Methods and compositions for genetic modification of cells

Abstract

Methods and compositions for genetically modifying cells are provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 353,008, filed June 16, 2022, pursuant to 35 USC 119(e), the contents of which are incorporated herein by reference in their entirety.

[0003] sequence list

[0004] This application contains a sequence list, which has been electronically submitted in XML file format and is hereby incorporated in its entirety by reference. The XML file was created on June 13, 2023, named "01155-0060-00PCT_SL.xml" and has a size of 2,718,632 bytes.

[0005] Introduction and Summary of the Invention

[0006] The ability to introduce multiple genetic edits into cells is of great interest for gene editing and clinical therapeutic applications. For example, adoptive cell therapy using genetically modified immune cells has become an attractive approach for treating a variety of diseases and ailments, including cancer, and for rebuilding cell lineages and immune system defenses. However, the clinical application of cell product therapies has been challenging, partly due to the complex requirements of genetic engineering. The ability to engineer multiple properties into single cells depends on the ability to effectively edit multiple target genes, including gene knockout and locus insertion, while maintaining survival and the desired cell phenotype.

[0007] CRISPR / Cas9 genome editing has been proven to be highly efficient; however, simultaneous editing at different loci has been reported to lead to poorer cell viability and increased translocations, potentially impairing the quality and safety of cell products, and gene editing efficiency decreases with increasing number of edits. Existing cell engineering techniques have limitations in providing the necessary cell quality and yield using sequential editing processes due to cumulative toxicity to cells.

[0008] Therefore, the industry needs safer and more efficient methods for delivering multiple genome editing tools to cells and for performing multiple gene editing, for example, in fewer steps or in a shorter time period.

[0009] The approach presented in this paper involves using at least two genome editing tools for multiplex genome editing applications, thereby providing substantial advantages over conventional methods.

[0010] In some implementations, the methods provided herein produce cells with higher survival and expansion rates while maintaining high editing rates, thereby reducing manufacturing time and increasing yield. Attached Figure Description

[0011] Figures 1A to 1C The percentage of T cells lacking HLA-A surface expression was shown after simultaneous insertion and base editing in three donors.

[0012] Figures 2A to 2C The percentage of T cells lacking CD3 surface expression was shown after simultaneous insertion and base editing in three donors.

[0013] Figures 3A to 3C The percentage of T cells expressing the transgenic T cell receptor is shown after simultaneous insertion and base editing in three donors.

[0014] Figures 4A to 4H Shows the percentage of edited cells in T cells after simultaneous insertion and base editing in three donors.

[0015] Figure 5A The percentage of T cells with fully edited markers is shown after simultaneous insertion and base editing using lipid nanoparticles in four donors.

[0016] Figure 5B The percentage of T cells lacking CD3 surface expression was shown after simultaneous insertion and base editing using lipid nanoparticles in four donors.

[0017] Figure 5C The percentage of T cells lacking HLA-A2 surface expression, HLA-A3 surface expression, or both was shown after simultaneous insertion and base editing using lipid nanoparticles in four donors.

[0018] Figure 5D The percentage of T cells lacking HLA-DP, DQ, and DR surface expression was shown after simultaneous insertion and base editing using lipid nanoparticles in four donors.

[0019] Figure 5E The percentage of T cells showing positive surface expression of transgenic TCRs after simultaneous insertion and base editing using lipid nanoparticles in four donors was shown.

[0020] Figure 6A This shows the percentage of editing at protein loci and relative luminescence in primary mouse hepatocytes.

[0021] Figure 6B This shows the average percentage of editing at the TTR locus in primary mouse hepatocytes.

[0022] Figure 7A This shows the percentage of editing at the TTR locus in the mouse liver.

[0023] Figure 7B This shows the percentage of editing at protein loci in mouse livers.

[0024] Figure 7C This shows the serum A1AT level.

[0025] Figure 8A Shows the percentage of GFP-positive donor 1T cells after insertion at AAVS1.

[0026] Figure 8B Shows the percentage of GFP-positive donor 2T cells after insertion at AAVS1.

[0027] Figure 9 The cell population fold increased after a specified number of days in the amplification medium.

[0028] Figures 10A to 10B The mean percentage of fully edited T cells in the CD4+ and CD8+ subsets are shown separately.

[0029] Figures 11A to 11C This shows the average percentage of base editing at the TRAC, TRBC1, TRBC2, and CIITA loci.

[0030] Figure 12A This shows the average percentage of CD8+ T cells scored by flow cytometry as CD3- or Vb8+. Figure 12B This shows the average percentage of CD8+ T cells that are negative for HLA-DP, DQ, DR, HLA-A2, or HLA-A3 surface markers as determined by flow cytometry.

[0031] Figure 13A The display shows the average percentage of CD8+ engineered T cells exhibiting the central memory stem cell phenotype. Figure 13B The display shows the average percentage of CD8+ engineered T cells that exhibit phenotypic markers of central memory cells. Figure 13C The display shows the average percentage of CD8+ engineered T cells that exhibit effector memory cell phenotypic markers.

[0032] Figure 14 This shows the average percentage of target cells killed by engineered T cells.

[0033] Figure 15 This displays the average percentage of edits after processing with 1.0 ug / ml or 0.5 ug / ml base editor mRNA.

[0034] Figure 16 This shows the average percentage of T cells that are negative for the indicated surface protein expression.

[0035] Brief description of the published sequence

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] Detailed Implementation

[0047] This disclosure provides, for example, a platform method for contacting cells with at least two genome editing tools and for multiplex genome editing. The method, for example, provides multiplex genome editing in cells without significant cellular side effects. The method also provides for delivering multiple genome editing tools to cells in fewer steps, thereby allowing for multiplex editing in a shorter timeframe.

[0048] In some embodiments, the platform relates to a manufacturing method for preparing cells in vitro for subsequent therapeutic administration to a subject. In some embodiments, the platform relates to multiplex genome editing via the simultaneous or sequential administration of lipid nanoparticles (LNPs) containing at least two genome editing tools. The platform is relevant to any cell type, but is particularly advantageous in preparing cells requiring multiplex genome editing for full therapeutic applicability (e.g., primary immune cells). Compared to prior delivery techniques, the method can exhibit improved properties; for example, the method provides efficient delivery of nucleic acids (e.g., the at least two genome editing tools) while providing greater cell survival and expansion. As provided herein, the platform method is applicable to “cells” or to “cell populations” (or “populations of cells”). When references are made herein to “cells” for delivery or gene editing methods, it should be understood that the method can be used for the delivery or gene editing of “cell populations”.

[0049] In some embodiments, this document provides a method for genetically modifying cells, the method comprising: (a) contacting the cells with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the first genome editor; and (b) contacting the cells with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA targeting at least one genomic locus and homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor, thereby generating at least two genome edits in the cells.

[0050] In some embodiments, this document provides a method for genetically modifying cells, the method comprising: (a) contacting the cells with a first genome editing tool, the first genome editing tool comprising a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and (b) contacting the cells with a second genome editing tool, the second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase, thereby generating at least two genome edits in the cells.

[0051] In some embodiments, this document provides a method for generating a cell population comprising edited cells, the method comprising: (a) contacting the cells with a first genome editing tool, the first genome editing tool comprising a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; (b) contacting the cells with a second genome editing tool, the second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase; and (c) culturing the cells, thereby generating the cell population comprising the edited cells, each of the edited cells comprising at least two genome edits.

[0052] In some embodiments, this document provides a composition comprising: (a) a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the first genome editor; and (b) a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA targeting at least one genomic locus and homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor.

[0053] In some embodiments, this document provides a composition comprising: (a) a first genome editing tool, wherein the first genome editing tool comprises a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and (b) a second genome editing tool, wherein the second genome editing tool comprises a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase.

[0054] In some embodiments, this document provides cells treated in vitro using any of the methods or compositions disclosed herein. In some embodiments, this document provides cells treated in vivo using any of the methods or compositions disclosed herein. In some embodiments, this document provides a cell population comprising any of the cells disclosed herein.

[0055] In some embodiments, this document provides for the use of any cells, cell populations, or compositions disclosed herein for the treatment of cancer. In some embodiments, this document provides for the use of any cells, cell populations, or compositions disclosed herein for the preparation of medicaments for the treatment of cancer.

[0056] In some embodiments, this document provides an engineered cell containing at least three base edits in at least three genomic loci and at least one foreign gene.

[0057] In some embodiments, this document provides a composition comprising: a. a gRNA comprising a guide sequence selected from: i) SEQ ID NO: 251-264; ii) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence selected from SEQ ID NO: 251-264; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NO: 251-264; iv) a sequence comprising 10 adjacent nucleotides ± 10 nucleotides of genomic coordinates listed in Table 5; v) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence derived from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or b. a nucleic acid encoding the gRNA of (a).

[0058] In some embodiments, this document provides a method for altering the DNA sequence within the AAVS1 gene, the method comprising delivering to a cell: a. a gRNA comprising a guide sequence selected from: i) SEQ ID NO: 251-264; ii) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence selected from SEQ ID NO: 251-264; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NO: 251-264; iv) a sequence comprising 10 adjacent nucleotides ± 10 nucleotides of genomic coordinates listed in Table 5; v) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence derived from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or b. a nucleic acid encoding the gRNA of (a).

[0059] In some embodiments, this document provides an immunotherapy method comprising administering to a subject a composition comprising engineered cells, wherein said cells comprise a genomic modification of the AAVS1 gene, wherein the genetic modification comprises an insertion selected from the following genomic coordinates: chr19: 55115695-55115715; chr19: 55115588-55115608; chr19: 55115616-55115636; chr19: 55115623-55115643; chr19: 55115637-55115657; chr19: 55115691-55115711; chr19: 55115755-55115775; chr19: 55115823-55115843; chr19: 55115834-5 5115854; chr19: 55115835-55115855; chr19: 55115836-55115856; chr19: 55115850-55115870; chr19: 55115951-55115971; and chr19: 55115949-55115969; or wherein the cells are engineered by delivering the following substance into the cells: a. gRNA, which comprises a guide sequence selected from the following: i) SEQ ii) at least 17, 18, 19 or 20 adjacent nucleotides selected from the sequence of SEQ ID NO: 251-264; iii) a guide sequence that is at least 95%, 90% or 85% identical to the sequence selected from SEQ ID NO: 251-264; iv) a sequence containing 10 adjacent nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 5; v) at least 17, 18, 19 or 20 adjacent nucleotides from the sequence of (iv); or vi) a guide sequence that is at least 95%, 90% or 85% identical to the sequence selected from (v); or b. a nucleic acid encoding the gRNA of (a.).

[0060] In some embodiments, this document provides an engineered cell comprising a genetic modification of the AAVS1 gene, wherein said genetic modification comprises an insertion selected from the following genomic coordinates: chr19: 55115695-55115715; chr19: 55115588-55115608; ch r19: 55115616-55115636; chr19: 55115623-55115643; chr19: 55115637-55115657; chr19: 55115691-55115711; chr19: 55115755-55115775; ch r19: 55115823-55115843; chr19: 55115834-55115854; chr19: 55115835-55115855; chr19: 55115836-55115856; chr19: 55115850-55115870; ch r19: 55115951-55115971; and chr19: 55115949-55115969.

[0061] This document provides the following numbered implementation schemes:

[0062] Implementation scheme 1 is a method for genetically modifying cells, the method comprising:

[0063] (a) Contacting the cell with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the first genome editor; and

[0064] (b) Contact the cell with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA targeting at least one genomic locus and homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor.

[0065] This results in at least two genome editing products being generated in the cells.

[0066] Implementation scheme 2 is the method as described in implementation scheme 1, wherein the first genome editor or the second genome editor is delivered to the cell as at least one polypeptide or at least one polynucleotide encoding said polypeptide.

[0067] Implementation scheme 3 is the method as described in implementation scheme 2, wherein the at least one polynucleotide is at least one mRNA.

[0068] Implementation scheme 4 is the method as described in any one of implementation schemes 1-3, wherein the at least one gRNA is delivered to the cell as at least one polynucleotide encoding the gRNA.

[0069] Implementation scheme 5 is a method as described in any one of implementation schemes 1-4, wherein the first genome editor comprises a lyase, a nicking enzyme, a non-catalytically active nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nicking enzyme.

[0070] Implementation Scheme 6 is a method as described in any one of Implementation Schemes 1-5, wherein the second genome editor comprises a lyase, a nicking enzyme, a non-catalytically active nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nicking enzyme.

[0071] Implementation 7 is a method as described in any one of Implementations 1-6, wherein one of the first genome editor and the second genome editor comprises a base editor, optionally a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor comprises a lyase.

[0072] Implementation scheme 8 is the method as described in implementation scheme 7, the method further comprising contacting the cell with a nucleic acid encoding a foreign gene.

[0073] Implementation scheme 9 is a method as described in any one of implementation schemes 1-6, wherein one of the first genome editor and the second genome editor comprises a C to T base editor, and the other of the first genome editor and the second genome editor comprises an A to G base editor.

[0074] Implementation scheme 10 is a method as described in any one of implementation schemes 1-9, wherein one of the first genome editor and the second genome editor contains a nicking enzyme or lyase guided by Neisseria meningitidis (Nme) RNA, and the other of the first genome editor and the second genome editor contains a nicking enzyme or lyase guided by Streptococcus pyogenes (Spy) RNA.

[0075] Implementation scheme 11 is a method as described in any one of implementation schemes 1-10, wherein the first genome editor or the second genome editor comprises a Cas nuclease.

[0076] Implementation scheme 12 is the method as described in implementation scheme 11, wherein the Cas nuclease is a type 2 Cas nuclease.

[0077] Implementation scheme 13 is the method as described in implementation scheme 11, wherein the Cas nuclease is Cas9.

[0078] Implementation scheme 14 is the method as described in implementation scheme 13, wherein the Cas9 is Streptococcus pyogenes Cas9 (SpyCas9), Staphylococcus aureus Cas9 (SauCas9), Corynebacterium diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (St1Cas9), Vibrio cellulolyticus Cas9 (AceCas9), Campylobacter jejuni Cas9 (CjeCas9), Rhodopseudomonas palustris Cas9 (RpaCas9), Rhodopseudomonas rubrum Cas9 (RruCas9), A. naeslundii Cas9 (AnaCas9), Francisella novicida Cas9 (FnoCas9), or Neisseria meningitidis (NmeCas9).

[0079] Implementation scheme 15 is the method as described in implementation scheme 13 or implementation scheme 14, wherein the Cas9 is Nme1Cas9, Nme2Cas9, Nme3Cas9 or SpyCas9.

[0080] Implementation scheme 16 is a method for genetically modifying cells, the method comprising:

[0081] (a) Contacting the cell with a first genome editing tool, the first genome editing tool comprising a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and

[0082] (b) Contact the cell with a second genome editing tool, the second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase.

[0083] This results in at least two genome editing products being generated in the cells.

[0084] Implementation scheme 17 is a method for generating a cell population comprising edited cells, the method comprising:

[0085] (a) Contact the cell with a first genome editing tool, the first genome editing tool comprising a first genome editor containing a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the base editor;

[0086] (b) Contacting the cell with a second genome editing tool, the second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase; and

[0087] (c) Culturing the cells to produce the cell population containing the edited cells, each of the edited cells containing at least two genome edits.

[0088] Embodiment 18 is the method as described in Embodiment 16 or 17, wherein the base editor is a C to T base editor, optionally containing cytidine deaminase, or an A to G base editor, optionally containing adenosine deaminase.

[0089] Implementation 19 is a method as described in any one of Implementations 1-18, wherein one of the at least two genome edits contains a double-strand break and the other of the at least two genome edits contains a transition (e.g., A to G or C to T).

[0090] Implementation 20 is a method as described in any one of Implementation 1-19, wherein the first genome editing tool or the second genome editing tool is delivered to the cell via electroporation.

[0091] Implementation scheme 21 is a method as described in any one of implementation schemes 1-20, wherein the first genome editing tool or the second genome editing tool is delivered to the cell via at least one lipid nanoparticle (LNP).

[0092] Implementation scheme 22 is a method as described in any one of implementation schemes 1-21, wherein the first genome editing tool or the second genome editing tool is delivered to the cell on at least one vector.

[0093] Implementation scheme 23 is the method as described in any one of implementation schemes 1-22, wherein the first genome editing tool or the second genome editing tool is a delivery of at least one nucleic acid encoding the first genome editing tool or the second genome editing tool.

[0094] Implementation scheme 24 is the method as described in implementation scheme 23, wherein the at least one nucleic acid comprises at least one mRNA.

[0095] Implementation scheme 25 is the method described as in implementation schemes 1-24, wherein steps (a) and (b) are performed simultaneously.

[0096] Implementation scheme 26 is the method as described in any one of implementation schemes 1-25, wherein steps (a) and (b) are performed in any order within a time period of approximately 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 24 hours.

[0097] Implementation scheme 27 is the method as described in any one of implementation schemes 1-26, wherein steps (a) and (b) are each performed independently over a time period of approximately 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 24 hours.

[0098] Implementation scheme 28 is a method as described in any one of implementation schemes 16-27, wherein the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI and the base editor are contained in a single polypeptide.

[0099] Implementation scheme 29 is a method as described in any one of implementation schemes 16-27, wherein the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI and the base editor are contained in different polypeptides.

[0100] Implementation scheme 30 is the method as described in implementation scheme 28 or 29, wherein the base editor comprises cytidine deaminase and RNA-guided nicking enzyme.

[0101] Implementation scheme 31 is the method as described in implementation scheme 30, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in a single polypeptide.

[0102] Implementation scheme 32 is the method as described in implementation scheme 30, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in different polypeptides.

[0103] Implementation scheme 33 is the method as described in implementation scheme 30, wherein the cytidine deaminase and the RNA-guided nickase are contained in a single polypeptide, and wherein the UGI is contained in a different polypeptide.

[0104] Implementation scheme 34 is the method as described in any one of implementation schemes 1-33, wherein the first genome editor contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, 146, or 311.

[0105] Embodiment 35 is a method as described in any one of Embodiments 1-34, wherein the first genome editor is delivered to the cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 1, and the second genome editor is delivered to the cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as any one of SEQ ID NO: 180-190.

[0106] Embodiment 36 is the method as described in any one of Embodiments 1-35, wherein the first genome editor is delivered to the cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 147 or 310, and the second genome editor is delivered to the cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 293 or 295.

[0107] Implementation scheme 37 is the method as described in any one of implementation schemes 1-33, wherein the first genome editor or the base editor contains at least 80%, 85%, 90%, 95%, 98%, or 100% of the same amino acid sequence as any one of SEQ ID NO: 9, 12, 18, and 21.

[0108] Implementation scheme 38 is the method as described in any one of implementation schemes 1-37, wherein the first genome editor or the base editor comprises cytidine deaminase, and wherein the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

[0109] Implementation scheme 39 is the method as described in implementation scheme 38, wherein the cytidine deaminase comprises APOBEC3A deaminase (A3A).

[0110] Implementation scheme 40 is the method as described in implementation scheme 39, wherein the A3A comprises the amino acid sequence of SEQ ID NO: 22 or an amino acid sequence that is at least 87%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 22.

[0111] Implementation scheme 41 is the method as described in implementation scheme 39 or 40, wherein the A3A is human A3A.

[0112] Implementation scheme 42 is the method as described in any one of implementation schemes 39-41, wherein the A3A is wild-type A3A.

[0113] Implementation scheme 43 is a method as described in any one of implementation schemes 1-42, wherein the first genome editor or the base editor comprises a Cas9 nickase.

[0114] Implementation scheme 44 is a method as described in any one of implementation schemes 1-43, wherein the first genome editor or the base editor contains Neisseria meningitidis (Nme) Cas9 nickase.

[0115] Implementation scheme 45 is a method as described in any one of implementation schemes 1-44, wherein the first genome editor or the base editor comprises a D16A NmeCas9 nickase, optionally a D16A Nme2Cas9.

[0116] Implementation scheme 46 is a method as described in any one of implementation schemes 1-45, wherein the first genome editor or the base editor comprises the amino acid sequence of SEQ ID NO: 149.

[0117] Implementation scheme 47 is the method as described in any one of implementation schemes 1-46, wherein the first genome editor or the base editor comprises a sequence that is at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 146.

