer and a downstream primer, and has nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3. The primer can be directly used for identifying the resistance of melon germplasm to gummy stem blight.

[0009] The third purpose of the application is to provide application of the functional marker or the primer thereof in phenotype identification and variety breeding of melon resistance to gummy stem blight.

[0010] The fourth purpose of the application is to provide a kit for phenotype identification and variety breeding of melon resistance to gummy stem blight, which comprises the primer.

[0011] The fifth purpose of the application is to provide a method for phenotype identification and variety breeding of melon resistance to gummy stem blight, which comprises the following steps:

[0012] (1) Extracting genomic DNA of melon;

[0013] (2) Taking the genomic DNA extracted in step (1) as a template, PCR amplification is carried out with the primers described above;

[0014] (3) The amplified product of step (2) is detected by gel electrophoresis, and the resistance of melon to gummy stem and wilt is identified according to the band size.

[0015] The PCR amplification system is 0.4 µL of upstream and downstream primers (10 µmol / L), 1 µL of DNA template (50-150 ng / µL), 2 × TaqMasterMix (DyePlus) 5 µL, and ddH2O is added to 10 µL.

[0016] The PCR reaction program is as follows: 95 ℃ pre-denaturation for 3 min, 95 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, 72 ℃ extension for 60 s, a total of 34 cycles, 72 ℃ final extension for 10 min, and the product is stored at 4 ℃.

[0017] Specifically, the band type of the PCR amplification product is recorded, and the resistance of melon to gummy stem and wilt is judged according to the fragment size, and the judgment principle is as follows:

[0018] (1) The band size amplified by the molecular marker primer in the disease-resistant parent and the disease-susceptible parent is significantly different;

[0019] (2) When the melon germplasm is amplified by the molecular marker primer, if a specific band with the same size as the disease-resistant parent appears, that is, a fragment with a size of 197 bp is amplified, then the strain shows disease resistance;

[0020] (3) When the melon germplasm is amplified by the molecular marker primer, if only a specific band with the same size as the disease-susceptible parent appears, that is, a fragment with a size of 206 bp is amplified, then the strain shows susceptibility.

[0021] The beneficial effects of the present application are:

[0022] The present application clones the gummy stem and wilt disease resistance gene by BSA and fine mapping CmWRKY , according to CmWRKY the sequence difference between the resistant and susceptible parents, a new functional marker of melon gummy stem and wilt disease resistance gene is developed, which can effectively distinguish the resistance phenotype of melon gummy stem and wilt.

[0023] The application has the advantages of accurate and reliable identification results, early screening of melon gummy stem and fruit rot resistance germplasm, shortened breeding period, improved breeding efficiency, convenient and fast detection, and no influence of environmental factors. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 is a sequence alignment figure of the insertion mutation of the diseased parent 'S49' compared with the resistant parent 'R63' in the application.

[0025] Figure 2 is a PCR amplification result of the molecular marker primer in the RIL population; wherein the Marker, the melon gummy stem and fruit rot resistant parent 'R63', the melon gummy stem and fruit rot susceptible parent 'S49' and the RIL population with completed phenotype identification are labeled respectively. The band of the RIL single plant phenotype resistant is consistent with the resistant parent; the band of the phenotype susceptible is consistent with the susceptible parent. Among them, R represents the single plant with the phenotype of resistant, and S represents the single plant with the phenotype of susceptible.

[0026] Figure 3 is a phenotype figure of the RIL resistant single plant and the susceptible single plant. Among them, R represents the single plant with the phenotype of resistant, and S represents the single plant with the phenotype of susceptible. DETAILED DESCRIPTION

[0027] The application will be further described in detail below in combination with specific embodiments. The following embodiments are only illustrative and have no limiting effect on the application. The various experimental operations involved in the embodiments, which are not described in detail, are all conventional operations in the art, and the parts not specifically described herein can be implemented by referring to various common tool books, scientific and technical literature or related instructions, manuals, etc. by those skilled in the art. The resistant parent 'R63' in the study is a germplasm resource introduced from abroad, and the susceptible parent 'S49' is a domestic local variety, which is currently preserved in the College of Horticulture and Forestry, Huazhong Agricultural University and can be provided to the outside.

[0028] Example 1: Development of a molecular marker based on melon gummy stem and fruit rot resistance gene CmWRKY Sequence difference in resistant and susceptible materials to develop a molecular marker

[0029] This embodiment provides a functional marker for identifying melon gummy stem and fruit rot resistance, and the primer sequences of the marker are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0030] Forward primer: 5'-GTCACCAGGTATCTTCAAGAA-3' (SEQ ID NO. 2)

[0031] Reverse primer: 5'-AAGGTAGAAAGAGCTCGAGA-3' (SEQ ID NO. 3)

[0032] The primers were designed as follows: PCR amplification was performed on the resistant parent (the resistant parent was the wild melon species 'R63', and the susceptible parent was 'S49') CmWRKY Full-length sequence and sequencing. CmWRKY Based on the sequence differences between the resistant and susceptible materials, select an appropriate InDel site. Select a base sequence encompassing the 200 bp before and after the InDel site. Use the Primer3 online website (https: / / primer3.ut.ee / ) to design primers with a length of 20-24 bp, a PCR product size of 100-200 bp, and a Tm of 52-57°C.

[0033] In this study, a 9bp base insertion mutation occurred in the susceptible parent relative to the resistant parent at the InDel site.