[0118] Implementation scheme 48 is a method as described in any one of implementation schemes 1-47, wherein the second genome editor or the RNA-guided lyase comprises Cas9 lyase.

[0119] Implementation scheme 49 is a method as described in any one of implementation schemes 1-48, wherein the second genome editor or the RNA-guided lyase comprises Streptococcus pyogenes (Spy)Cas9 lyase.

[0120] Embodiment 50 is the method as described in any one of Embodiments 1-49, wherein the second genome editor or the RNA-guided lyase contains an amino acid sequence that is at least 90% identical to that of SEQ ID NO: 156.

[0121] Embodiment 51 is a method as described in any one of Embodiments 1-50, wherein the second genome editor or the RNA-guided lyase comprises the amino acid sequence of SEQ ID NO: 156.

[0122] Implementation scheme 52 is a method as described in any one of implementation schemes 1-43, wherein the first genome editor or the base editor contains Streptococcus pyogenes (SPy) Cas9 nickase.

[0123] Implementation scheme 53 is a method as described in any one of implementation schemes 1-43 and 52, wherein the first genome editor or the base editor contains a D10A SpyCas9 nickase.

[0124] Implementation scheme 54 is a method as described in any one of implementation schemes 1-43, 52 and 53, wherein the first genome editor or the base editor comprises an amino acid sequence of any one of SEQ ID NO: 41, 43 and 45 or an amino acid sequence having at least 80%, 90%, 95%, 98% or 99% identity with any one of SEQ ID NO: 41, 43 and 45.

[0125] Implementation scheme 55 is a method as described in any one of implementation schemes 1-43 and 52-54, wherein the first genome editor or the base editor is a nucleic acid delivered to the cell as a nucleotide sequence comprising any one of SEQ ID NO: 42, 44 and 46 or a nucleotide sequence having at least 80%, 90%, 95%, 98% or 99% identity with any one of SEQ ID NO: 42, 44 and 46.

[0126] Implementation scheme 56 is a method as described in any one of implementation schemes 1-43 and 52-54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid containing a nucleotide sequence of any one of SEQ ID NO: 42, 44 and 46-58.

[0127] Implementation scheme 57 is a method as described in any one of implementation schemes 1-43 and 52-54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 1.

[0128] Implementation scheme 58 is a method as described in any one of implementation schemes 1-43 and 52-54, wherein the first genome editor or the base editor is delivered to the cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 4.

[0129] Implementation scheme 59 is a method as described in any one of implementation schemes 1-43 and 52-56, wherein the first genome editor or the base editor contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 148.

[0130] Implementation Scheme 60 is a method as described in any one of Implementation Schemes 1-43 and 52-59, wherein the second genome editor or the RNA-guided lyase comprises Neisseria meningitidis (Nme) Cas9 lyase.

[0131] Implementation scheme 61 is a method as described in any one of implementation schemes 1-43 and 52-60, wherein the second genome editor or the RNA-guided lyase comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the same amino acid sequence as any one of SEQ ID NO: 157-167, 191, 198, 205, 212, and 219.

[0132] Implementation scheme 62 is a method as described in any one of implementation schemes 1-43 and 52-61, wherein the second genome editor or the RNA-guided lyase comprises the amino acid sequence of any one of SEQ ID NO: 157-167, 191, 198, 205, 212 and 219.

[0133] Implementation Scheme 63 is a method as described in any one of Implementation Schemes 1-43 and 52-61, wherein the second genome editor or the RNA-guided lyase is delivered to the cell as a nucleic acid containing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the same nucleotide sequence as any one of SEQ ID NO: 168-190, 192-197, 199-204, 206-211, 213-218, and 220-225.

[0134] Implementation scheme 64 is a method as described in any one of implementation schemes 1-43 and 52-61, wherein the second genome editor or the RNA-guided lyase is delivered to the cell as a nucleic acid containing a nucleotide sequence comprising any one of SEQ ID NO: 168-190, 192-197, 199-204, 206-211, 213-218 and 220-225.

[0135] Implementation scheme 65 is a method as described in any one of implementation schemes 1-64, wherein at least one gRNA homologous to the first genome editor or the base editor is not homologous to the second genome editor or the RNA-guided lyase.

[0136] Implementation scheme 66 is a method as described in any one of implementation schemes 1-65, wherein at least one gRNA homologous to the second genome editor or the RNA-guided lyase is not homologous to the first genome editor or the base editor.

[0137] Implementation scheme 67 is a method as described in any one of implementation schemes 1-66, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

[0138] Implementation scheme 68 is the method as described in implementation scheme 67, wherein the at least one sgRNA comprises a short single guide RNA (short sgRNA), the short sgRNA comprises a conserved portion of sgRNA containing a hairpin region, wherein the hairpin region is missing at least 5-10 nucleotides and wherein the short sgRNA contains a 5′ end modification or a 3′ end modification or both.

[0139] Implementation scheme 69 is a method as described in any one of implementation schemes 1-68, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

[0140] Implementation scheme 70 is a method as described in any one of implementation schemes 1-69, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least two gRNAs targeting at least two different genomic loci.

[0141] Implementation scheme 71 is a method as described in any one of implementation schemes 1-70, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

[0142] Implementation scheme 72 is a method as described in any one of implementation schemes 1-71, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least three gRNAs targeting at least three different genomic loci.

[0143] Implementation scheme 73 is a method as described in any one of implementation schemes 1-72, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci.

[0144] Implementation scheme 74 is the method as described in any one of implementation schemes 1-73, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least four gRNAs targeting at least four different genomic loci.

[0145] Implementation scheme 75 is a method as described in any one of implementation schemes 1-74, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

[0146] Implementation scheme 76 is a method as described in any one of implementation schemes 1-75, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least five gRNAs targeting at least five different genomic loci.

[0147] Implementation scheme 77 is a method as described in any one of implementation schemes 1-76, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least six gRNAs targeting at least six different genomic loci.

[0148] Implementation scheme 78 is a method as described in any one of implementation schemes 1-77, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least six gRNAs targeting at least six different genomic loci.

[0149] Implementation scheme 79 is a method as described in any one of implementation schemes 1-78, wherein the at least one gRNA homologous to the first genome editor or the base editor targets one or more genomic loci selected from the following: TRBC locus, HLA-A locus, HLA-B locus, CIITA locus, HLA-DR locus, HLA-DQ locus, and HLA-DP locus.

[0150] Implementation scheme 80 is a method as described in any one of implementation schemes 1-79, wherein at least one gRNA homologous to the second genome editor or the RNA-guided lyase targets one or more genomic loci selected from the following: TRAC locus, AAVS1 locus, and CIITA locus.

[0151] Implementation scheme 81 is the method as described in any one of implementation schemes 1-80, wherein

[0152] (i) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0153] (ii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0154] (iii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0155] (iv) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0156] (v) The at least one gRNA homologous to the first genome editor or the base editor comprises a gRNA targeting the HLA-A locus and a gRNA targeting the HLA-DR locus, the HLA-DQ locus or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises a gRNA targeting the TRAC locus.

[0157] (vi) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus;

[0158] (vii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus;

[0159] (viii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus;

[0160] (ix) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRAC locus, a gRNA targeting the TRBC locus, a gRNA targeting the CIITA locus, and a gRNA targeting the HLA-A locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0161] (x) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the AAVS1 locus.

[0162] (xi) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the AAVS1 locus.

[0163] (xii) The at least one gRNA homologous to the first genome editor or the base editor comprises a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises a gRNA targeting the AAVS1 locus; or

[0164] (xiii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the AAVS1 locus.

[0165] Implementation scheme 82 is a method as described in any one of implementation schemes 1-81, the method further comprising contacting the cell with nucleic acid encoding a foreign gene for insertion into the TRAC or the AAVS1 locus.

[0166] Implementation scheme 83 is the method as described in implementation scheme 82, wherein in any of sub-parts (i) to (ix), the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises another gRNA targeting the AAVS1 locus.

[0167] Implementation scheme 84 is the method as described in implementation scheme 82, wherein in any of sub-parts (x) to (xiii), the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises another gRNA targeting the TRAC locus.

[0168] Implementation scheme 85 is the method as described in implementation scheme 84, wherein after contacting the cell with the gRNA targeting the TRAC locus, the cell is contacted with the other gRNA targeting the AAVS1 locus.

[0169] Implementation scheme 86 is the method as described in implementation scheme 85, wherein after contacting the cell with the gRNA targeting the AAVS1 locus, the cell is contacted with the other gRNA targeting the TRAC locus.

[0170] Implementation scheme 87 is a composition comprising:

[0171] (a) A first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the first genome editor; and

[0172] (b) A second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA that targets at least one genomic locus and is homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor.

[0173] Embodiment 88 is a composition as described in Embodiment 87, wherein the first genome editor or the second genome editor comprises at least one polypeptide or at least one mRNA.

[0174] Embodiment 89 is a composition as described in Embodiment 87 or 88, wherein the at least one gRNA comprises at least one polynucleotide encoding the gRNA.

[0175] Embodiment 90 is a composition as described in any one of Embodiments 87-89, wherein the first genome editor comprises a lyase, a nicking enzyme, a non-catalytically active nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nicking enzyme.

[0176] Embodiment 91 is a composition as described in any one of Embodiments 87-90, wherein the second genome editor comprises a lyase, a nicking enzyme, a non-catalytically active nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nicking enzyme.

[0177] Embodiment 92 is a composition as described in any one of embodiments 87-91, wherein one of the first genome editor and the second genome editor comprises a base editor, optionally a C-to-T base editor or an A-to-G base editor, and the other of the first genome editor and the second genome editor comprises a lyase.

[0178] Embodiment 93 is a composition as described in Embodiment 92, wherein the composition further comprises a nucleic acid encoding a foreign gene.

[0179] Embodiment 94 is a composition as described in any one of embodiments 87-91, wherein one of the first genome editor and the second genome editor comprises a C to T base editor, and the other of the first genome editor and the second genome editor comprises an A to G base editor.

[0180] Embodiment 95 is a composition as described in any one of Embodiments 87-94, wherein one of the first genome editor and the second genome editor contains a nicking enzyme guided by Neisseria meningitidis (Nme) RNA, and the other of the first genome editor and the second genome editor contains a nicking enzyme guided by Streptococcus pyogenes (Spy) RNA.

[0181] Embodiment 96 is a composition as described in any one of Embodiments 87-95, wherein the first genome editor or the second genome editor is a Cas nuclease.

[0182] Embodiment 97 is the composition as described in Embodiment 96, wherein the Cas nuclease is a type 2 Cas nuclease.

[0183] Embodiment 98 is the composition as described in Embodiment 96, wherein the Cas nuclease is Cas9.

[0184] Embodiment 99 is the composition as described in Embodiment 98, wherein the Cas9 is Streptococcus pyogenes Cas9 (SpyCas9), Staphylococcus aureus Cas9 (SauCas9), Corynebacterium diphtheriae Cas9 (CdiCas9), Streptococcus thermophilus Cas9 (St1Cas9), Vibrio cellulose hydrolysate Cas9 (AceCas9), Campylobacter jejuni Cas9 (CjeCas9), Rhodopseudomonas palustris Cas9 (RpaCas9), Rhodospirillum rubrum Cas9 (RruCas9), Actinomyces nephron Cas9 (AnaCas9), Francisella neonatorum Cas9 (FnoCas9), or Neisseria meningitidis (NmeCas9).

[0185] Embodiment 100 is the composition as described in Embodiment 98 or 99, wherein the Cas9 is Nme 1Cas9, Nme 2Cas9, Nme 3Cas9 or SpyCas9.

[0186] Implementation scheme 101 is a composition comprising:

[0187] (a) A first genome editing tool, wherein the first genome editing tool comprises a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and

[0188] (b) A second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase.

[0189] Embodiment 102 is the composition as described in Embodiment 101, wherein the base editor is a C to T base editor, optionally containing cytidine deaminase, or an A to G base editor, optionally containing adenosine deaminase.

[0190] Embodiment 103 is a composition as described in any one of embodiments 87-102, wherein the first genome editing tool or the second genome editing tool is delivered to the cell via electroporation.

[0191] Embodiment 104 is a composition as described in any one of embodiments 87-103, wherein the first genome editing tool or the second genome editing tool is contained in at least one lipid nanoparticle (LNP).

[0192] Embodiment 105 is a composition as described in any one of embodiments 87-104, wherein the first genome editing tool or the second genome editing tool comprises at least one vector.

[0193] Embodiment 106 is a composition as described in any one of Embodiments 87-105, wherein the first genome editing tool or the second genome editing tool comprises at least one polypeptide or at least one nucleic acid encoding the first genome editing tool or the second genome editing tool.

[0194] Embodiment 107 is a composition as described in any one of Embodiments 87-106, wherein the first genome editing tool comprises at least one polypeptide comprising the first genome editing tool or at least one nucleic acid encoding the first genome editing tool.

[0195] Embodiment 108 is a composition as described in any one of Embodiments 87-107, wherein the second genome editing tool comprises at least one polypeptide comprising the second genome editing tool or at least one nucleic acid encoding the second genome editing tool.

[0196] Embodiment 109 is a composition as described in any one of Embodiments 106-108, wherein the at least one nucleic acid comprises at least one mRNA.

[0197] Embodiment 110 is a composition as described in any one of Embodiments 101-109, wherein the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI and the base editor are contained in a single polypeptide.

[0198] Embodiment 111 is a composition as described in any one of Embodiments 101-109, wherein the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI and the base editor are contained in different polypeptides.

[0199] Embodiment 112 is a composition as described in Embodiment 110 or 111, wherein the base editor comprises cytidine deaminase and RNA-guided nicking enzyme.

[0200] Embodiment 113 is a composition as described in Embodiment 112, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in a single polypeptide.

[0201] Embodiment 114 is a composition as described in Embodiment 112, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in different polypeptides.

[0202] Embodiment 115 is a composition as described in Embodiment 112, wherein the cytidine deaminase and the RNA-guided nickase are contained in a single polypeptide, and wherein the UGI is contained in a different polypeptide.

[0203] Embodiment 116 is a composition as described in any one of embodiments 87-115, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 3, 146, or 311.

[0204] Embodiment 117 is a composition as described in any one of Embodiments 87-116, wherein the first genome editor is delivered to a cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 1, and the second genome editor is delivered to a cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as any one of SEQ ID NO: 180-190.

[0205] Embodiment 118 is a composition as described in any one of Embodiments 87-117, wherein the first genome editor is delivered to a cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 147 or 310, and the second genome editor is delivered to a cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 293 or 295.

[0206] Embodiment 119 is a composition as described in any one of embodiments 87-115, wherein the first genome editor or the base editor comprises at least 80%, 85%, 90%, 95%, 98%, or 100% of the same amino acid sequence as any one of SEQ ID NO: 9, 12, 18, and 21.

[0207] Embodiment 120 is a composition as described in any one of Embodiments 87-119, wherein the first genome editor or the base editor comprises cytidine deaminase, and wherein the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 22.

[0208] Embodiment 121 is the composition as described in Embodiment 120, wherein the cytidine deaminase comprises APOBEC3A deaminase (A3A).

[0209] Embodiment 122 is the composition as described in Embodiment 121, wherein the A3A comprises the amino acid sequence of SEQ ID NO: 22 or an amino acid sequence that is at least 87%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 22.

[0210] Embodiment 123 is the composition as described in Embodiment 121 or 122, wherein the A3A is human A3A.

[0211] Embodiment 124 is the composition as described in any one of embodiments 121-123, wherein the A3A is wild-type A3A.

[0212] Embodiment 125 is a composition as described in any one of embodiments 87-124, wherein the first genome editor or the base editor comprises a Cas9 nickase.

[0213] Embodiment 126 is a composition as described in any one of Embodiments 87-125, wherein the first genome editor or the base editor comprises Neisseria meningitidis (Nme) Cas9 nickase.

[0214] Embodiment 127 is a composition as described in any one of Embodiments 87-126, wherein the first genome editor or the base editor comprises a D16A NmeCas9 nickase, optionally a D16A Nme2Cas9.

[0215] Embodiment 128 is a composition as described in any one of embodiments 87-127, wherein the first genome editor or the base editor comprises the amino acid sequence of SEQ ID NO: 149.

[0216] Embodiment 129 is a composition as described in any one of Embodiments 87-128, wherein the first genome editor or the base editor comprises a sequence that is at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 146.

[0217] Embodiment 130 is a composition as described in any one of Embodiments 87-129, wherein the second genome editor or the RNA-guided lyase comprises Cas9 lyase.

[0218] Embodiment 131 is a composition as described in any one of embodiments 87-130, wherein the second genome editor or the RNA-guided lyase comprises a Streptococcus pyogenes (Spy) Cas9 lyase.

[0219] Embodiment 132 is a composition as described in any one of embodiments 87-131, wherein the second genome editor or the RNA-guided lyase comprises an amino acid sequence that is at least 90% identical to that of SEQ ID NO: 156.

[0220] Embodiment 133 is a composition as described in any one of embodiments 87-132, wherein the second genome editor or the RNA-guided lyase comprises the amino acid sequence of SEQ ID NO: 156.

[0221] Embodiment 134 is a composition as described in any one of embodiments 87-125, wherein the first genome editor or the base editor comprises a Streptococcus pyogenes (Spy) Cas9 nickase.

[0222] Embodiment 135 is a composition as described in any one of embodiments 87-125 and 134, wherein the first genome editor or the base editor comprises D10ASpyCas9 nickase.

[0223] Embodiment 136 is a composition as described in any one of embodiments 87-125, 134 and 135, wherein the first genome editor or the base editor comprises an amino acid sequence of any one of SEQ ID NO: 41, 43 and 45 or an amino acid sequence having at least 80%, 90%, 95%, 98% or 99% identity with any one of SEQ ID NO: 41, 43 and 45.

[0224] Embodiment 137 is a composition as described in any one of Embodiments 87-125 and 134-136, wherein the first genome editor or the base editor is a nucleic acid delivered to a cell as a nucleotide sequence comprising any one of SEQ ID NO: 42, 44 and 46 or a nucleotide sequence having at least 80%, 90%, 95%, 98% or 99% identity with any one of SEQ ID NO: 42, 44 and 46.

[0225] Embodiment 138 is a composition as described in any one of embodiments 87-125 and 134-137, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid containing a nucleotide sequence comprising any one of SEQ ID NO: 42, 44 and 46-58.

[0226] Embodiment 139 is a composition as described in any one of embodiments 87-125 and 134-138, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 1.

[0227] Embodiment 140 is a composition as described in any one of Embodiments 87-125 and 134-138, wherein the first genome editor or the base editor is delivered to a cell as a nucleic acid containing at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 4.

[0228] Embodiment 141 is a composition as described in any one of embodiments 87-125 and 134-138, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 148.

[0229] Embodiment 142 is a composition as described in any one of Embodiments 87-125 and 134-141, wherein the second genome editor or the RNA-guided lyase comprises Neisseria meningitidis (Nme) Cas9 lyase.

[0230] Embodiment 143 is a composition as described in any one of embodiments 87-125 and 134-142, wherein the second genome editor or the RNA-guided lyase comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the same amino acid sequence as any one of SEQ ID NOs: 157-167, 191, 198, 205, 212, and 219.

[0231] Embodiment 144 is a composition as described in any one of embodiments 87-124 and 134-143, wherein the second genome editor or the RNA-guided lyase comprises the amino acid sequence of any one of SEQ ID NO: 157-167, 191, 198, 205, 212 and 219.

[0232] Embodiment 145 is a composition as described in any one of Embodiments 87-124 and 134-144, wherein the second genome editor or the RNA-guided lyase is delivered to the cell as a nucleic acid containing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the same nucleotide sequence as any one of SEQ ID NO: 168-190, 192-197, 199-204, 206-211, 213-218, and 220-225.

[0233] Embodiment 146 is a composition as described in any one of Embodiments 87-124 and 134-144, wherein the second genome editor or the RNA-guided lyase is delivered to the cell as a nucleic acid containing a nucleotide sequence comprising any one of SEQ ID NO: 168-190, 192-197, 199-204, 206-211, 213-218, and 220-225.

[0234] Embodiment 147 is a composition as described in any one of Embodiments 87-146, wherein at least one gRNA homologous to the first genome editor or the base editor is not homologous to the second genome editor or the RNA-guided lyase.

[0235] Embodiment 148 is a composition as described in any one of Embodiments 87-147, wherein at least one gRNA homologous to the second genome editor or the RNA-guided lyase is not homologous to the first genome editor or the base editor.

[0236] Embodiment 149 is a composition as described in any one of embodiments 87-148, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

[0237] Embodiment 150 is a composition as described in Embodiment 149, wherein the at least one sgRNA comprises a short single guide RNA (short sgRNA), the short sgRNA comprising a conserved portion of sgRNA containing a hairpin region, wherein the hairpin region is missing at least 5-10 nucleotides and wherein the short sgRNA comprises a 5′ end modification or a 3′ end modification or both.

[0238] Embodiment 151 is a composition as described in any one of Embodiments 87-150, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

[0239] Embodiment 152 is a composition as described in any one of Embodiments 87-151, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least two gRNAs targeting at least two different genomic loci.

[0240] Embodiment 153 is a composition as described in any one of Embodiments 87-152, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

[0241] Embodiment 154 is a composition as described in any one of Embodiments 87-153, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least three gRNAs targeting at least three different genomic loci.

[0242] Embodiment 155 is a composition as described in any one of Embodiments 87-154, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci.

[0243] Embodiment 156 is a composition as described in any one of Embodiments 87-155, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least four gRNAs targeting at least four different genomic loci.

[0244] Embodiment 157 is a composition as described in any one of Embodiments 87-156, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

[0245] Embodiment 158 ​​is a composition as described in any one of Embodiments 87-157, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least five gRNAs targeting at least five different genomic loci.

[0246] Embodiment 159 is a composition as described in any one of Embodiments 87-158, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least six gRNAs targeting at least six different genomic loci.

[0247] Embodiment 160 is a composition as described in any one of Embodiments 87-159, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises at least six gRNAs targeting at least six different genomic loci.

[0248] Embodiment 161 is a composition as described in any one of Embodiments 151-160, wherein the first genome editor and one, two, three, four, five, or six of the at least one gRNA homologous to the first genome editor or the base editor and targeting different genomic loci are contained in the same lipid nanoparticle (LNP).

[0249] Embodiment 162 is a composition as described in any one of Embodiments 87-161, wherein the at least one gRNA homologous to the first genome editor or the base editor targets one or more genomic loci selected from the following: TRBC locus, HLA-A locus, HLA-B locus, CIITA locus, HLA-DR locus, HLA-DQ locus, and HLA-DP locus.

[0250] Embodiment 163 is a composition as described in any one of Embodiments 87-162, wherein at least one gRNA homologous to the second genome editor or the RNA-guided lyase targets one or more genomic loci selected from the following: TRAC locus, AAVS1 locus, and CIITA locus.

[0251] Embodiment 164 is the composition as described in any one of embodiments 87-163, wherein

[0252] (i) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0253] (ii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0254] (iii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0255] (iv) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0256] (v) The at least one gRNA homologous to the first genome editor or the base editor comprises a gRNA targeting the HLA-A locus and a gRNA targeting the HLA-DR locus, the HLA-DQ locus or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises a gRNA targeting the TRAC locus.

[0257] (vi) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus;

[0258] (vii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus;

[0259] (viii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus;

[0260] (ix) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRAC locus, a gRNA targeting the TRBC locus, a gRNA targeting the CIITA locus, and a gRNA targeting the HLA-A locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the TRAC locus.

[0261] (x) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the AAVS1 locus.

[0262] (xi) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the AAVS1 locus.

[0263] (xii) The at least one gRNA homologous to the first genome editor or the base editor comprises a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises a gRNA targeting the AAVS1 locus; or

[0264] (xiii) The at least one gRNA homologous to the first genome editor or the base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or the RNA-guided lyase includes a gRNA targeting the AAVS1 locus.

[0265] Embodiment 165 is a composition as described in any one of Embodiments 87-164, the composition further comprising nucleic acids encoding a foreign gene for insertion into the TRAC or the AAVS1 locus.

[0266] Embodiment 166 is the composition as described in Embodiment 164, wherein in any of subparts (i) to (ix), the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises another gRNA targeting the AAVS1 locus.

[0267] Embodiment 167 is the composition as described in Embodiment 164, wherein in any of subparts (x) to (xiii), the at least one gRNA homologous to the second genome editor or the RNA-guided lyase comprises another gRNA targeting the TRAC locus.

[0268] Embodiment 168 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising the first genome editor or the base editor, (iii) a third LNP comprising a uracil glycosidase inhibitor (UGI), (iv) a fourth LNP comprising the second gRNA, (v) a fifth LNP comprising the third gRNA, and (vi) a sixth LNP comprising the fourth gRNA.

[0269] Embodiment 169 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising the first genome editor or the base editor, (iii) a third LNP comprising a uracil glycosidase inhibitor (UGI), (iv) a fourth LNP comprising the second gRNA and the third gRNA, and (v) a fifth LNP comprising the fourth gRNA.

[0270] Embodiment 170 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising the first genome editor or the base editor and comprising a uracil glycosidase inhibitor (UGI), (iii) a third LNP comprising the second gRNA, (iv) a fourth LNP comprising the third gRNA, and (v) a fifth LNP comprising the fourth gRNA.

[0271] Embodiment 171 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising the first genome editor or the base editor and comprising a uracil glycosidase inhibitor (UGI), (iii) a third LNP comprising the second gRNA and the third gRNA, and (iv) a fourth LNP comprising the fourth gRNA.

[0272] Embodiment 172 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising the first genome editor or the base editor, (iii) a third LNP comprising a uracil glycosidase inhibitor (UGI), and (iv) a fourth LNP comprising the second gRNA, the third gRNA, and the fourth gRNA.

[0273] Embodiment 173 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising a uracil glycosidase inhibitor (UGI), (iii) a third LNP comprising the first genome editor or the base editor and comprising the second gRNA, (iv) a fourth LNP comprising the first genome editor or the base editor and comprising the third gRNA, and (v) a fifth LNP comprising the first genome editor or the base editor and comprising the fourth gRNA.

[0274] Embodiment 174 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively comprised of: (i) a first lipid nanoparticle (LNP) comprising the second genome editor and the first gRNA, (ii) a second LNP comprising a uracil glycosidase inhibitor (UGI), (iii) a third LNP comprising the first genome editor or the base editor and comprising the second gRNA and the third gRNA, and (iv) a fourth LNP comprising the first genome editor or the base editor and comprising the fourth gRNA.

[0275] Embodiment 175 is a method or composition as described in any one of Embodiments 168-174, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in the first to fourth LNPs, the first to fifth LNPs, or the first to sixth LNPs, and in one or more additional LNPs containing the fifth gRNA.

[0276] Embodiment 176 is the method or composition as described in Embodiment 175, wherein the one or more additional LNPs further comprise a sixth gRNA.

[0277] Embodiment 177 is the method or composition as described in Embodiment 176, wherein the one or more additional LNPs further comprise a seventh gRNA.

[0278] Embodiment 178 is the method or composition as described in Embodiment 177, wherein the one or more additional LNPs further comprise an eighth gRNA.

[0279] Embodiment 179 is the method or composition as described in Embodiment 178, wherein the one or more additional LNPs further comprise a ninth gRNA.

[0280] Embodiment 180 is the method or composition as described in Embodiment 179, wherein the one or more additional LNPs further comprise a tenth gRNA.

[0281] Embodiment 181 is a method or composition as described in any one of Embodiments 168-180, wherein the second genome editor comprises a *Spy* Cas9 lysin, the first genome editor or the base editor comprises a *N. meningitidis* Cas9 nickase, the first gRNA targets the TRAC locus, the second gRNA targets the HLA-A locus, the third gRNA targets the CIITA locus, the fourth gRNA targets the HLA-B locus, the fifth gRNA targets the TRBC locus, and the one or more additional gRNAs each target a locus different from the TRAC locus, the HLA-A locus, the HLA-B locus, the CIITA locus, and the TRBC locus.

[0282] Embodiment 182 is the method or composition as described in Embodiment 181, wherein the first gRNA comprises the sequence of SEQ ID NO: 374 or 378 or a sequence that is at least 95%, 90%, or 85% identical to SEQ ID NO: 374 or 378, wherein the second gRNA comprises the sequence of SEQ ID NO: 366 or 370 or a sequence that is at least 95%, 90%, or 85% identical to SEQ ID NO: 366 or 370, wherein the third gRNA comprises the sequence of SEQ ID NO: 345 or 384 or a sequence that is at least 95%, 90%, or 85% identical to SEQ ID NO: 345 or 384, and wherein the fourth gRNA comprises the sequence of SEQ ID NO: 363 or a sequence that is at least 95%, 90%, or 85% identical to SEQ ID NO: 363.

[0283] Implementation scheme 183 is a method or composition as described in any one of embodiments 1-167, wherein the first genome editing tool, the second genome editing tool and the gRNA are collectively contained in at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 different lipid nanoparticles (LNPs), each containing different nucleic acid components.

[0284] Embodiment 184 is the method or composition as described in Embodiment 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in 4, 5, 6, or 7 different lipid nanoparticles (LNPs), each containing different nucleic acid components.

[0285] Implementation scheme 185 is the method or composition as described in implementation scheme 183, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in four different LNPs, each containing different nucleic acid components.

[0286] Implementation scheme 186 is the method or composition as described in implementation scheme 183, wherein the first genome editing tool, the second genome editing tool and the gRNA are collectively contained in five different LNPs, each containing different nucleic acid components.

[0287] Implementation scheme 187 is the method or composition as described in implementation scheme 183, wherein the first genome editing tool, the second genome editing tool and the gRNA are collectively contained in six different LNPs, each containing different nucleic acid components.

[0288] Implementation scheme 188 is the method or composition as described in implementation scheme 183, wherein the first genome editing tool, the second genome editing tool and the gRNA are collectively contained in seven different LNPs, each containing different nucleic acid components.

[0289] Embodiment 189 is a method or composition as described in any one of Embodiments 1-167, wherein the at least one gRNA homologous to the first genome editor or the base editor and the at least one gRNA homologous to the second genome editor together comprise at least two gRNAs, and wherein the two gRNAs targeting different genomic loci are contained in the same lipid nanoparticle (LNP).

[0290] Embodiment 190 is a method or composition as described in any one of Embodiments 1-167 and 189, wherein the at least one gRNA homologous to the first genome editor or the base editor and the at least one gRNA homologous to the second genome editor together comprise at least three gRNAs, and wherein the three gRNAs targeting different genomic loci are contained in the same lipid nanoparticle.

[0291] Embodiment 191 is a method or composition as described in any one of Embodiments 1-167, 189 and 190, wherein the at least one gRNA homologous to the first genome editor or the base editor and the at least one gRNA homologous to the second genome editor together comprise at least four gRNAs, and wherein the four gRNAs targeting different genomic loci are contained in the same lipid nanoparticle.

[0292] Embodiment 192 is a method or composition as described in any one of embodiments 189-191, wherein the other gRNAs are each contained in a different LNP.

[0293] Embodiment 193 is a method or composition as described in any one of Embodiments 1-167, wherein each of the gRNAs is contained in a different LNP.

[0294] Embodiment 194 is a method or composition as described in any one of Embodiments 1-167, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises more than one gRNA targeting different genomic loci, and the first genome editor or the base editor and at least one of the more than one gRNA are contained in the same LNP.

[0295] Embodiment 195 is the method or composition as described in Embodiment 194, wherein the first genome editor or one of the base editor and the gRNA is contained in the same LNP.

[0296] Implementation scheme 196 is the method or composition as described in implementation scheme 194 or 195, wherein the first genome editor or the base editor and two of the gRNA are contained in the same LNP.

[0297] Embodiment 197 is a method or composition as described in any one of Embodiments 194-196, wherein the first genome editor or the base editor and the gRNA are contained in the same LNP.

[0298] Embodiment 198 is a method or composition as described in any one of Embodiments 194-197, wherein the first genome editor or the base editor and four of the gRNA are contained in the same LNP.

[0299] Embodiment 199 is a method or composition as described in any one of Embodiments 1-167, wherein the first genome editor or the base editor is contained in an LNP that is different from each of the at least one gRNA homologous to the first genome editor or the base editor.

[0300] Embodiment 200 is a method or composition as described in any one of Embodiments 1-167, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises more than one gRNA targeting different genomic loci, and each of the more than one gRNA is contained in a different LNP.

[0301] Embodiment 201 is the method or composition as described in Embodiment 200, wherein each of the LNPs of one of the gRNAs homologous to the first genome editor or the base editor further comprises the first genome editor or the base editor.

[0302] Implementation scheme 202 is a method or composition as described in any one of implementation schemes 1-167, wherein the second genome editor and the at least one gRNA homologous to the second genome editor are contained in the same LNP.

[0303] Implementation scheme 203 is the method or composition as described in implementation scheme 202, wherein the second genome editor and one of the gRNAs are contained in the same LNP.

[0304] Embodiment 204 is a method or composition as described in any one of Embodiments 1-167, wherein the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI is contained in an LNP that is different from each of the gRNAs.

[0305] Embodiment 205 is a method or composition as described in any one of embodiments 1-204, wherein the LNP comprises a first set of different LNPs, a second set of different LNPs, and optionally a third set of different LNPs.

[0306] Embodiment 206 is the method or composition as described in Embodiment 205, wherein the first set of different LNPs comprises 2, 3, 4 or 5 LNPs, the second set of different LNPs comprises 2, 3, 4 or 5 LNPs, and the third set of different LNPs, when present, comprises 2, 3, 4 or 5 LNPs.

[0307] Implementation scheme 207 is the method or composition as described in implementation scheme 205 or 206, wherein the first group of different LNPs comprises 3 or 4 LNPs and the second group of different LNPs comprises 3 or 4 LNPs.

[0308] Embodiment 208 is a method or composition as described in any one of Embodiments 205-207, wherein the first set of different LNPs, the second set of different LNPs, and the third set of different LNPs (in the presence) are sequentially delivered to the cells.

[0309] Embodiment 209 is a method or composition as described in any one of Embodiments 205-208, wherein the second set of different LNPs is delivered to the cells 1, 2 or 3 days after the first set of different LNPs is delivered to the cells, and wherein the third set of different LNPs (if present) is delivered to the cells 1, 2 or 3 days after the second set of different LNPs is delivered to the cells.

[0310] Embodiment 210 is a method or composition as described in any one of embodiments 205-209, wherein the second set of different LNPs is delivered to the cells 1 day after the first set of different LNPs are delivered to the cells.

[0311] Embodiment 211 is a method or composition as described in any one of Embodiments 21-86 and 104-210, wherein the diameter of the LNP is 1-250 nm, 10-200 nm, 20-150 nm, about 35-150 nm, 50-150 nm, 50-100 nm, 50-120 nm, 60-100 nm, 75-150 nm, 75-120 nm, or 75-100 nm.

[0312] Embodiment 212 is the method or composition as described in Embodiment 211, wherein the diameter of the LNP is <100 nm.

[0313] Embodiment 213 is a method or composition as described in any one of Embodiments 21-86 and 104-211, wherein the LNP comprises an ionizable lipid.

[0314] Embodiment 214 is the method or composition as described in Embodiment 213, wherein the ionizable lipid comprises a biodegradable ionizable lipid.

[0315] Embodiment 215 is the method or composition as described in Embodiments 213 or 214, wherein the ionizable lipid has a pKa value in the range of about 5.1 to about 7.4, for example, about 5.5 to about 6.6, about 5.6 to about 6.4, about 5.8 to about 6.2, or about 5.8 to about 6.5.

[0316] Embodiment 216 is a method or composition as described in any one of Embodiments 213-215, wherein the ionizable lipid comprises an amine lipid.

[0317] Embodiment 217 is the method or composition as described in Embodiment 216, wherein the amine lipid is lipid A or an acetal analog thereof or lipid D.

[0318] Embodiment 218 is a method or composition as described in any one of Embodiments 21-86 and 104-217, wherein the LNP comprises an auxiliary lipid.

[0319] Embodiment 219 is a method or composition as described in any one of Embodiments 21-86 and 104-218, wherein the N / P ratio of the LNP is about 6.

[0320] Embodiment 220 is a method or composition as described in any one of Embodiments 21-86 and 104-219, wherein the LNP comprises amine lipids, auxiliary lipids, and PEG lipids.

[0321] Embodiment 221 is a method or composition as described in any one of Embodiments 21-86 and 104-220, wherein the LNP comprises amine lipids, auxiliary lipids, neutral lipids, and PEG lipids.

[0322] Embodiment 222 is a method or composition as described in any one of Embodiments 21-86 and 104-221, wherein the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol% amine lipids such as lipid A; about 8-10 mol% neutral lipids; and about 2.5-4 mol% occult lipids (e.g., PEG lipids), wherein the remainder of the lipid component is accessory lipids, and wherein the N / P ratio of the lipid LNP is about 3-7.

[0323] Embodiment 223 is a method or composition as described in any one of Embodiments 21-86 and 104-222, wherein the LNP comprises a lipid component and the lipid component comprises: about 25-45 mol% amine lipids such as lipid A; about 10-30 mol% neutral lipids; about 25-65 mol% accessory lipids; and about 1.5-3.5 mol% occult lipids (e.g., PEG lipids), and wherein the N / P ratio of the LNP is about 3-7.

[0324] Embodiment 224 is the method or composition as described in Embodiment 223, wherein the amount of the amine lipid is about 29-38 mol% of the lipid component; about 30-43 mol% of the lipid component; or about 25-34 mol% of the lipid component; or optionally about 33 mol%, about 35 mol%, or about 38 mol% of the lipid component.

[0325] Embodiment 225 is the method or composition of 223 or 224, wherein the amount of the neutral lipid is about 11-20 mol% of the lipid component, optionally about 15 mol% of the lipid component.

[0326] Embodiment 226 is a method or composition as described in any one of Embodiments 223-225, wherein the amount of the auxiliary lipid is about 43-65 mol% of the lipid component; or about 43-55 mol% of the lipid component; optionally about 47.5 mol% of the lipid component or about 49 mol% of the lipid component.

[0327] Embodiment 227 is a method or composition as described in any one of Embodiments 223-226, wherein the amount of said PEG lipid is about 2.0-3.5 mol% of the lipid component; about 2.3-3.5 mol% of the lipid component; or about 2.3-2.7 mol% of the lipid component, optionally about 2.5 mol% or about 2.7 mol% of the lipid component.

[0328] Embodiment 228 is the method or composition as described in any one of embodiments 223-237, wherein

[0329] a. The amount of the amine lipid is about 29-44 mol% of the lipid component; the amount of the neutral lipid is about 11-28 mol% of the lipid component; the amount of the auxiliary lipid is about 28-55 mol% of the lipid component; and the amount of the PEG lipid is about 2.3-3.5 mol% of the lipid component.

[0330] b. The amount of the amine lipid is about 29-38 mol% of the lipid component; the amount of the neutral lipid is about 11-20 mol% of the lipid component; the amount of the auxiliary lipid is about 43-55 mol% of the lipid component; and the amount of the PEG lipid is about 2.3-2.7 mol% of the lipid component.

[0331] c. The amount of the amine lipid is about 25-34 mol% of the lipid component; the amount of the neutral lipid is about 10-20 mol% of the lipid component; the amount of the auxiliary lipid is about 45-65 mol% of the lipid component; and the amount of the PEG lipid is about 2.5-3.5 mol% of the lipid component; or

[0332] d. The amount of the amine lipid is about 30-43 mol% of the lipid component; the amount of the neutral lipid is about 10-17 mol% of the lipid component; the amount of the auxiliary lipid is about 43.5-56 mol% of the lipid component; and the amount of the PEG lipid is about 1.5-3 mol% of the lipid component.

[0333] Embodiment 229 is a method or composition as described in any one of Embodiments 21-86 and 104-228, wherein the LNP comprises a lipid component and the lipid component comprises: about 25-50 mol% amine lipids, such as lipid D; about 7-25 mol% neutral lipids; about 39-65 mol% accessory lipids; and about 0.5-1.8 mol% occult lipids (e.g., PEG lipids), and wherein the N / P ratio of the LNP is about 3-7.