[0034] Functional marker sequence of disease-resistant parent:

[0035] >R63

[0036] GTCACCAGGTATCTTCAAGAAACGGCGTCACAGCCCAATCGGTAAAAGCGTTTGATTCCTCGACACTTTTTTTTCTTTAACTCTTTTGGGAAACGACACCCACGCTGGCGTCGGCGACCATAGGGTGCGGGTGACGGTGATCGCCCTCGTAGGTTACGAGGAGCATCGTTGGATCGTCTCGAGCTCTTTCTACCTT

[0037] Functional marker sequence of susceptible parent:

[0038] >S49

[0039] GTCACCAGGTATCTTCAAGAAACGGCGTCACAGCCCAATCGGTAAAAGCGTTTGATTCCTCGACACTTTTTCTTTTCTTTTTTTCTTTAACTCTTTTGGGAAACGACACCCACGCTGGCGTCGGCGACCATAGGGTGCGGGTGACGGTGATCGCCCTCGTAGGTTACGAGGAGCATCGTTGGATCGTCTCGAGCTCTTTCTACCTT

[0040] Example 2 Screening for melon vine blight-resistant germplasm using functional markers

[0041] The molecular marker in Example 1 is used to screen melon germplasm with resistance to gummy stem blight, and the specific implementation method is as follows: I. PCR amplification and electrophoresis detection

[0042] (1) CTAB method is used to extract genomic DNA of the sample to be tested;

[0043] (2) Using the genomic DNA obtained in step (1) as a template, the molecular marker specific primer in Example 1 is used for PCR amplification. The PCR amplification system is: 0.4 μL of upstream and downstream primers (10 μmol / L), 1 μL of DNA template (50-150 ng / μL), 2 × TaqMasterMix (DyePlus) 5 μL, and ddH2O to make up to 10 μL. The PCR reaction program is: 95°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 60 s, a total of 34 cycles, 72°C final extension for 10 min, and the PCR product is stored at 4°C. The amplification product is detected by electrophoresis using 8% polyacrylamide gel, the voltage is 200 V, the current is 200 mA, the power is 36 W, and the electrophoresis time is 80 min, and finally silver staining is used for color development. The formula of 8% polyacrylamide gel is: 24 mL of 30% Acr-Bis (acrylamide-methylene bisacrylamide), 16 mL of 5 × TBE, 800 μL of 10% APS (ammonium persulfate), 64 μL of accelerator TEMED, and ultrapure water to make up to 80 mL.

[0044] II. Construction of RIL population

[0045] The melon gummy stem blight susceptible material 'S49' is a fine melon local variety in China, with thin skin, thick flesh, high sugar content and good flavor, but poor disease resistance; the resistant material 'R63' is a wild melon variety, with small fruit, sour and astringent flavor, and low edible value, but carrying gummy stem blight resistance gene CmWRKY , which is a high-quality gummy stem blight resistant germplasm resource. A recombinant inbred line population was obtained in the early stage of the study, and the population was constructed as follows: F2 generation was obtained by using high-generation inbred lines 'S49' and 'R63' as female and male parents, respectively, and then self-crossing; single seed descent method was used to self-cross in F2 generation to produce strains, and each strain was kept for 1 single plant, and continuous self-crossing was carried out for 7 generations, and finally a RIL population containing 118 strains and being genetically stable was obtained.

[0046] III. Identification of RIL population single plant phenotype of gummy stem blight resistance

[0047] In order to verify the accuracy of the functional marker developed to identify the phenotype of melon gummy stem blight resistance, the RIL population constructed is used to analyze and verify the marker. Figure 1All the phenotypes identified as resistant in the population have the genotype consistent with the resistant parent, i.e. a fragment of 197 bp is present, and all the phenotypes identified as susceptible have the genotype consistent with the susceptible parent, i.e. a fragment of 206 bp is present. The population is a RIL population, and the result shows that the functional marker can distinguish the resistant material from the susceptible material, and is targeted to the resistance gene of C. melo to gummy stem blight CmWRKY The functional marker screened by the application can be applied to the auxiliary screening of seedling stage resistant and susceptible single plants of C. melo, and the disadvantages of conventional disease resistance breeding can be overcome, the phenotypic identification method is simplified, a genetic tool is provided for the functional marker assisted breeding of gummy stem blight resistance, and the process of breeding of gummy stem blight resistant varieties is further accelerated.

Claims

1. A functional marker for identifying resistance to gummy stem blight in Cucumis melo, which is located in the CDS region of the resistance gene to gummy stem blight in Cucumis melo, belongs to InDel molecular marker, characterized in that: The functional marker nucleotide sequence is shown as SEQ ID NO: 1 and SEQ ID NO:

4. ​ 2. Use of the functional marker of claim 1 in resistance identification of melon gummy stem and wilt.

3. A method for identifying resistance to gummy stem blight in Cucumis melo, comprising The method comprises the following steps: (1) extracting genomic DNA of the sample to be tested; (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification with primers shown as SEQ ID NO. 2 and SEQ ID NO. 3; (3) performing electrophoresis detection on the amplification product of step (2), and identifying the resistance of melon gummy stem and wilt according to the band size, if a specific band with the same size as the resistant parent appears, i.e. a fragment with a size of 197 bp is amplified, then the phenotype of the melon single plant is resistant; if only a specific band with the same size as the susceptible parent appears, i.e. a fragment with a size of 206 bp is amplified, then the phenotype of the melon single plant is susceptible.

4. The method for identifying resistance to gummy stem and wood disease in C. melo according to claim 3, wherein, The PCR amplification system is as follows: 10 µmol / L of each of the upstream and downstream primers, 0.4 µL, 50-150 ng / µL of DNA template, 1 µL, 2×TaqMasterMix, 5 µL, and ddH2O, supplemented to 10 µL.

5. The method of identifying resistance to gummy stem and wood disease in C. melo according to claim 3, wherein, The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, a total of 34 cycles, 72℃ final extension for 10 min, and preservation at 4℃.