[0334] Embodiment 230 is the method or composition as described in Embodiment 229, wherein the amount of the amine lipid is about 30-45 mol% of the lipid component; or about 30-40 mol% of the lipid component; or optionally about 30 mol%, 40 mol%, or 50 mol% of the lipid component.

[0335] Embodiment 231 is the method or composition as described in Embodiments 229 or 230, wherein the amount of the neutral lipid is about 10-20 mol% of the lipid component; or about 10-15 mol% of the lipid component; optionally about 10 mol% or 15 mol% of the lipid component.

[0336] Embodiment 232 is a method or composition as described in any one of Embodiments 229-231, wherein the amount of the auxiliary lipid is about 50-60 mol% of the lipid component; about 39-59 mol% of the lipid component; or about 43.5-59 mol% of the lipid component; optionally about 59 mol% of the lipid component; about 43.5 mol% of the lipid component; or about 39 mol% of the lipid component.

[0337] Embodiment 233 is a method or composition as described in any one of Embodiments 229-232, wherein the amount of said PEG lipid is about 0.9-1.6 mol% of said lipid component; or about 1-1.5 mol% of said lipid component; optionally about 1 mol% of said lipid component or about 1.5 mol% of said lipid component.

[0338] Embodiment 234 is a method or composition as described in any one of embodiments 229-233, wherein:

[0339] a. The amount of the ionizable lipid is about 27-40 mol% of the lipid component; the amount of the neutral lipid is about 10-20 mol% of the lipid component; the amount of the auxiliary lipid is about 50-60 mol% of the lipid component; and the amount of the PEG lipid is about 0.9-1.6 mol% of the lipid component.

[0340] b. The amount of the ionizable lipid is about 30-45 mol% of the lipid component; the amount of the neutral lipid is about 10-15 mol% of the lipid component; the amount of the auxiliary lipid is about 39-59 mol% of the lipid component; and the amount of the PEG lipid is about 1-1.5 mol% of the lipid component.

[0341] c. The amount of the ionizable lipid is about 30 mol% of the lipid component; the amount of the neutral lipid is about 10 mol% of the lipid component; the amount of the auxiliary lipid is about 59 mol% of the lipid component; and the amount of the PEG lipid is about 1 mol% of the lipid component.

[0342] d. The amount of the ionizable lipid is about 40 mol% of the lipid component; the amount of the neutral lipid is about 15 mol% of the lipid component; the amount of the accessory lipid is about 43.5 mol% of the lipid component; and the amount of the PEG lipid is about 1.5 mol% of the lipid component; or

[0343] e. The amount of the ionizable lipid is about 50 mol% of the lipid component; the amount of the neutral lipid is about 10 mol% of the lipid component; the amount of the auxiliary lipid is about 39 mol% of the lipid component; and the amount of the PEG lipid is about 1 mol% of the lipid component.

[0344] Embodiment 235 is a method or composition as described in any one of Embodiments 216-234, wherein the amine lipid is lipid A.

[0345] Embodiment 236 is a method or composition as described in any one of Embodiments 216-234, wherein the amine lipid is lipid D.

[0346] Embodiment 237 is a method or composition as described in any one of Embodiments 221-236, wherein the neutral lipid is DSPC.

[0347] Embodiment 238 is a method or composition as described in any one of Embodiments 222-237, wherein the elusive lipid is PEG-dimyristoylglycerol (PEG-DMG).

[0348] Embodiment 239 is a method or composition as described in any one of Embodiments 218-238, wherein the auxiliary lipid is cholesterol.

[0349] Embodiment 240 is a method or composition as described in any one of Embodiments 21-86 and 104-239, wherein the LNP is pretreated with a serum factor prior to contacting the cells, optionally wherein the serum factor is a primate serum factor or optionally a human serum factor.

[0350] Embodiment 241 is a method or composition as described in any one of Embodiments 21-86 and 104-240, wherein the LNP is pretreated with human serum prior to contact with the cells.

[0351] Embodiment 242 is a method or composition as described in any one of embodiments 21-86 and 104-241, wherein the LNP is pretreated with ApoE prior to contacting the cells, optionally wherein the ApoE is human ApoE.

[0352] Embodiment 243 is a method or composition as described in any one of Embodiments 21-86 and 104-242, wherein the LNP is pretreated with recombinant ApoE3 or ApoE4 prior to contacting the cells, optionally wherein the ApoE3 or ApoE4 is human ApoE3 or ApoE4.

[0353] Embodiment 244 is a cell, wherein the cell is treated in vitro using any one of the methods or compositions described in Embodiments 1-243.

[0354] Embodiment 245 is a cell, wherein the cell is treated in vivo with any one of the methods or compositions described in Embodiments 1-243.

[0355] Implementation scheme 246 is a cell as described in implementation scheme 244 or 245, wherein the cell is a human cell.

[0356] Embodiment 247 is a cell as described in any one of Embodiments 244-246, wherein the cell is selected from: mesenchymal stem cells; hematopoietic stem cells (HSCs); monocytes; endothelial progenitor cells (EPCs); neural stem cells (NSCs); limbic stem cells (LSCs); tissue-specific primary cells or cells derived therefrom (TSCs); induced pluripotent stem cells (iPSCs); ocular stem cells; pluripotent stem cells (PSCs); embryonic stem cells (ESCs); and cells for organ or tissue transplantation, and optionally cells for use in ACT therapy.

[0357] Implementation scheme 248 is a cell as described in any one of implementation schemes 244-247, wherein the cell is an immune cell.

[0358] Implementation scheme 249 is the cell as described in implementation scheme 248, wherein the immune cell is selected from lymphocytes (e.g., T cells, B cells, natural killer cells (“NK cells”, and NKT cells or iNKT cells)), monocytes, macrophages, mast cells, dendritic cells, granule cells (e.g., neutrophils, eosinophils and basophils), primary immune cells, CD3+ cells, CD4+ cells, CD8+ T cells, regulatory T cells (Treg), B cells and dendritic cells (DC)).

[0359] Implementation scheme 250 is the cell as described in implementation scheme 248, wherein the immune cell is selected from peripheral blood mononuclear cells (PBMCs), lymphocytes, T cells, optionally CD4+ cells, CD8+ cells, memory T cells, primary T cells, stem cell memory T cells; or B cells, optionally memory B cells, primary B cells; and primary cells.

[0360] Implementation scheme 251 is a cell as described in implementation scheme 250, wherein the cell is a T cell.

[0361] Implementation scheme 252 is the cell as described in implementation scheme 251, wherein the T cell is selected from tumor-infiltrating lymphocytes (TIL), T cells expressing α-βTCR, T cells expressing γ-δTCR, regulatory T cells (Treg), memory T cells, and early stem cell memory T cells (Tscm, CD27+ / CD45+).

[0362] Embodiment 253 is a cell as described in any one of Embodiments 244-252, wherein the cell is isolated from a human donor PBMC or leukopak prior to editing.

[0363] Implementation scheme 254 is a cell as described in any one of implementation schemes 244-253, wherein the cell is derived from a progenitor cell before editing.

[0364] Embodiment 255 is a cell population comprising the cells described in any one of embodiments 244-254.

[0365] Embodiment 256 is a cell population as described in Embodiment 255, wherein the population comprises edited T cells, and wherein at least 30%, 40%, 50%, 55%, 60%, and 65% of the cells in the population have a memory phenotype (CD27+, CD45RA+).

[0366] Implementation scheme 257 is a cell population as described in implementation scheme 255 or 256, wherein the cells are inactive immune cells.

[0367] Embodiment 258 is a cell population as described in any one of Embodiments 255-257, wherein the cells are activated immune cells.

[0368] Implementation scheme 259 is a cell population as described in any one of implementation schemes 255-258, wherein the cells are T cells and the cells respond to repeated stimuli after editing.

[0369] Implementation scheme 260 is a cell population as described in any one of implementation schemes 255-259, wherein the cells are cultured, expanded or proliferated in vitro.

[0370] Implementation scheme 261 is a cell, cell population or composition as described in any one of implementation schemes 87-260, for the treatment of cancer.

[0371] Implementation Scheme 262: Use of any cell, cell population, or composition as described in any one of Implementation Schemes 87-261 for the preparation of a medicament for the treatment of cancer.

[0372] Implementation scheme 263 is an engineered cell that contains at least three base edits in at least three genomic loci and at least one foreign gene.

[0373] Implementation scheme 264 is a composition comprising:

[0374] a.gRNA comprising a guide sequence selected from the following: i) SEQ ID NO: 251-264; ii) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence selected from SEQ ID NO: 251-264; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NO: 251-264; iv) a sequence comprising 10 adjacent nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 5; v) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence derived from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or

[0375] b. Nucleic acid encoding (a.) gRNA.

[0376] Implementation scheme 265 is a method for altering the DNA sequence within the AAVS1 gene, the method comprising delivering to a cell:

[0377] a.gRNA comprising a guide sequence selected from the following: i) SEQ ID NO: 251-264; ii) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence selected from SEQ ID NO: 251-264; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NO: 251-264; iv) a sequence comprising 10 adjacent nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 5; v) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence derived from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or

[0378] b. Nucleic acid encoding (a.) gRNA.

[0379] Implementation scheme 266 is an immunotherapy method comprising administering to a subject a composition containing engineered cells.

[0380] The cells described herein contain genomic modifications in the AAVS1 gene, wherein the genetic modifications comprise insertions selected from the following genomic coordinates: chr19: 55115695-55115715; chr19: 55115588-55115608; chr19: 55115616-55115636; chr19: 55115623-55115643; chr19: 55115637-55115657; chr19: 55115691-55115711; chr19: 55115755-55115775; chr19: 55115823-55115843; chr 19: 55115834-55115854; chr19: 55115835-55115855; chr19: 55115836-55115856; chr19: 55115850-55115870; chrl9: 55115951-55115971; and chr19: 55115949-55115969; or

[0381] The cells are engineered by delivering the following substances into the cells:

[0382] a.gRNA comprising a guide sequence selected from the following: i) SEQ ID NO: 251-264; ii) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence selected from SEQ ID NO: 251-264; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NO: 251-264; iv) a sequence comprising 10 adjacent nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 5; v) at least 17, 18, 19, or 20 adjacent nucleotides of a sequence derived from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); or

[0383] b. Nucleic acid encoding (a.) gRNA.

[0384] Implementation scheme 267 is an engineered cell that contains a genetic modification of the AAVS1 gene, wherein the genetic modification comprises an insertion selected from the following genomic coordinates: chr19: 55115695-55115715; chr19: 55115588-55115608; chr19: 55115616-55115636; chr19: 55115623-55115643; chr19: 55115637-55115657; chr19: 55115691-5 5115711; chr19: 55115755-55115775; chr19: 55115823-55115843; chr19: 55115834-55115854; chr19: 55115835-55115 855; chr19: 55115836-55115856; chr19: 55115850-55115870; chr19: 55115951-55115971; and chr19: 55115949-55115969.

[0385] Embodiment 268 is a method or composition as described in any one of Embodiments 1, 16, 17, 87, and 101, wherein the first genome editing tool, the second genome editing tool, and the gRNA are collectively contained in the following:

[0386] (a)

[0387] (i) a first lipid nanoparticle (LNP) comprising a uracil glycosidase inhibitor (UGI); (ii) a second LNP comprising the first genome editor or the base editor and comprising a second gRNA; (iii) a third LNP comprising the first genome editor or the base editor and comprising a third gRNA; and (iv) a fourth LNP comprising the first genome editor or the base editor and comprising a fourth gRNA; and

[0388] (b)

[0389] (i) a fifth LNP containing a uracil glycosidase inhibitor (UGI); (ii) a sixth LNP containing a second genome editor and a first gRNA; (iii) a nucleic acid encoding a foreign gene for insertion at the editing site of the first gRNA; (iv) optionally a seventh LNP containing either the first genome editor or the base editor and containing a fifth gRNA; (v) optionally an eighth LNP containing either the first genome editor or the base editor and containing a sixth gRNA; (vi) optionally a ninth LNP containing either the first genome editor or the base editor and containing a seventh gRNA.

[0390] I. Definition

[0391] Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings:

[0392] In this document, “polynucleotide” and “nucleic acid” refer to polymeric compounds containing nucleosides or nucleoside analogs, having nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers as analogs thereof. The nucleic acid “backbone” can consist of a variety of bonds, including one or more of the following, or combinations thereof: sugar-phosphodiester bonds, peptide-nucleic acid bonds (“peptide-nucleic acid” or PNA; PCT WO 95 / 32305), thiophosphate bonds, and methylphosphonate bonds. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or analogous compounds with substitutions (e.g., 2′methoxy, 2′halide, or 2′-O-(2-methoxyethyl)(2′-O-moe) substitution). Nitrogenous bases can be conventional bases (A, G, C, T, U), their analogues (e.g., modified uridines, such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or other uridines); inosine; purine or pyrimidine derivatives (e.g., N... 4 -Methyldeoxyguanosine, desaturated purine or azapurine, desaturated pyrimidine or azapurine, pyrimidine bases with substituents at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with substituents at the 2, 6 or 8 position, 2-amino-6-methylaminopurine, O 6 -Methylguanine, 4-thiopyrimidine, 4-aminopyrimidine, 4-dimethylhydrazine-pyrimidine and O 4-alkyl-pyrimidine; U.S. Patent No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion, see The Biochemistry of the Nucleic Acids 5-36, edited by Adams et al., 11th edition, 1992. Nucleic acids may include one or more “base-free” residues in which the backbone does not include nitrogenous bases at polymer positions (U.S. Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may include conventional components and substitutions for both (e.g., conventional bases with 2′ methoxy linkages, or polymers containing conventional bases and one or more base analogs). Nucleic acids include “locked nucleic acids” (LNAs), which are analogs containing one or more LNA nucleotide monomers with bicyclic furanose units locked in a sugar conformation mimicking RNA, which enhances hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42): 13233-41). Nucleic acids include "unlocking nucleic acids," which enable the regulation of thermodynamic stability and also provide stability for nucleases. RNA and DNA have different sugar moieties and can differ due to the presence of uracil or its analogues in RNA and thymine or its analogues in DNA.

[0393] As used in this article, "peptide" refers to a multimeric compound containing amino acid residues, which can have a three-dimensional conformation. Peptides include (but are not limited to) enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid-binding proteins, antibodies, etc. Peptides may (but do not necessarily) contain post-translational modifications, non-natural amino acids, prosthetic groups, etc.

[0394] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA along with an RNA-guided DNA binder, such as a Cas nuclease, such as a Cas lyase, a Cas nickase, or a dCas DNA binder (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA binder (e.g., Cas9) to a target sequence, and the guide RNA hybridizes to the target sequence and the binder binds to the target sequence; in the case where the binder is a lyase or a nickase, cleavage or nicking can occur after binding.

[0395] As used herein, “RNA-guided DNA binder” means a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the presence of a PAM and the sequence of the guide RNA. Exemplary RNA-guided DNA binders include Cas lysins / nicking enzymes and their inactivated forms (“dCas DNA binders”). As used herein, “Cas nuclease” is also referred to as “Cas protein” and encompasses Cas lysins, Cas nicking enzymes, and dCas DNA binders. Cas lysins / nicking enzymes and dCas DNA binders include the Csm or Cmr complex of the type III CRISPR system, its Cas10, Csm1, or Cmr2 subunits, the cascade complex of the type I CRISPR system, its Cas3 subunit, and class II Cas nucleases. As used herein, “class II Cas nuclease” is a single-stranded polypeptide having RNA-guided DNA binding activity. Class 2 Cas nucleases include two classes of Cas lysin / nicking enzymes (e.g., H840A, D10A, or N863A variants) that further possess RNA-guided DNA lysin or nicking enzyme activity; and two classes of dCas DNA binders in which the lysin / nicking enzyme activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants) and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and their modified forms. The Cpf1 protein (Zetsche et al., Cell, 163: 1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. Zetsche's Cpf1 sequence is incorporated in its entirety by reference. See, for example, Zetsche, Tables S1 and S3. See, for example, Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60: 385-397 (2015).

[0396] As used herein, the term "genome editor" or "editor" refers to a substance containing a polypeptide capable of modifying a nucleic acid sequence (e.g., DNA or RNA). In some embodiments, the editor is a lysin, such as Cas9 lysin. In some embodiments, the editor is capable of deaminating bases within nucleic acids and may be referred to as a base editor. In some embodiments, the editor is capable of deaminating bases within DNA molecules. In some embodiments, the editor is capable of deaminating cytosine (C) in DNA. In some embodiments, the editor is a fusion protein containing an RNA-guided nickase fused to a cytidine deaminase domain. In some embodiments, the editor is a combination of an RNA-guided nickase and a cytidine deaminase domain. In some embodiments, the editor is a fusion protein containing an RNA-guided nickase fused to APOBEC3A deaminase (A3A). In some embodiments, the editor contains a Cas9 nickase fused to APOBEC3A deaminase (A3A). In some embodiments, the editor is a fusion protein comprising an enzyme-inactive RNA-guided DNA-binding protein fused to a cytidine deaminase domain. In some embodiments, the editor is a nicking enzyme fused to DNA polymerase.

[0397] As used herein, the term "genome editing tool" refers to a substance comprising a genome editor and at least one guide RNA homologous to a nuclease or nickase component of the genome editor.

[0398] A genome editor may, for example, include a C-to-T base editor and may or may not include a uracil glycosidase inhibitor (UGI). A genome editor may, for example, include a cytidine deaminase, an RNA-guided nickase, and a UGI, wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in a single polypeptide; wherein the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in different polypeptides; or wherein the deaminase and the RNA-guided nickase are contained in a single polypeptide, and the UGI is contained in different polypeptides. In some embodiments, the deaminase comprises cytidine deaminase.

[0399] As used herein, the term "orthogonal" refers to any two genome editors (e.g., base editors, nucleases, nickases, or lyases) where each can recognize its own target via its homologous guide RNA, but is incompatible with guide RNA homologous to another genome editor; for example, each cannot recognize the target of another genome editor via guide RNA homologous to another genome editor. For instance, the Neisseria meningitidis Cas9 (NmeCas9) nickase may be able to recognize a genomic locus via guide RNA homologous to the NmeCas9 nickase, and the Streptococcus pyogenes Cas9 (SpyCas9) lyase may be able to recognize another genomic locus via guide RNA homologous to the SpyCas9 lyase. In this example, the NmeCas9 nickase and the SpyCas9 lyase are orthogonal to each other. Genome editors or genome editing components can be engineered to be orthogonal. Although in this example, the NmeCas9 nickase and the SpyCas9 lyase originate from different organisms, two genome editors do not need to originate from different organisms to be orthogonal to each other.

[0400] As used herein, “cytidine deaminase” refers to a polypeptide or polypeptide complex that possesses cytidine deaminase activity, catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically producing uridine or deoxyuridine. Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and specifically, enzymes of the APOBEC family (enzymes of the APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (e.g., see Conticello et al., Mol. Biol. Evol. 22: 367-77, 2005; Conticello, Genome Biol. 9: 229, 2008; Muramatsu et al., J. Biol. Chem. 274: 18470-6, 1999; Carrington et al., Cells 9: 1690 (2020)). In some embodiments, variants of any known cytidine deaminase or APOBEC protein are included. Variants include proteins having sequences that differ from wild-type proteins due to one or more mutations (i.e., substitution, deletion, insertion, such as one or more single-point substitutions). For example, shortened sequences may be used, such as by deleting the N-terminus, C-terminus, or internal amino acids, preferably deleting one to four amino acids from the C-terminus. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial mutants that are homologous to the reference sequence. Variants are "functional" because they exhibit catalytic activity for DNA editing.

[0401] As used herein, the term "APOBEC3A" refers to a cytidine deaminase, such as a protein expressed by the human A3A gene. APOBEC3A may possess catalytic DNA editing activity. The amino acid sequence of APOBEC3A has been elucidated (UniPROT accession ID: p31941) and is included herein as SEQ ID NO: 22. In some embodiments, the APOBEC3A protein is the human APOBEC3A protein or a wild-type protein. Variants include proteins having sequences that differ from the wild-type APOBEC3A protein due to one or more mutations (i.e., substitution, deletion, insertion, such as one or more single-point substitutions). For example, a shortened APOBEC3A sequence may be used, for example by deleting one to four amino acids from the N-terminus, C-terminus, or internal amino acids, preferably deleting one to four amino acids from the C-terminus. As used herein, the term "variant" refers to an allelic variant, splicing variant, and natural or artificial mutant homologous to the APOBEC3A reference sequence. Variants are "functional" because they exhibit catalytic activity for DNA editing. In some embodiments, APOBEC3A (e.g., human APOBEC3A) has a wild-type amino acid at position 57 (as numbered in the wild-type sequence). In some embodiments, APOBEC3A (e.g., human APOBEC3A) has asparagine at position 57 (as numbered in the wild-type sequence).

[0402] As used herein, a “nicking enzyme” is an enzyme that produces single-strand breaks (also called “nicks”) in double-stranded DNA (i.e., cuts one strand of the DNA double helix but not the other). As used herein, “RNA-guided nicking enzyme” means a polypeptide or polypeptide complex having DNA nicking enzyme activity, wherein the DNA nicking enzyme activity is sequence-specific and depends on the RNA sequence. Exemplary RNA-guided nicking enzymes include Cas nicking enzymes. Cas nicking enzymes include (but are not limited to) nicking enzyme forms of the Csm or Cmr complexes of type III CRISPR systems, their Cas10, Csm1, or Cmr2 subunits, cascade complexes of type I CRISPR systems, their Cas3 subunits, and class 2 Cas nucleases. Class 2 Cas nicking enzymes include polypeptides with inactivated HNH or RuvC catalytic domains, such as Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9 or D16A variant of NmeCas9). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain or RuvC or RuvC-like domain of Neisseria meningitidis include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase). Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and their modified forms. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like protein domain. Zetsche's Cpf1 sequence is incorporated in its entirety by reference. See, for example, Zetsche, Tables S1 and S3. "Cas9" encompasses Streptococcus pyogenes (Spy) Cas9, the Cas9 variants listed herein, and their equivalents. See, for example, Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60: 385-397 (2015).

[0403] As used herein, the term "fusion protein" refers to a hybrid polypeptide comprising polypeptides derived from at least two different proteins or sources. One polypeptide may be located at the N-terminal (N-terminal) portion of the fusion protein or at the C-terminal (C-terminal) portion, thereby forming an "N-terminal fusion protein" or a "C-terminal fusion protein," respectively. Any protein presented herein can be produced by any method known in the art. For example, the proteins presented herein can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods for the expression and purification of recombinant proteins are well known and include those described in Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0404] As used herein, the term "connector" refers to a chemical group or molecule that links two adjacent molecules or portions. Typically, a connector is located between, or flanking, two groups, molecules, or other portions and is covalently linked to each other. In some embodiments, the connector is one or more amino acids (e.g., peptides or proteins), such as the 16-amino acid residue "XTEN" connector or a variant thereof (e.g., see Examples; and Schellenberger et al., Arecombinantpolypeptide extends the in vivo half-life of peptides and proteins in an atunab1e manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN connector comprises the sequence SGSETPGTSE SATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27). In some embodiments, the connector comprises one or more sequences selected from SEQ ID NO: 25-39 and 72-133.

[0405] As used herein, the terms “uracil glycosidase inhibitor,” “uracil-DNA glycosidase inhibitor,” or “UGI” refer to proteins that inhibit the uracil-DNA glycosidase (UDG) base excision repair enzyme (e.g., UniPROT ID: P14739; SEQ ID NO: 15; SEQ ID NO: 24).

[0406] As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces the transport of molecules containing or linked to such sequences to the nucleus of a eukaryotic cell. The nuclear localization signal can form part of the molecule to be transported. In some embodiments, the NLS may fuse with the molecule via covalent bonds, hydrogen bonds, or ionic interactions. In some embodiments, the NLS may fuse with the molecule via a linker.

[0407] As used herein, a gene's "open reading frame" or "ORF" refers to a sequence of codons that specify the amino acid sequence of the protein encoded by the gene. An ORF typically begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon (e.g., TAA, TAG, or TGA in DNA, or UAA, UAG, or UGA in RNA).

[0408] The terms “guide RNA,” “gRNA,” and “guide” are used interchangeably in this article to refer to crRNA (also known as CRISPRRNA) or a combination of crRNA and trRNA (also known as tracrRNA). crRNA and trRNA can associate to form a single RNA molecule (single guide RNA, sgRNA) or two separate RNA molecules (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to each type. trRNA can be a naturally occurring sequence or a modified or altered trRNA sequence compared to a naturally occurring sequence.

[0409] As used herein, "guide sequence," "guide region," "target sequence," "spacer," or "spacer sequence" refers to a sequence within the gRNA that is complementary to the target sequence and is used to guide the gRNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided nicking enzyme. Guide sequences can be 20 nucleotides long, for example in the case of *Streptococcus pyogenes* (i.e., Spy Cas9 (also known as SpCas9)) and related Cas9 homologs / orthologs. Shorter or longer sequences can also be used as guides, for example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. Guide sequences can also be 20-25 nucleotides long, for example, in the case of Nme Cas9, for example, 20, 21, 22, 23, 24, or 25 nucleotides in length. For example, a 24-nucleotide guide sequence can be used with Nme Cas9 (e.g., Nme2 Cas9).

[0410] In some embodiments, the target sequence is located, for example, at a genomic locus or on a chromosome, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, wherein the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and the target region may contain 1-4 mismatches, wherein the guide sequence contains at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches, wherein the guide sequence contains 20 nucleotides. In some embodiments, for example when the guide sequence comprises a sequence of 24 adjacent nucleotides, the complementarity or identity between the guide sequence and its corresponding target sequence is at least 80%, 85%, 90%, or 95%. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., a non-identical or non-complementary nucleotide, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1-2, preferably no more than 1, mismatch, wherein the total length of the target sequence is 19, 20, 21, 22, 23, or 24 or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches, wherein the guide sequence comprises at least 24 or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches, wherein the guide sequence comprises 24 nucleotides.

[0411] As used herein, a "target sequence" or "genomic target sequence" refers to a nucleic acid sequence in the target genomic locus on the positive or negative strand that is complementary to the guide sequence of the gRNA, i.e., sufficiently complementary to the guide sequence of the gRNA to allow the guide sequence to bind specifically to the target sequence. The interaction between the target sequence and the guide sequence guides an RNA-guided DNA binder to bind to and potentially cleave or break down (depending on the activity of the binder) the target sequence. The specific length of the target sequence and the possible number of mismatches between the target sequence and the guide sequence depend on, for example, the identity of the Cas9 nuclease guided by the gRNA. The target sequence of a Cas protein includes both the positive and negative strands of genomic DNA (i.e., a given sequence and its inverse complement), because the nucleic acid substrate of the Cas protein is a double-stranded nucleic acid. Therefore, in the case where the guide sequence is referred to as "complementary to the target sequence," it should be understood that the guide sequence can guide an RNA-guided DNA binder (e.g., dCas9 or damaged Cas9) to bind to the inverse complement of the target sequence. Therefore, in some embodiments, where the guide sequence binds to the inverse complementary sequence of the target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., a target sequence excluding PAM), except that U is used to replace T in the guide sequence.

[0412] As used herein, a first sequence is considered to "contain a sequence with at least X% identity to the second sequence" if an alignment of the first and second sequences shows that X% or more positions in the entire second sequence match the first sequence. For example, the sequence AAGA contains a sequence with 100% identity to the sequence AAG because the alignment will result in 100% identity since it matches all three positions in the second sequence. Differences between RNA and DNA (often exchanging uridine for thymidine, or vice versa) and the presence of nucleoside analogs (e.g., modified uridine) do not cause differences in identity or complementarity in polynucleotides, as long as the relevant nucleotides (e.g., thymidine, uridine, or modified uridine) have the same complementary sequence (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which use guanosine as the complementary sequence). Therefore, for example, the sequence 5′-AXG (where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered 100% identical to AUG because both are perfectly complementary to the same sequence (5′-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand which algorithms and parameter settings are suitable for a given sequence pair to be aligned; for sequences that are generally of similar length and expected identity (>50% for amino acids or >75% for nucleotides), the Needleman-Wunsch algorithm with its default settings provided by EBI on the www.ebi.ac.uk web server is generally appropriate.

[0413] In this document, “mRNA” refers to a polynucleotide that is not DNA and contains an open reading frame (which can be used as a translation substrate for ribosomes and aminoacylated tRNA). mRNA may contain one or more modifications, such as those described below. Generally, mRNA does not contain substantial amounts of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1% thymidine content). mRNA may contain modified uridine at some or all of its uridine sites.

[0414] "Modified uridine" is used herein to refer to a nucleoside, other than thymidine, that has the same hydrogen bond acceptor as uridine and has one or more structural differences from uridine. In some embodiments, modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy groups, such as methoxy groups) replace a proton. In some embodiments, modified uridine is a pseudouridine. In some embodiments, modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl groups, such as methyl groups) replace a proton. In some embodiments, modified uridine is any one of substituted uridine, pseudouridine, or substituted pseudouridine.

[0415] As used herein, "uridine position" refers to a position in a polynucleotide occupied by uridine or a modified uridine. Therefore, for example, a polynucleotide that is "100% uridine-positioned" contains modified uridine at every position in a standard RNA sequence of the same sequence (where all bases are standard A, U, C, or G bases) where uridine should be present. Unless otherwise indicated, the U in a polynucleotide sequence in this disclosure or in the sequence listing or sequence listing accompanying this disclosure may be uridine or a modified uridine.

[0416] As used herein, the “minimum uridine codon” for a given amino acid is the codon with the fewest uridines (usually 0 or 1, except for the codon for phenylalanine, whose minimum uridine codon has 2 uridines). For the purpose of evaluating uridine content, modified uridine residues are considered equivalent to uridine.

[0417] As used herein, the “uridine dinucleotide (UU) content” of an ORF can be expressed in absolute terms as the UU dinucleotides listed in the ORF, or as a percentage of positions occupied by uridine dinucleotides (e.g., AUUAU has a 40% uridine dinucleotide content because 2 out of 5 positions are occupied by uridine dinucleotides). For the purpose of evaluating uridine dinucleotide content, modified uridine residues are considered equivalent to uridine.

[0418] As used herein, the “minimum adenine codon” for a given amino acid is the codon with the fewest adenine residues (usually 0 or 1, except for the codons for lysine and asparagine, whose minimum adenine codons have 2 adenine residues). For the purpose of evaluating adenine content, modified adenine residues are considered equivalent to adenine.

[0419] As used herein, the "adenine dinucleotide content" of an ORF can be expressed in absolute terms as the listed AA dinucleotides in the ORF, or as a percentage of positions occupied by adenine dinucleotides (e.g., UAAUA has a 40% adenine dinucleotide content because 2 out of 5 positions are occupied by adenine dinucleotides). For the purpose of evaluating adenine dinucleotide content, modified adenine residues are considered equivalent to adenine.

[0420] As used herein, the term "genomic locus," when used in the context of a genomic locus targeted by a guide RNA, includes one or more portions of the genome that are targeted to influence the expression of genes associated with said locus. For example, a genomic locus may include coding sequences of genes, intronic sequences of genes, regulatory sequences, transcriptional control sequences of genes, translational control sequences of genes, splicing sites, or non-coding sequences between genes (e.g., intergenetic spaces).

[0421] As used herein, the term "contact" means providing at least one component such that the component physically contacts a cell, including physical contact with the cell surface, cytoplasm, and / or nucleus. "Contacting" a cell with a polypeptide encompasses, for example, contacting the cell with a nucleic acid encoding the polypeptide and allowing the cell to express the polypeptide.

[0422] As used herein, the term "simultaneously" when used in the context of contacting a cell with at least two genome editing tools (e.g., compositions, peptides, nucleic acids, or combinations thereof) means that the contact between the cell and one of the at least two genome editing tools occurs no more than 48 hours after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools occurs no more than 36 hours after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools occurs no more than 24 hours after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools occurs no more than 18 hours after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools occurs no more than 12 hours after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools occurs no more than 6 hours after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 4 hours after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 3 hours after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 2 hours after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 1 hour after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 30 minutes after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 15 minutes after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of at least two genome editing tools is no more than 10 minutes after the contact between the cell and the other of at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools occurs no more than 5 minutes after the contact between the cell and the other of the at least two genome editing tools. In some embodiments, the contact between the cell and one of the at least two genome editing tools and the contact between the cell and the other of the at least two genome editing tools occur simultaneously. In some embodiments, the two genome editing tools are premixed before contacting the cell.

[0423] As used herein, “insertion / deletion” refers to an insertion or deletion mutation consisting of multiple nucleotides that are inserted, deleted, or both inserted and deleted in a target nucleic acid, such as at a double-strand break (DSB) site. As used herein, when an insertion / deletion results in an insertion, the insertion is a random insertion at a DSB site and is generally not guided by or based on a template sequence.

[0424] As used herein, “knockdown” refers to a reduction in the expression of a specific gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured by detecting the amount of protein secreted by a tissue or cell population (e.g., in serum or cell culture medium) or by detecting the total cellular amount of protein from the tissue or cell population of interest. Methods for measuring mRNA knockdown are known and involve sequencing mRNA isolated from the tissue or cell population of interest. In some embodiments, “knockdown” may refer to a certain loss of expression of a specific gene product, such as a reduction in the amount of transcribed mRNA or a reduction in the amount of protein expressed or secreted by a cell population (including in vivo populations, such as those found in tissues).

[0425] As used herein, “knockout” refers to the loss of expression of a specific protein in cells. Knockout can be measured by detecting the amount of protein secreted from a tissue or cell population (e.g., in serum or cell culture medium) or by detecting the total cellular amount of protein in a tissue or cell population. In some embodiments, the methods of this disclosure “knock out” a target protein in one or more cells (e.g., cell populations, including in vivo populations, such as those found in tissues). In some embodiments, knockout is not the formation of a mutant of the target protein (e.g., generated by insertion / deletion), but rather the complete loss of expression of the target protein in cells, even if the expression is reduced to below the detection level used for assay.

[0426] As used herein, "a cell population containing edited cells" or "a group of cells containing edited cells" refers to a cell population containing edited cells; however, not all cells in the population must be edited. A cell population containing edited cells may also include unedited cells. The percentage of edited cells in a cell population containing edited cells can be determined by counting the edited cells in the population, as determined by standard cell counting methods. For example, in some embodiments, at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the cells in a cell population containing edited cells with a single genome edit will have a single edit. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the cells in a cell population containing edited cells with at least two genome edits will have at least two genome edits.

[0427] As used herein, “β2M” or “B2M” refers to the nucleic acid or protein sequence of “β-2 microglobulin”; the Human Genome Project has accession number NC_000015 (range 44711492..44718877), see GRCh38.p13. B2M protein associates with MHC class I molecules as a heterodimer on the surface of nucleated cells and is essential for the expression of MHC class I proteins.

[0428] As used herein, “CIITA” or “C2TA” refers to the nucleic acid or protein sequence of “trans-activator of MHC class II major histocompatibility complex”; the Human Genome Project has accession number NC_000016.10 (range 10866208..10941562), see GRCh38.p13. The CIITA protein in the cell nucleus acts as a positive regulator of MHC class II gene transcription and is essential for the expression of MHC class II proteins.

[0429] As used herein, “MHC” or “MHC molecule” or “MHC protein” or “MHC complex” refers to one or more major histocompatibility complex molecules, including, for example, MHC class I and MHC class II molecules. In humans, MHC molecules are referred to as “human leukocyte antigen” complexes or “HLA molecules” or “HLA proteins.” The use of the terms “MHC” and “HLA” is not intended to be restrictive; as used herein, the term “MHC” can be used to refer to human MHC molecules, i.e., HLA molecules. Therefore, the terms “MHC” and “HLA” are used interchangeably herein.

[0430] As used in the context of HLA-A proteins, the term "HLA-A" refers to an MHC class I protein molecule, which is a heterodimer composed of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., β-2 microglobulin). As used in the context of nucleic acids, the term "HLA-A" or "HLA-A gene" refers to the gene encoding the heavy chain of the HLA-A protein molecule. The HLA-A gene is also known as "HLA class I histocompatibility, Aα chain"; the Human Genome Project accession number is NC_000006.12 (29942532..29945870). The HLA-A gene is known to exist in thousands of different forms (also called "alleles") in the population (and individuals may receive two different alleles of the HLA-A gene). Public databases of HLA-A alleles (including sequence information) are available at IPD-IMGT / HLA: https: / / www.ebi.ac.uk / ipd / imgt / hla / . The terms “HLA-A” and “HLA-A gene” encompass all alleles of HLA-A.

[0431] In the context of nucleic acids, "HLA-B" as used in this article refers to the gene encoding the heavy chain of the HLA-B protein molecule. HLA-B is also known as "HLAI class histocompatibility, Bα chain"; the Human Genome Project has accession number NC_000006.12 (31353875..31357179).

[0432] In the context of nucleic acids, "HLA-C" as used in this article refers to the gene encoding the heavy chain of the HLA-C protein molecule. HLA-C is also known as "HLA class I histocompatibility, Cα chain"; the Human Genome Project has accession number NC_000006.12 (31268749..31272092).

[0433] In the context of nucleic acids, “TRBC1” and “TRBC2” refer to two homologous genes encoding the β-chain of the T-cell receptor. “TRBC” or “TRBC1 / 2” are used in this document to refer to TRBC1 and TRBC2. The human wild-type TRBC1 sequence is available at NCBI Gene ID: 28639; Ensembl: ENSG00000211751. The T-cell receptor β constant V region translation product, BV05S1J2.2, TCRBCl, and TCRB are genetic synonyms for TRBC1. The human wild-type TRBC2 sequence is available at NCBI Gene ID: 28638; Ensembl: ENSG00000211772. The T-cell receptor β constant V region translation product and TCRBC2 are genetic synonyms for TRBC2.

[0434] "TRAC" refers to the nucleic acid or amino acid sequence of the "T cell receptor α chain". The human wild-type TRAC sequence is available at NCBI Gene ID: 28755; Ensembl: ENSG00000277734. T cell receptor α constant, TCRA, IMD7, TRCA, and TRA are genetic synonyms for TRAC.

[0435] "TRBC" refers to the nucleic acid or amino acid sequence of the "T cell receptor β-chain," such as TRBC1 and TRBC2. "TRBC1" and "TRBC2" are two homologous genes encoding the T cell receptor β-chain, which are the gene products of the TRBC1 or TRBC2 genes.

[0436] The human wild-type TRBC1 sequence is available at NCBI Gene ID: 28639; Ensembl: ENSG00000211751. The translation product of the T cell receptor β constant V region, BV05S1J2.2, TCRBC1, and TCRB are genetic synonyms for TRBC1.

[0437] The human wild-type TRBC2 sequence is available at NCBI Gene ID: 28638; Ensembl: ENSG00000211772. The translation product of the T cell receptor β constant V region and TCRBC2 are genetic synonyms for TRBC2.

[0438] As used in this article, the term "homozygote" refers to two identical alleles that share a specific gene.

[0439] As used herein, “treatment” means any administration or application of a therapeutic agent to a subject’s disease or condition, and includes suppressing the disease, preventing its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including recurrence of symptoms.

[0440] As used herein, “delivery” and “application” are used interchangeably and include both ex vivo and in vivo application.

[0441] As used herein, co-application means the administration of multiple substances together in sufficiently close proximity so that the agents work together. Co-application encompasses both the administration of substances together in a single formulation and the administration of substances in separate formulations in sufficiently close proximity so that the agents work together.

[0442] As used herein, the phrase "pharmaceutically acceptable" means that it can be used to prepare pharmaceutical compositions that are generally non-toxic and not biologically undesirable, and is otherwise not unacceptable for pharmaceutical use. Pharmaceutically acceptable typically refers to nonpyrogenic substances. Pharmaceutically acceptable can also refer to sterile substances, especially pharmaceutical substances intended for injection or infusion.

[0443] As used herein, “subject” means any member of the animal kingdom. In some embodiments, “subject” means human. In some embodiments, “subject” means non-human animal. In some embodiments, “subject” means primate. In some embodiments, the subject includes (but is not limited to) mammals, birds, reptiles, amphibians, fish, insects, or worms. In some embodiments, non-human subjects are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, or pigs). In some embodiments, the subject may be a transgenic animal, a genetically engineered animal, or a clone. In some embodiments of the invention, the subject is an adult, adolescent, or infant. In some embodiments, the terms “individual” or “patient” are used and are intended to be used interchangeably with “subject.”

[0444] As used herein, “reduced or eliminated” expression of a protein on a cell refers to the partial or complete loss of protein expression relative to unmodified cells. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry, and “reduced or eliminated” surface expression relative to unmodified cells is demonstrated by a reduction in fluorescence signal when stained with the same antibody targeting the protein. Cells exhibiting “reduced or eliminated” protein surface expression relative to unmodified cells by flow cytometry may be described as having “negative” expression of the protein, as demonstrated by a fluorescence signal similar to that of cells stained with an isotype control antibody. “Reduced or eliminated” protein expression can be measured using other techniques known in the art, utilizing appropriate controls known to those skilled in the art. As used herein, “elimination” of expression should be understood as a reduction in expression below the protein detection level by the method used.

[0445] The terms “about” or “approximately” mean an acceptable error in a particular value as determined by a person skilled in the art (which depends in part on the method of measurement or determination of said value), or a degree of variation that substantially does not affect the nature of the subject matter (e.g., within 10%, 5%, 2%, or 1%, or within two standard deviations of a set of values). Therefore, unless the contrary is indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values, which may vary depending on the desired properties sought to be obtained. To a minimum, and not as an attempt to limit the application of equivalents to the scope of the claims, each numerical parameter should be interpreted at least based on the reported significant figures and by applying common rounding techniques.

[0446] Certain embodiments of the invention will now be described in detail with reference to the accompanying drawings, illustrating examples of these embodiments. Although the invention will be described in conjunction with the illustrated embodiments, it should be understood that these embodiments are not intended to limit the invention to those embodiments. Rather, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the invention as defined by the appended claims and the included embodiments.

[0447] Before detailing the teachings of this invention, it should be understood that this disclosure is not limited to specific compositions or process steps, as such elements can vary. It should be noted that, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “described” as used in this specification and the appended claims include multiple indicators. Thus, for example, a reference to “conjugate” includes multiple conjugates, and a reference to “cell” includes multiple cells, and so on.

[0448] Numerical ranges include numerical values ​​that define the range. Measured and measurable values ​​should be understood as approximate values, taking into account significant figures and measurement-related errors. Similarly, the use of terms such as "comprise," "comprises," "comprising," "contain," "contains," and "including" is not intended to be restrictive. It should be understood that both the foregoing general descriptions and detailed descriptions are exemplary and interpretive only, and do not limit the teaching content.

[0449] Unless expressly stated in this specification, embodiments in this specification that "comprise" various components are also to be considered as "consisting of the listed components" or "consisting substantially of the listed components"; embodiments in this specification that "comprise various components" are also to be considered as "comprising the listed components" or "consisting substantially of the listed components"; and embodiments in this specification that "consisting substantially of various components" are also to be considered as "comprising the listed components" or "comprising the listed components" (this interchangeability does not apply to the use of these terms in the claims).

[0450] Unless the context clearly indicates otherwise, the term "or" is used in an inclusive sense, that is, equivalent to "and / or".

[0451] The section headings used herein are for organizational purposes only and should not be construed as limiting the intended subject matter in any way. In the event of any conflict between any material incorporated by reference and any terminology defined herein or any other expression herein, this specification shall prevail. Although the teachings of this invention are set forth in conjunction with various embodiments, they are not intended to limit the teachings to such embodiments. Rather, as those skilled in the art will understand, the teachings of this invention encompass various alternatives, modifications, and equivalents.

[0452] II. First Genome Editing Tools

[0453] In some embodiments, the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the first genome editor. In some embodiments, the first genome editing tool comprises a first genome editor containing a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the base editor.

[0454] In some embodiments, the first genome editor is delivered to the cell as at least one polypeptide or at least one mRNA. In some embodiments, the first genome editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the first genome editor comprises a lyase, a nicking enzyme, a non-catalytically active nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nicking enzyme.

[0455] In some embodiments, the first genome editor comprises a Cas nuclease. In some embodiments, the Cas nuclease is Cas9. In some embodiments, the Cas9 is *Streptococcus pyogenes* Cas9 (SpyCas9), *Staphylococcus aureus* Cas9 (SauCas9), *Corynebacterium diphtheriae* Cas9 (CdiCas9), *Streptococcus thermophilus* Cas9 (StlCas9), *Vibrio celluloseis* Cas9 (AceCas9), *Campylobacter jejuni* Cas9 (CjeCas9), *Rhodopseudomonas palustris* Cas9 (RpaCas9), *Rhodospirillum rubrum* Cas9 (RruCas9), *Actinomyces necrophora* Cas9 (AnaCas9), *Francisella foetida* Cas9 (FnoCas9), or *Neisseria meningitidis* (NmeCas9). In some embodiments, the Cas9 is NmelCas9, Nme2Cas9, Nme3Cas9, or SpyCas9. In some embodiments, the Cas nuclease is a class 2 Cas nuclease. In some embodiments, the Cas nuclease is Cas12. In some embodiments, the Cas12 is *Lachnospiraceae bacterium* Cas12a (LbCas12a) or *Acidaminococcus sp.* Cas12a (AsCas12a). In some embodiments, the Cas nuclease is *Eubacterium siraeum* Cas13d (EsCas13d).

[0456] In some embodiments, the first genome editor or the base editor comprises a cytidine deaminase (e.g., A3A). In some embodiments, the first genome editor or the base editor comprises a cytidine deaminase (including any of the cytidine deaminases disclosed herein, such as A3A) and an RNA-guided nicking enzyme (including any of the RNA-guided nicking enzymes disclosed herein). In some embodiments, the base editor is a C-to-T base editor, optionally comprising a cytidine deaminase, or an A-to-G base editor, optionally comprising adenosine deaminase.

[0457] In some implementations, the first genome editing tool may be combined with any of the second genome editing tools disclosed herein.

[0458] A.UGI

[0459] In some embodiments, the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI and the base editor are contained in a single polypeptide. In some embodiments, the first genome editing tool comprises a UGI, and the UGI and the base editor are contained in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are contained in a single polypeptide, and the UGI is contained in a different polypeptide.

[0460] Unbound by any theoretical constraints, providing UGI and peptides containing deaminases can facilitate the methods described herein by inhibiting cellular DNA repair mechanisms (such as UDG and downstream repair effectors) that recognize uracil in DNA as a form of DNA damage or otherwise excise or modify uracil and / or surrounding nucleotides. It should be understood that using UGI can increase the editing efficiency of enzymes capable of deaminating C residues.

[0461] This article provides suitable UGI protein and nucleotide sequences, and other suitable UGI sequences are known to those skilled in the art, including those published in, for example, the following: Wang et al., Uracil-DNA glycosylase inhibitor gene of bacteriophage PBS2 encodes a binding protein specific for uracil-DNA glycosylase. J. Biol. Chem. 264: 1163-1171 (1989); Lundquist et al., Site-directed mutagenesis and characterization of uracil-DNA glycosylase inhibitor protein. Role of specific carboxylic amino acids in complex formation with Escherichia coli uracil-DNA glycosylase. J. Biol. Chem. 272: 21408-21419 (1997); Ravishankar et al., X-ray analysis of a complex of Escherichia coli uracil DNA glycosylase (EcUDG) with a proteinaceous inhibitor. The structure elucidation ofa prokaryotic UDG. Nucleic Acids Res. 26: 4880-4887 (1998); and Putnam et al., Proteinmimicry of DNA from crystal structures of the uracil-DNA glycosylase inhibitor protein and its complex with Escherichia coliuracil-DNA glycosylase. J. Mol. Biol. 287: 331-346 (1999), the entire contents of each of these references are incorporated herein by reference. It should be understood that any protein capable of inhibiting the uracil-DNA glycosylase base excision repair enzyme is within the scope of this disclosure. Additionally, any protein that blocks or inhibits base excision repair is also within the scope of this disclosure. In some embodiments, the uracil glycosylase inhibitor is a protein that binds to uracil.In some embodiments, the uracil glycosidase inhibitor is a protein that binds to uracil in DNA. In some embodiments, the uracil glycosidase inhibitor is a single-stranded binding protein. In some embodiments, the uracil glycosidase inhibitor is a catalytically inactive uracil DNA-glycosidase protein. In some embodiments, the uracil glycosidase inhibitor is a catalytically inactive uracil DNA-glycosidase protein that does not cleave uracil from DNA. In some embodiments, the uracil glycosidase inhibitor is a catalytically inactive UDG.

[0462] In some embodiments, the uracil glycosidase inhibitor (UGI) disclosed herein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 15 or 24. In some embodiments, any of the aforementioned levels of identity is at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the UGI comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises an amino acid sequence having at least 99% identity with SEQ ID NO: 15 or 24. In some embodiments, the UGI comprises the amino acid sequence of SEQ ID NO: 15 or 24.

[0463] B. Cytidine deaminase

[0464] Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and specifically, enzymes of the APOBEC family (enzymes of the APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (e.g., see Conticello et al., Mol. Biol. Evol. 22: 367-77, 2005; Conticello, Genome Biol. 9: 229, 2008; Muramatsu et al., J. Biol. Chem. 274: 18470-6, 1999); and Carrington et al., Cells 9: 1690 (2020)).

[0465] In some embodiments, the cytidine deaminases disclosed herein are enzymes of the APOBEC family. In some embodiments, the cytidine deaminases disclosed herein are enzymes of the APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups. In some embodiments, the cytidine deaminases disclosed herein are enzymes of the APOBEC3 subgroup. In some embodiments, the cytidine deaminases disclosed herein are APOBEC3A deaminases (A3A).

[0466] In some embodiments, the cytidine deaminase is a cytidine deaminase comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 95%, 98%, 99%, or 100% identity with SEQ ID NO: 22.

[0467] 1. APOBEC3A deaminase

[0468] In some embodiments, the APOBEC3A deaminase (A3A) disclosed herein is human A3A. In some embodiments, the A3A is wild-type A3A.

[0469] In some embodiments, the A3A is an A3A variant. The A3A variant shares homology with wild-type A3A or fragments thereof. In some embodiments, the A3A variant has at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity with wild-type A3A. In some embodiments, the A3A variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid variations compared to wild-type A3A. In some embodiments, the A3A variant comprises a fragment of A3A such that the fragment has at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity with the corresponding fragment of wild-type A3A.

[0470] In some embodiments, the A3A variant is a protein having a sequence that differs from the wild-type A3A protein due to one or more mutations (e.g., substitution, deletion, insertion, one or more single-point substitutions). In some embodiments, a shortened A3A sequence may be used, for example by deleting the N-terminus, C-terminus, or internal amino acids. In some embodiments, a shortened A3A sequence is used, wherein one to four amino acids are deleted at the C-terminus of the sequence. In some embodiments, APOBEC3A (e.g., human APOBEC3A) has 57 wild-type amino acids (as numbered in the wild-type sequence). In some embodiments, APOBEC3A (e.g., human APOBEC3A) has asparagine at amino acid 57 (as numbered in the wild-type sequence).

[0471] In some implementations, the wild-type A3A is human A3A (UniPROT Registry ID: p319411, SEQ ID NO: 22).

[0472] In some embodiments, the A3A disclosed herein comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 22. In some embodiments, the identity level is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the A3A comprises an amino acid sequence having at least 87% identity with SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence having at least 98% identity with SEQ ID NO: 22. In some embodiments, the A3A comprises an amino acid sequence having at least 99% identity with A3A SEQ ID NO: 22. In some embodiments, the A3A comprises the amino acid sequence of SEQ ID NO: 22.

[0473] C. Connector

[0474] In some embodiments, the first genome editor or base editor described herein further includes a linker connecting the deaminase to the RNA-guided nicking enzyme. In some embodiments, the linker is an organic molecule, polymer, or chemical motif. In some embodiments, the linker is a peptide linker. In some embodiments, the nucleic acid encoding a polypeptide comprising the deaminase and the RNA-guided nicking enzyme further includes a sequence encoding the peptide linker. mRNA encoding a deaminase-linker-RNA-guided nicking enzyme fusion protein is provided.

[0475] In some embodiments, the peptide linker is any amino acid segment having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50 or more amino acids.

[0476] In some embodiments, the peptide linker is a 16-residue "XTEN" linker or a variant thereof (e.g., see Schellenberger et al., A recombinant polypeptide extends the in viVo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence of any of the following: SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27). In some embodiments, the XTEN linker consists of the sequence SGSETPGTSESATPES (SEQ ID NO: 25), SGSETPGTSESA (SEQ ID NO: 26), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 27).

[0477] In some embodiments, the peptide linker comprises (GGGGS). n (e.g., SEQ ID NO: 73, 77, 82, 101), (G) n (EAAAK) n (e.g., SEQ ID NO: 74, 80, 128), (GGS) nSGSETPGTSESATPES (SEQ ID NO: 25) motif (e.g., see Guilinger JP, Thompson DB, Liu D R. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 2014; 32(6): 577-82; all of which are incorporated herein by reference) or (XP)n motif (SEQ ID NO: 407), or any combination of these sequences, wherein n is independently an integer between 1 and 30. See WO2015089406, e.g. paragraph

[0012] , the entire contents of which are incorporated herein by reference.

[0478] In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NO: 25-39 and 72-133. In some embodiments, the peptide linker comprises one or more sequences selected from: SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, and SEQ ID NO: 133. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 129.

[0479] D. RNA-guided nickase

[0480] In some embodiments, the RNA-guided nickase disclosed herein is a Cas nickase. In some embodiments, the RNA-guided nickase is derived from a specific Cas nuclease in which its catalytic domain is inactivated. In some embodiments, the RNA-guided nickase is a class 2 Cas nickase, such as a Cas9 nickase or a Cpf1 nickase. In some embodiments, the RNA-guided nickase is a Streptococcus pyogenes Cas9 nickase. In some embodiments, the RNA-guided nickase is a Neisseria meningitidis Cas9 nickase.

[0481] In some embodiments, the RNA-guided nicking enzyme is a modified class 2 Cas protein or a Cas protein derived from a class 2 Cas protein. In some embodiments, the RNA-guided nicking enzyme is a modified Cas protein or a Cas protein derived from a class 2 Cas nuclease (which may be, for example, type II, type V, or type VI Cas nucleases). Class 2 Cas nucleases include, for example, Cas9, Cpf1 (Cas12a), C2c1, C2c2, and C2c3 proteins and their modified forms. Examples of Cas9 nucleases include those Cas9 nucleases of the type II CRISPR system of Streptococcus pyogenes, Staphylococcus aureus, and other prokaryotes (see, for example, the list in the next paragraph), and their modified (e.g., engineered or mutant) forms. See, for example, US2016 / 0312198 A1; US2016 / 0312199 A1, which are incorporated herein by reference in their entirety. Other examples of Cas nucleases include the Csm or Cmr complex of a type III CRISPR system or its Cas10, Csm1, or Cmr2 subunit; and the cascade complex of a type I CRISPR system or its Cas3 subunit. In some embodiments, the Cas nuclease may be derived from a type IIA, type Ib, or type IIIc system. For a discussion of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., NAT. REV. MICROBIOL. 9: 467-477 (2011); Makarova et al., NAT. REV. MICROBIOL. 13: 722-36 (2015); Shmakov et al., MOLECULARCELL. 60: 385-397 (2015).

[0482] The Cas nickase described in this article can be a nickase form of Cas nuclease, derived from (but not limited to) the following species: *Streptococcus pyogenes*, *Streptococcus thermophilus*, *Streptococcus* sp., *Staphylococcus aureus*, *Listeria innocua*, *Lactobacillus gasseri*, *Francisella neoculi*, *Wolinella succinogene*, *Sutterella wadsworthensis*, *Gammaproteobacterium*, *Neisseria meningitidis*, *Campylobacter jejuni*, *Pasteurella multocida*, *Fibrobacter succinogene*, *Rhodospirillum rubrum*, and *Nocardiopsis dassonvillei*. Streptomyces dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogene, Streptomyces pyrochromogene, Streptosporangium roseum, Streptomyces roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales *Plasma bacterium*, *Polaromonas naphthalenivorans*, *Polaromonas sp.*, *Crocosphaera watsonii*, and *Cyanothece sp.*Microcystis aeruginosa, Synechococcus sp., Acetohalobium arbatidum, Ammonifex degensii, Caldicelulosiruptorbecscii, Candidams desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrous thiobacillus *Ferrooxidans*, *Allochromatium vinosum*, *Marinobacter* sp., *Nitrosococcus halophilus*, *Nitrosococcus watsoni*, *Pseudoalteromona shaloplanktis*, *Ktedonobacter racemifer*, *Methanohalobium evestigatum*, *Anabaena variabilis*, *Nodularia spumigena*, *Nostoc* sp., *Arthrospira maxima*, *Arthrospira platensis*, *Arthrospira* sp., *Lyngbya* sp., *Microcoleus chthonoplastes*, *Oscillatoria* sp.), Petrotogamobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacterlari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Aminococcus, Trichophyton ND2006, or Acaryochloris marina.

[0483] In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from *Streptococcus pyogenes*. In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from *Streptococcus thermophilus*. In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from *Neisseria meningitidis*. For example, see WO / 2020081568, which describes the Nme2Cas9 D16A nickase. In some embodiments, the Cas nickase is a nickase form of the Cas9 nuclease from *Staphylococcus aureus*. In some embodiments, the Cas nickase is a nickase form of the Cpf1 nuclease from *Francisella necrophora*. In some embodiments, the Cas nickase is a nickase form of the Cpf1 nuclease from *Aminococcus* spp. In some embodiments, the Cas nickase is a nickase form of the Cpf1 nuclease from *Trichophyton* ND2006. In other embodiments, the Cas nickase is a nickase form of Cpf1 nuclease from the following species: *Francisella tularensis*, *Trichophyton*, *Butyrivibrio proteoclasticus*, *Peregrinibacteria bacterium*, *Parcubacteria bacterium*, *Smithella*, *Acidaminococcus*, *Candidatus Methanoplasma termitum*, *Eubacterium eligens*, *Moraxella bovoculi*, *Leptospira inadai*, *Porphyromonas crevioricanis*, and *Prevotella*. (disiens) or Porphyromonas macacae. In some embodiments, the Cas nickase is a nickase form of Cpf1 nuclease from aminococci or Lachnospiraceae. As discussed elsewhere, the nickase may be derived from (i.e., associated with) a specific Cas nuclease because a nickase is a form of nuclease in which one of its two catalytic domains is inactivated, for example by mutation of active site residues (e.g., D10, H840, or N863 in Spy Cas9) necessary for nucleolysis.Those skilled in the art will be familiar with techniques used to readily identify corresponding residues in other Cas proteins, such as sequence alignment and structure alignment, which are discussed in detail below.

[0484] In other embodiments, the Cas nickase may be associated with a type I CRISPR / Cas system. In some embodiments, the Cas nickase may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nickase may be a Cas3 protein. In some embodiments, the Cas nickase may be derived from a type III CRISPR / Cas system.

[0485] In some embodiments, the Cas nickase is a nickase form of a Cas nuclease or a modified Cas nuclease, wherein the endonuclease active site (e.g.) is inactivated due to one or more alterations (e.g., point mutations) in the catalytic domain. For a discussion of Cas nickases and exemplary catalytic domain alterations, see, for example, U.S. Patent No. 8,889,356.

[0486] The wild-type *Streptococcus pyogenes* Cas9 has two catalytic domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target DNA strand. In some embodiments, the Cas nuclease may contain amino acid substitutions in the RuvC or RuvC-like nuclease domains. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domains include D10A (based on the *Streptococcus pyogenes* Cas9 protein). See, for example, Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may contain amino acid substitutions in the HNH or HNH-like nuclease domains. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domains include E762A, H840A, N863A, H983A, and D986A (based on the *Streptococcus pyogenes* Cas9 protein). See, for example, Zetsche et al. (2015). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain or the RuvC or RuvC-like domain of Neisseria meningitidis include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase). Other exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the sequence of the novel culprit Francisella U112Cpf1 (FnCpf1) (UniProtKB-A0Q7Q2 (CPF1_FRATN)).

[0487] In some embodiments, the Cas nickase (such as the Cas9 nickase) has an inactivated RuvC or HNH domain. In some embodiments, a nickase with a reduced-activity RuvC domain is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with a reduced-activity HNH domain is used. In some embodiments, a nickase with an inactive HNH domain is used.

[0488] In some implementations, the Cas9 nickase has an active HNH nuclease domain and is capable of cleaving the non-target strand of DNA, i.e., the strand bound by gRNA, and has an inactive RuvC nuclease domain and is not capable of cleaving the target strand of DNA, i.e., the strand for which base editing is desired by deaminase.

[0489] An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 41. An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO: 42.

[0490] In some embodiments, the RNA-guided nickase is one of the two types of Cas nickases described herein. In some embodiments, the RNA-guided nickase is one of the Cas9 nickases described herein.

[0491] In some embodiments, the RNA-guided nicking enzyme is the Streptococcus pyogenes Cas9 nicking enzyme described herein.

[0492] In some embodiments, the RNA-guided nickase is the D10A SpyCas9 nickase described herein. In some embodiments, the RNA-guided nickase comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any of SEQ ID NO: 41, 43, or 45. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41.

[0493] In some embodiments, the nucleic acid encoding the polypeptide or the first ORF comprises a nucleotide sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% identity with the nucleotide sequence of any one of SEQ ID NO: 42, 44, or 46. In some embodiments, the nucleic acid encoding the polypeptide or the first ORF comprises a nucleotide sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% identity with the nucleotide sequence of any one of SEQ ID NO: 42, 44, and 46-58. In some embodiments, the level of identity is at least 90%. In some embodiments, the level of identity is at least 95%. In some embodiments, the level of identity is at least 98%. In some embodiments, the level of identity is at least 99%. In some embodiments, the level of identity is at least 100%. In some embodiments, the sequence encoding an RNA-guided nickase comprises a nucleotide sequence of any one of SEQ ID NO: 42, 44, and 46.

[0494] In some embodiments, the RNA-guided nicking enzyme is the meningococcal (Nme) Cas9 nicking enzyme described herein.

[0495] In some embodiments, the RNA-guided nickase is the D16A NmeCas9 nickase described herein. In some embodiments, the D16A NmeCas9 nickase is the D16A Nme2Cas9 nickase. In some embodiments, the D16A Nme2Cas9 nickase comprises at least 80%, 90%, 95%, 98%, 99%, or 100% of the same amino acid sequence as SEQ ID NO: 149. In some embodiments, the sequence encoding D16ANme2Cas9 comprises at least 80%, 90%, 95%, 98%, 99%, or 100% of the same nucleotide sequence as any one of SEQ ID NO: 150-155.

[0496] E. A composition containing cytidine deaminase and RNA-guided nickase.

[0497] In some embodiments, the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the first genome editor. In some embodiments, the first genome editing tool comprises a first genome editor containing a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the base editor.

[0498] In some embodiments, the first genome editing tool comprises a uracil glycosidase inhibitor (UGI), and the UGI and the base editor are contained in a single polypeptide. In some embodiments, the first genome editing tool comprises a UGI, and the UGI and the base editor are contained in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are contained in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are contained in a single polypeptide, and the UGI is contained in a different polypeptide.

[0499] 1. Exemplary Composition

[0500] In some embodiments, a first genome editor (e.g., a base editor) is provided, comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nicking enzyme. In some embodiments, an enzyme from the APOBEC family and an RNA-guided nicking enzyme are provided. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and an RNA-guided nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC2 subgroup and an RNA-guided nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC4 subgroup and an RNA-guided nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and an RNA-guided nicking enzyme.

[0501] In some embodiments, a first genome editor or base editor is provided, comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nicking enzyme. In some embodiments, an enzyme from the APOBEC family and a D10ASpyCas9 nicking enzyme are provided. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D10ASpyCas9 nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC2 subgroup and a D10A SpyCas9 nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC4 subgroup and a D10A SpyCas9 nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D10A SpyCas9 nicking enzyme.

[0502] In some embodiments, a first genome editor or base editor is provided, comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nicking enzyme. In some embodiments, an APOBEC family enzyme and a D16A Nme2Cas9 nicking enzyme are provided. In some embodiments, an APOBEC family enzyme and a D16A Nme2Cas9 nicking enzyme are provided. In some embodiments, the first genome editor comprises an APOBEC1 subgroup enzyme and a D16A Nme2Cas9 nicking enzyme. In some embodiments, the first genome editor comprises an APOBEC2 subgroup enzyme and a D16A Nme2Cas9 nicking enzyme. In some embodiments, the first genome editor comprises an APOBEC4 subgroup enzyme and a D16A Nme2Cas9 nicking enzyme. In some embodiments, the first genome editor comprises an APOBEC3 subgroup enzyme and a D16A Nme2Cas9 nicking enzyme.

[0503] In some implementations, the first genome editor lacks a UGI. In some implementations, the first genome editor contains one or more UGIs.

[0504] In some embodiments, the cytidine deaminase and the RNA-guided nicking enzyme are linked via a linker. In some embodiments, the cytidine deaminase and the RNA-guided nicking enzyme are linked via a peptide linker. In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NO: 25-39 and 72-133.

[0505] In some embodiments, the first genome editor further includes one or more additional heterologous functional domains. In some embodiments, the first genome editor further includes one or more nuclear localization sequences (NLS) (described herein) located at the C-terminus or N-terminus of a polypeptide.

[0506] In some embodiments, a first genome editor or base editor is provided, comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nicking enzyme. In some embodiments, an enzyme from the APOBEC family and an RNA-guided nicking enzyme are provided. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and an RNA-guided nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC2 subgroup and an RNA-guided nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC4 subgroup and an RNA-guided nicking enzyme. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and an RNA-guided nicking enzyme.

[0507] In some embodiments, a first genome editor or base editor is provided, comprising a deaminase (e.g., cytidine deaminase) and an RNA-guided nicking enzyme. In some embodiments, an APOBEC family enzyme and a D10A SpyCas9 nicking enzyme are used, wherein the APOBEC family enzyme and the D10A SpyCas9 nicking enzyme are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D10A SpyCas9 nicking enzyme, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D10A SpyCas9 nicking enzyme, wherein the APOBEC family enzyme and the D10A SpyCas9 nicking enzyme are fused via a linker, and optionally an NLS fused to the C-terminus of the D10A SpyCas9 nicking enzyme via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D10A SpyCas9 nickase, wherein the APOBEC family enzyme and the D10A SpyCas9 nickase are NLS fused via a linker and optionally fused to the C-terminus of the D10A SpyCas9 nickase via a linker.

[0508] In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A NmeCas9 nickase, wherein the APOBEC family enzyme and the D16A NmeCas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, wherein the APOBEC family enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, wherein the APOBEC family enzyme and the D16A Nme2Cas9 nickase are fused via a linker, and optionally, an NLS is fused to the C-terminus of the D16A Nme2Cas9 nickase via a linker. In some embodiments, the first genome editor comprises an APOBEC family enzyme and a D16A Nme2Cas9 nickase, wherein the APOBEC family enzyme and the D16A Nme2Cas9 nickase are fused via a linker, and optionally, an NLS is fused to the C-terminus of the D16A Nme2Cas9 nickase via a linker.

[0509] In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D10A SpyCas9 nickase, wherein the APOBEC1 subgroup enzyme and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D10A SpyCas9 nickase, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D10A SpyCas9 nickase, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D10A SpyCas9 nickase, wherein the APOBEC1 subgroup enzyme and the D10A SpyCas9 nickase are fused via a linker, and optionally an NLS fused to the C-terminus of the D10A SpyCas9 nickase via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D10A SpyCas9 nickase, wherein the APOBEC1 subgroup enzyme and the D10A SpyCas9 nickase are fused via a linker, and optionally fused via a linker to the C-terminus of the D10A SpyCas9 nickase as NLS.

[0510] In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the APOBEC1 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the APOBEC1 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D16A Nme2Cas9 nickase, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D16A Nme2Cas9 nickase, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the APOBEC1 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker, and optionally, an NLS is fused to the C-terminus of the D16A Nme2Cas9 nickase via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC1 subgroup and a D16A Nme2Cas9 nickase, wherein the APOBEC1 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker, and optionally, an NLS is fused to the C-terminus of the D16A Nme2Cas9 nickase via a linker.

[0511] In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D10A SpyCas9 nickase, wherein the APOBEC3 subgroup enzyme and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D10A SpyCas9 nickase, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D10A SpyCas9 nickase, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D10A SpyCas9 nickase, wherein the APOBEC3 subgroup enzyme and the D10A SpyCas9 nickase are fused via a linker, and optionally an NLS fused to the C-terminus of the D10A SpyCas9 nickase via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D10A SPyCas9 nickase, wherein the APOBEC3 subgroup enzyme and the D10A SPyCas9 nickase are NLS fused via a linker and optionally fused to the C-terminus of the D10A SPyCas9 nickase via a linker.

[0512] In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D16A Nme2Cas9 nickase, wherein the APOBEC3 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D16A Nme2Cas9 nickase, wherein the APOBEC3 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D16A Nme2Cas9 nickase, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an enzyme from the APOBEC3 subgroup and a D16A Nme2Cas9 nickase, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor comprises an APOBEC3 subgroup enzyme and a D16A Nme2Cas9 nickase, wherein the APOBEC3 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker, and optionally, an NLS is fused to the C-terminus of the D16A Nme2Cas9 nickase via a linker. In some embodiments, the first genome editor comprises an APOBEC3 subgroup enzyme and a D16A Nme2Cas9 nickase, wherein the APOBEC3 subgroup enzyme and the D16A Nme2Cas9 nickase are fused via a linker, and optionally, an NLS is fused to the C-terminus of the D16A Nme2Cas9 nickase via a linker.

[0513] In some embodiments, the first genome editor comprises a D10A SPyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SPyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SPyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10ASPyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SPyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising at least 85% of the same amino acid sequence as SEQ ID NO: 22. In any of the foregoing embodiments, the D10A SPyCas9 nickase may comprise at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the same amino acid sequence as any one of SEQ ID NO: 41, 43, and 45.

[0514] In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising an amino acid sequence that is at least 85% identical to that of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16ANme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising at least 85% of the same amino acid sequence as SEQ ID NO: 22. In any of the foregoing embodiments, the D16ANme2Cas9 nickase may comprise at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the same amino acid sequence as SEQ ID NO: 149.

[0515] In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10A SpyCas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D10ASpyCas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In any of the foregoing embodiments, the D10A SpyCas9 comprises at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the same amino acid sequence as any one of SEQ ID NO: 41, 43, and 45.

[0516] In some embodiments, the first genome editor comprises a D16ANme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 129, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 130, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16ANme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 131, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16A Nme2Cas9 nickase, a adapter comprising the amino acid sequence of SEQ ID NO: 132, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first genome editor comprises a D16ANme2Cas9 nickase, a linker comprising the amino acid sequence of SEQ ID NO: 133, and a cytidine deaminase comprising the amino acid sequence of SEQ ID NO: 22. In any of the foregoing embodiments, the D16ANme2Cas9 nickase comprises an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to that of SEQ ID NO: 149.

[0517] The first genome editor can be organized in various ways to form a single strand. The NLS can be N-terminal or C-terminal, or both N-terminal and C-terminal, and the cytidine deaminase can be N-terminal or C-terminal compared to the RNA-guided nickase. In some embodiments, the first genome editor comprises, from N to C-terminus, cytidine deaminase, optional adapter, RNA-guided nickase, and optional NLS. In some embodiments, the first genome editor comprises, from N to C-terminus, optional NLS, RNA-guided nickase, optional adapter, and cytidine deaminase. In some embodiments, the first genome editor comprises, from N to C-terminus, optional NLS, RNA-guided nickase, optional adapter, and cytidine deaminase, and optional NLS.

[0518] In some embodiments, the first genome editor includes, from N to C ends, an optional NLS, an APOBEC family enzyme, an optional adapter, an RNA-guided nicking enzyme, and an optional NLS.

[0519] In some embodiments, the first genome editor includes, from N to C ends, an optional NLS, an enzyme from the APOBEC3 subgroup, an optional adapter, an RNA-guided nicking enzyme, and an optional NLS. (This text is repeated four times in the original.)

[0520] In some embodiments, the first genome editor comprises, from N to C ends, an optional NLS, an APOBEC family enzyme, an optional adapter, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and an optional NLS. In some embodiments, the first genome editor comprises, from N to C ends, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional adapter, an APOBEC family enzyme, and an optional NLS. In some embodiments, the first genome editor comprises, from N to C ends, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional adapter, an APOBEC family enzyme, and an optional NLS. In some embodiments, the first genome editor comprises, from N to C ends, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional adapter, an APOBEC family enzyme, and an optional NLS.

[0521] In some embodiments, the first genome editor comprises, from N to C, an optional NLS, an APOBEC3 subgroup enzyme, an optional adapter, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, and an optional NLS. In some embodiments, the first genome editor comprises, from N to C, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional adapter, an APOBEC3 subgroup enzyme, and an optional NLS. In some embodiments, the first genome editor comprises, from N to C, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional adapter, an APOBEC3 subgroup enzyme, and an optional NLS. In some embodiments, the first genome editor comprises, from N to C, an optional NLS, a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, an optional adapter, an APOBEC3 subgroup enzyme, and an optional NLS.

[0522] In some implementations, the first genome editor includes, from the N to the C end, optional NLS, an enzyme from the APOBEC3 subgroup, an optional adapter, and a D16A Nme2Cas9 nickase.

[0523] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS; (ii) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22; (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133; (iv) a D10A SpyCas9 nickase or a D16ANme2Cas9 nickase; and (v) an optional NLS.

[0524] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22, and (v) an optional NLS.

[0525] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22, and (v) an optional NLS.

[0526] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22, and (v) an optional NLS.

[0527] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22; (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, (iv) a D10A SpyCas9 nickase or a D16ANme2Cas9 nickase, and (v) an optional NLS.

[0528] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22, and (v) an optional NLS.

[0529] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22, and (v) an optional NLS.

[0530] In some embodiments, the first genome editor comprises, from the N to the C end, (i) an optional NLS, (ii) a D10A SpyCas9 nickase or a D16A Nme2Cas9 nickase, (iii) a linker comprising one or more sequences selected from SEQ ID NO: 25-38, 39 and 72-133, and (iv) a cytidine deaminase comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22, and (v) an optional NLS.

[0531] 2. A composition containing APOBEC3A deaminase and RNA-guided nickase.

[0532] In some embodiments, a first genome editing tool comprising a first genome editor is provided. In some embodiments, the first genome editor comprises a base editor. In some embodiments, the first genome editor or the base editor comprises human A3A and an RNA-guided nickase. In some embodiments, the first genome editor or the base editor comprises wild-type A3A and an RNA-guided nickase. In some embodiments, the first genome editor or the base editor comprises an A3A variant and an RNA-guided nickase. In some embodiments, the first genome editor or the base editor comprises A3A and a Cas9 nickase. In some embodiments, the first genome editor or the base editor comprises A3A and a D10ASpyCas9 nickase. In some embodiments, the first genome editor or the base editor comprises human A3A and a D10A SpyCas9 nickase. In some embodiments, the first genome editor or the base editor comprises an A3A variant and a D10ASpyCas9 nickase. In some embodiments, the first genome editor or the base editor lacks a UGI. In some embodiments, the first genome editor or the base editor comprises one or more UGIs. In some embodiments, the first genome editor or the base editor comprises two UGIs. In some embodiments, the A3A is linked to the RNA-guided nickase via a linker. In some embodiments, the first genome editor or the base editor further comprises one or more additional heterologous functional domains. In some embodiments, the first genome editor or the base editor further comprises a nuclear localization sequence (NLS) (described herein) located at the C-terminus or N-terminus of a polypeptide.

[0533] In some embodiments, the first genome editor or the base editor comprises human A3A and D10A SpyCas9 nickases, wherein the human A3A and the D10A SpyCas9 nickase are fused via a linker. In some embodiments, the first genome editor or the base editor comprises human A3A and D10A SpyCas9 nickases, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor or the base editor comprises human A3A and D10A SpyCas9 nickases, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor or the base editor comprises human A3A and D10A SpyCas9 nickases, wherein the human A3A and the D10A SpyCas9 nickase are fused via a linker, and optionally an NLS fused to the C-terminus of the D10A SpyCas9 nickase via a linker. In some embodiments, the first genome editor or the base editor comprises human A3A and D10A SpyCas9 nickase, wherein the human A3A and the D10A SpyCas9 nickase are NLS fused via a linker and optionally fused to the C-terminus of the D10A SpyCas9 nickase via a linker.

[0534] In some embodiments, the first genome editor or the base editor comprises human A3A and D16A NmeCas9 nickases, wherein the human A3A and the D16A NmeCas9 nickase are fused via a linker. In some embodiments, the first genome editor or the base editor comprises human A3A and D16A NmeCas9 nickases, and a nuclear localization sequence (NLS) located at the C-terminus of the fusion polypeptide. In some embodiments, the first genome editor or the base editor comprises human A3A and D16A NmeCas9 nickases, and an NLS located at the N-terminus of the fusion polypeptide. In some embodiments, the first genome editor or the base editor comprises human A3A and D16A NmeCas9 nickases, wherein the human A3A and the D16A NmeCas9 nickase are fused via a linker, and optionally an NLS fused to the C-terminus of the D16A NmeCas9 nickase via a linker. In some embodiments, the first genome editor or the base editor comprises human A3A and D16A NmeCas9 nickases, wherein the human A3A and the D16A NmeCas9 nickase are NLS fused via a linker and optionally fused to the C-terminus of the D16A NmeCas9 nickase via a linker.

[0535] The first genome editor or the base editor can be organized in various ways to form a single strand. The NLS can be N-terminal or C-terminal, or both N-terminal and C-terminal, and the A3A can be N-terminal or C-terminal compared to an RNA-guided nickase. In some embodiments, the first genome editor or the base editor includes A3A, an optional adapter, an RNA-guided nickase, and an optional NLS from the N to C-terminus. In some first genome editors or base editors, the polypeptide includes an RNA-guided nickase, an optional adapter, A3A, and an optional NLS from the N to C-terminus. In some first genome editors or base editors, the polypeptide includes an optional NLS, an RNA-guided nickase, an optional adapter, and A3A from the N to C-terminus. In some embodiments, the first genome editor or the base editor includes an optional NLS, an RNA-guided nickase, an optional adapter, and A3A, as well as an optional NLS, from the N to C-terminus.

[0536] In any of the foregoing embodiments, the first genome editor or the base editor may contain an amino acid sequence having at least 80% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, any of the aforementioned identity levels is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 90% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 95% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 98% identity with SEQ ID NO: 3, 6, or 146. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 99% identity with SEQ ID NO: 3, 6, or 146. In some implementations, the first genome editor or base editor disclosed herein may contain the amino acid sequence of SEQ ID NO: 3, 6 or 146.

[0537] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with SEQ ID NO: 2, 5, or 147. In some embodiments, any of the foregoing levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0538] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with SEQ ID NO: 1 or 4. In some embodiments, any of the aforementioned levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0539] In any of the foregoing embodiments, the first genome editor or the base editor may contain an amino acid sequence having at least 80% identity with any of SEQ ID NO: 9, 12, 18, and 21. In some embodiments, any of the aforementioned identity levels is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 90% identity with any of SEQ ID NO: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 95% identity with any of SEQ ID NO: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 98% identity with any of SEQ ID NO: 9, 12, 18, and 21. In some embodiments, the first genome editor or base editor disclosed herein may contain an amino acid sequence having at least 99% identity with any of SEQ ID NO: 9, 12, 18, and 21.

[0540] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with any of SEQ ID NO: 8, 11, 17, and 20. In some embodiments, any of the aforementioned levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0541] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80% identity with any of SEQ ID NO: 7, 10, 16, and 19. In some embodiments, any of the aforementioned levels of identity is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.

[0542] In any of the foregoing embodiments, the first genome editor or the base editor may comprise an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 136, 139, 142, or 145. In some embodiments, the first genome editor or base editor disclosed herein may comprise an amino acid sequence of SEQ ID NO: 136, 139, 142, or 145. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: SEQ ID NO: 135, 138, 141, or 144. In some embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein comprises a nucleic acid sequence of SEQ ID NO: 135, 138, 141, or 144. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 134, 137, 140, or 143. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor disclosed herein may comprise a nucleic acid sequence of SEQ ID NO: 134, 137, 140, or 143.

[0543] In any of the foregoing embodiments, the A3A may comprise an amino acid sequence having at least 80% identity with SEQ ID NO: 22. In some embodiments, the identity level is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the A3A comprises the amino acid sequence of SEQ ID NO: 22.

[0544] In any of the foregoing embodiments, the RNA-guided nickase may comprise an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any of SEQ ID NO: 41, 43, or 45. In some embodiments, the identity level is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 43. In some embodiments, the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 45.

[0545] In any of the foregoing embodiments, A3A may comprise an amino acid sequence having at least 80% identity with SEQ ID NO: 22, and the RNA-guided nickase may comprise an amino acid sequence having at least 80%, 90%, 95%, 98%, or 99% identity with any of SEQ ID NO: 41, 43, or 45. In some embodiments, A3A comprises the amino acid sequence of SEQ ID NO: 22, and the RNA-guided nickase comprises the amino acid sequence of SEQ ID NO: 41.

[0546] In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor comprises at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 1. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor comprises at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 147. In any of the foregoing embodiments, the nucleic acid or ORF encoding the first genome editor or base editor comprises at least 80%, 85%, 90%, 95%, 98%, or 100% of the same nucleotide sequence as SEQ ID NO: 310.

[0547] III. Second Genome Editing Tools

[0548] In some embodiments, the second genome editing tool comprises a second genome editor and at least one gRNA targeting at least one genomic locus and homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor. In some embodiments, the second genome editing tool comprises a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase.

[0549] In some embodiments, the second genome editor is delivered to the cell as at least one polypeptide or at least one mRNA. In some embodiments, the second genome editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the second genome editor comprises a lyase, a nicking enzyme, a non-catalytically active nuclease, a base editor, optionally a C-to-T base editor or an A-to-G base editor, or a fusion protein comprising a DNA polymerase and a nicking enzyme.

[0550] In some embodiments, one of the first and second genome editors comprises a base editor, optionally a C-to-T base editor or an A-to-G base editor, and the other of the first and second genome editors comprises a lyase. In some embodiments, one of the first and second genome editors comprises a C-to-T base editor, and the other of the first and second genome editors comprises an A-to-G base editor. In some embodiments, one of the first and second genome editors comprises a Neisseria meningitidis (Nme) RNA-guided nicking enzyme or lyase, and the other of the first and second genome editors comprises a Streptococcus pyogenes (Spy) RNA-guided nicking enzyme or lyase.

[0551] In some embodiments, the second genome editor or the RNA-guided lyase is a Cas nuclease. In some embodiments, the Cas nuclease is Cas9. In some embodiments, the Cas9 is *Streptococcus pyogenes* Cas9 (SpyCas9), *Staphylococcus aureus* Cas9 (SauCas9), *Corynebacterium diphtheriae* Cas9 (CdiCas9), *Streptococcus thermophilus* Cas9 (StlCas9), *Vibrio celluloseis* Cas9 (AceCas9), *Campylobacter jejuni* Cas9 (CjeCas9), *Rhodopseudomonas palustris* Cas9 (RpaCas9), *Rhodospirillum rubrum* Cas9 (RruCas9), *Actinomyces nephroticis* Cas9 (AnaCas9), *Francisella foetida* Cas9 (FnoCas9), or *Neisseria meningitidis* (NmeCas9). In some embodiments, the Cas9 is NmelCas9, Nme2Cas9, Nme3Cas9, or SpyCas9. In some embodiments, the Cas nuclease is a class 2 Cas nuclease. In some embodiments, the Cas nuclease is Cas12. In some embodiments, the Cas12 is either LbCas12a (a member of the Trichophyton family) or AsCas12a (a member of the Aminococcus genus). In some embodiments, the Cas nuclease is EsCas13d (a member of the Eubacterium casuarinae family).

[0552] In some embodiments, the second genome editor or the RNA-guided lyase is a Cas9 lyase. In some embodiments, the second genome editor or the RNA-guided lyase is a Streptococcus pyogenes Cas9 (SpyCas9) lyase. In some embodiments, the SpyCas9 lyase contains an amino acid sequence that is at least 90% identical to SEQ ID NO: 156. In some embodiments, the SpyCas9 lyase contains the amino acid sequence of SEQ ID NO: 156.

[0553] In some embodiments, the second genome editor or the RNA-guided lyase is a Cas9 lyase. In some embodiments, the second genome editor or the RNA-guided lyase is a Neisseria meningitidis Cas9 (NmeCas9) lyase. In some embodiments, the NmeCas9 lyase comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the amino acid sequence identical to any one of SEQ ID NOs: 157, 158-167, 191, 198, 205, 212, and 219. In some embodiments, the NmeCas9 lyase comprises the amino acid sequence of any one of SEQ ID NOs: 157, 158-167, 191, 198, 205, 212, and 219.

[0554] In some implementations, the second genome editing tool, the nucleic acid encoding an RNA-guided lyase, the second nucleic acid containing a second ORF, or the second ORF contains at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the same polynucleotide sequence as any one of SEQ ID NO: 168, 169-178, 180, 181-190, 192-197, 199-204, 206-211, 213-218, and 220-225. In some implementations, the second genome editing tool, the nucleic acid encoding an RNA-guided lyase, the second nucleic acid containing a second ORF, or the second ORF containing a polynucleotide sequence of any one of SEQ ID NO: 168, 169-178, 180, 181-190, 192-197, 199-204, 206-211, 213-218, and 220-225.

[0555] In some embodiments, the second genome editing tool comprises an RNA-guided lyase. In some embodiments, when used with at least one gRNA homologous to the lyase, the RNA-guided lyase provides simultaneous knockout of a genomic locus targeted by the at least one gRNA and knock-in of a foreign gene.

[0556] In some embodiments, the second genome editing tool comprises a fusion protein containing a DNA polymerase and a nickase. In some embodiments, when used with at least one gRNA homologous to the nickase, the fusion protein containing the DNA polymerase and the nickase provides targeted knock-in of exogenous nucleic acids.

[0557] In some embodiments, the second genome editing tool may be combined with any first genome editing tool disclosed herein. In some embodiments, a second nucleic acid containing any second ORF may be combined with any first nucleic acid containing any first ORF disclosed herein. Using mutually orthogonally homologous Cas9 nickases and Cas9 lyases in both the first and second genome editing tools prevents cross-utilization.

[0558] In some embodiments, the first genome editing tool comprises a first genome editor or base editor (containing an APOBEC family deaminase (e.g., cytidine deaminase) and a D16A NmeCas9 cleavage enzyme), and at least one gRNA targeting at least one genomic locus and homologous to the cleavage enzyme. In some embodiments, the first genome editor or the base editor comprises one or more UGIs. In some embodiments, the second genome editing tool comprises a Streptococcus pyogenes Cas9 (SpyCas9) lyase and at least one gRNA targeting at least one genomic locus and homologous to the SpyCas9 lyase.

[0559] In some embodiments, the first genome editing tool comprises a first genome editor or base editor (containing an APOBEC family deaminase (e.g., cytidine deaminase) and a D16A NmeCas9 cleavage enzyme), and at least one gRNA targeting at least one genomic locus and homologous to the cleavage enzyme. In some embodiments, the first genome editor or the base editor does not contain any UGI. In some embodiments, the first genome editing tool further comprises a UGI in at least one polypeptide different from the first genome editor or base editor. In some embodiments, the second genome editing tool comprises a Streptococcus pyogenes Cas9 (SpyCas9) lyase and at least one gRNA targeting at least one genomic locus and homologous to the SpyCas9 lyase.

[0560] In some embodiments, the first genome editing tool comprises a first genome editor or base editor (containing an APOBEC family deaminase (e.g., cytidine deaminase) and a D10A SpyCas9 cleavage enzyme), and at least one gRNA targeting at least one genomic locus and homologous to the cleavage enzyme. In some embodiments, the first genome editor or the base editor comprises one or more UGIs. In some embodiments, the second genome editing tool comprises an NmeCas9 lyase and at least one gRNA targeting at least one genomic locus and homologous to the NmeCas9 lyase.

[0561] In some embodiments, the first genome editing tool comprises a first genome editor or base editor (containing an APOBEC family deaminase (e.g., cytidine deaminase) and a D10A SpyCas9 nickase), and at least one gRNA targeting at least one genomic locus and homologous to the nickase. In some embodiments, the first genome editor or the base editor does not contain any UGI. In some embodiments, the first genome editing tool further comprises a UGI in at least one polypeptide different from the first genome editor or base editor. In some embodiments, the second genome editing tool comprises an NmeCas9 lyase and at least one gRNA targeting at least one genomic locus and homologous to the NmeCas9 lyase.

[0562] IV. Other characteristics

[0563] The following sections provide further features of the first genome editor, the base editor, the second genome editor, and the nucleic acid encoding them. In any of the embodiments described herein, the nucleic acid may be an expression construct containing a promoter operatively linked to an ORF encoding the first genome editor, the base editor, or the second genome editor disclosed herein.

[0564] A. Codon optimization

[0565] In some embodiments, the nucleic acid encoding a first genome editor, a base editor, or a second genome editor comprises an ORF containing a codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized nucleic acid sequence comprises a minimum adenine codon and / or a minimum uridine codon.

[0566] The uridine or uridine dinucleotide content of a given ORF can be reduced, for example, by using minimal uridine codons in a sufficient portion of the ORF. For instance, the amino acid sequence of a first genome editor, base editor, or second genome editor described herein can be back-translated into an ORF sequence by converting amino acids into codons, some or all of which use the exemplary minimal uridine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are the codons listed in Table 1.

[0567] Table 1. Exemplary minimal uridine codons

[0568]

[0569]

[0570] In some implementations, the ORF may consist of a set of codons in which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are the codons listed in Table 1.

[0571] The adenine or adenine dinucleotide content of a given ORF can be reduced, for example, by using minimal adenine codons in a sufficient portion of the ORF. For instance, the amino acid sequence of a first genome editor, base editor, or second genome editor described herein can be back-translated into an ORF sequence by converting amino acids into codons, some or all of which use exemplary minimal adenine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are the codons listed in Table 2.

[0572] Table 2. Exemplary minimal adenine codons

[0573]

[0574]

[0575] In some implementations, the ORF may consist of a set of codons in which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are the codons listed in Table 2.

[0576] To a degree of feasibility, any of the characteristics described above for low adenine content can be combined with any of the characteristics described above for low uridine content. The same applies to uridine and adenine dinucleotides. Similarly, the content of uridine nucleotides and adenine dinucleotides in the ORF can be as described above.

[0577] The content of uridine and adenine nucleotides or dinucleotides in a given ORF can be reduced, for example, by using minimal uridine and adenine codons in a sufficient portion of the ORF. For instance, the amino acid sequence of a polypeptide, second genome editor, or RNA-guided lyase described herein can be back-translated into an ORF sequence by converting amino acids into codons, some or all of which use the exemplary minimal uridine and adenine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are the codons listed in Table 3.

[0578] Table 3. Exemplary minimum uridine and adenine codons

[0579]

[0580]

[0581] In some embodiments, the ORF may consist of a set of codons in which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are the codons listed in Table 3. As can be seen in Table 3, each of the three listed serine codons contains one A or one U. In some embodiments, uridine minimization is preferentially performed by using the AGC codon of serine. In some embodiments, adenine minimization is preferentially performed by using the UCC or UCG codons of serine.

[0582] In some embodiments, the ORF may have codons that increase translation in mammals (e.g., humans). In other embodiments, the ORF is mRNA and contains codons that increase translation in mammalian organs (e.g., livers). In other embodiments, the ORF may have codons that increase translation in mammalian cell types (e.g., hepatocytes). The increase in translation in mammals, cell types, mammalian organs, humans, human organs, etc., can be determined relative to the degree of translation of the wild-type sequence of the ORF, or relative to the ORF whose codon distribution matches that of the organism from which the ORF is derived, or to the ORF whose codon distribution is most similar to that of the organism at the amino acid level. Alternatively, in some embodiments, the increase in translation of the Cas9 sequence in mammals, cell types, mammalian organs, humans, human organs, etc., is determined relative to the translation of an ORF having the sequence of SEQ ID NO: 2 or 5, all other things being equal (including any applicable point mutations, heterologous domains, etc.). In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) in mammals (such as humans). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) in mammalian organs (such as human organs).

[0583] Alternatively, codons corresponding to tRNAs that are highly expressed in organisms such as humans can often be used.

[0584] Any of the aforementioned methods for codon selection may be combined with the minimum uridine or adenine codons shown above, for example by starting with codons from Table 1, Table 2 or Table 3, and then, if more than one option is available, using codons corresponding to tRNAs expressed at a higher degree in a typical organism (e.g., humans) or the organ or cell type of interest (e.g., human liver or human hepatocytes).

[0585] In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons from the codon subsets shown in Table 4 (e.g., low U1, low A, or low A / U codon subsets). Codons in the low U1, low G, low A, and low A / U sets use codons that minimize the indicated nucleotide, and also use codons corresponding to highly expressed tRNAs when more than one option is available. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons from the low U1 codon subset shown in Table 4. In some implementations, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons from the low-A codon subset shown in Table 4. In some implementations, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons from the low-A / U codon subset shown in Table 4.

[0586] Table 4. Exemplary subsets of cryptography.

[0587]

[0588]

[0589] B. Heterogeneous functional domains; nuclear localization signal (NLS)

[0590] In some implementations, the first genome editor, base editor, or second genome editor disclosed herein may also include one or more other heterologous functional domains (e.g., ternary or higher-order fusion peptides).

[0591] In some embodiments, the heterologous functional domain may facilitate the delivery of a first genome editor, base editor, or second genome editor to the cell nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with 1-10 NLSs. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with 1-5 NLSs. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with a single NLS. When using a single NLS, the NLS may be fused to the N-terminus or C-terminus of the first genome editor, base editor, or second genome editor sequence. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused to at least one NLS at the C-terminus. The NLS may also be inserted within a peptide, a second genome editor, or an RNA-guided lyase sequence. In other embodiments, the first genome editor, the base editor, or the second genome editor may be fused with more than one NLS. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with two NLSs. In some cases, the two NLSs may be identical (e.g., two SV40 NLSs) or different. In some embodiments, the first genome editor, the base editor, or the second genome editor is fused with two SV40 NLS sequences at the carboxyl terminus. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the first genome editor, the base editor, or the second genome editor may be fused with 3 NLSs. In some embodiments, the first genome editor, the base editor, or the second genome editor may not be fused with any NLS. In some embodiments, the NLS may be a single-component sequence, such as SV40 NLS, PKKKRKV (SEQ ID NO: 40), or PKKKRRV (SEQ ID NO: 70). In some embodiments, the NLS may be a two-component sequence, such as the NLS of a nucleoplasmic protein, KRPAATKKAGQAKKKK (SEQ ID NO: 71). In one specific embodiment, a single PKKKRKV (SEQ ID NO: 40) NLS may be fused to the C-terminus of a first genome editor, a base editor, or a second genome editor.One or more adapters may optionally be included at a fusion site (e.g., between the first genome editor, base editor, or second genome editor and the NLS). In some embodiments, one or more NLS according to any of the foregoing embodiments are combined with one or more other heterologous functional domains (e.g., any of the heterologous functional domains set forth below) in the first genome editor, base editor, or second genome editor.

[0592] In some embodiments, the cytidine deaminase (e.g., A3A) is located at the N-terminus of an RNA-guided nicking enzyme in a first genome editor or base editor. In some embodiments, the RNA-guided nicking enzyme includes a nuclear localization signal (NLS). In some embodiments, the NLS is fused to the C-terminus of the RNA-guided nicking enzyme. In some embodiments, the NLS is fused to the C-terminus of the RNA-guided nicking enzyme via a linker. In some embodiments, the NLS is fused to the N-terminus of the RNA-guided nicking enzyme. In some embodiments, the NLS is fused to the N-terminus of the RNA-guided nicking enzyme via a linker (e.g., SEQ ID NO: 39). In some embodiments, the NLS contains a sequence having at least 80%, 85%, 90%, or 95% identity with any of SEQ ID NO: 40 and 59-71. In some embodiments, the NLS contains a sequence of any of SEQ ID NO: 40 and 59-71. In some embodiments, the NLS is encoded by a sequence having at least 80%, 85%, 90%, 95%, 98%, or 100% identity with any of the sequences in SEQ ID NO: 40 and 59-71.

[0593] In some embodiments, the heterologous functional domain may improve the intracellular half-life of an A3A or RNA-guided nickase in a first genome editor or base editor. In some embodiments, the half-life of an A3A or RNA-guided nickase in the polypeptide may be prolonged. In some embodiments, the half-life of an A3A or RNA-guided nickase in the first genome editor or base editor may be shortened. In some embodiments, the heterologous functional domain may increase the stability of an A3A or RNA-guided nickase in a first genome editor or base editor. In some embodiments, the heterologous functional domain may decrease the stability of an A3A or RNA-guided nickase in a first genome editor or base editor. In some embodiments, the heterologous functional domain may serve as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteases, such as proteasomes, lysosomal proteases, or calpases. In some embodiments, the heterologous functional domain may contain a PEST sequence. In some embodiments, the polypeptide may be modified by adding ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifying factor (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-associated modifying factor-1 (URM1), developmentally downregulated protein-8 expressed in neuronal progenitor cells (NEDD8, also known as Rub1 in Saccharomyces cerevisiae), human leukocyte antigen F associative protein (FAT10), autophagy-8 (ATG8) and autophagy-12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin folding modifying factor-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0594] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Any known fluorescent protein can be used as a marker domain, such as GFP, YFP, EBFP, ECFP, DsRed, or any other suitable fluorescent protein. In some embodiments, the marker domain may be a purification tag or an epitope tag. Non-limiting exemplary tags include glutathione S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis (SEQ ID NO: 401), 8xHis (SEQ ID NO: 402), biotinylate carboxyl carrier protein (BCCP), polyHis, and calmodulin. In some embodiments, the marker domain may be a reporter gene. Non-restrictive exemplary reporter genes include glutathione S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, or fluorescent protein.

[0595] In other embodiments, the heterologous functional domain may enable a first genome editor, base editor, or second genome editor to target a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may enable a first genome editor, base editor, or second genome editor to target mitochondria.

[0596] C.UTR; Kozak sequence

[0597] In some embodiments, the nucleic acids (e.g., mRNA) disclosed herein comprise 5′UTR, 3′UTR, or 5′ and 3′UTRs of hydroxysteroid 17-β dehydrogenase 4 (HSD17B4 or HSD) or globulins (such as human alpha globulin (HBA), human β globulin (HBB), Xenopus laevis β globulin (XBG)), bovine growth hormone, cytomegalovirus (CMV), mouse Hba-al, heat shock protein 90 (Hsp90), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, α-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0598] In some embodiments, the nucleic acid described herein does not contain a 5′ UTR, for example, there are no other nucleotides between the 5′ cap and the start codon. In some embodiments, the nucleic acid contains a Kozak sequence (described below) between the 5′ cap and the start codon, but does not have any other 5′ UTR. In some embodiments, the nucleic acid does not contain a 3′ UTR, for example, there are no other nucleotides between the stop codon and the poly-A tail.

[0599] In some embodiments, the nucleic acid described herein contains a Kozak sequence. The Kozak sequence can influence translation initiation and the overall yield of the polypeptide translated from mRNA. The Kozak sequence includes a methionine codon that can function as a start codon. The minimal Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G and the second N is G. In the case of nucleotide sequences, R indicates a purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN, NNNRUUGG, RNNRUUGG, RNNAUGN, NNNAUUGG, RNNAUUGG, or GCCACCAUG.

[0600] D. Poly-A tail

[0601] In some embodiments, the nucleic acids disclosed herein also include a polyadenylated (poly-A) tail. The poly-A tail may contain at least eight consecutive adenine nucleotides, but may also contain one or more non-adenine nucleotides. As used herein, a "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Therefore, the poly-A tail on the nucleic acid described herein may contain consecutive adenine nucleotides at the 3′ of the nucleotide encoding the polypeptide of interest. In some cases, the poly-A tail on the nucleic acid contains non-contiguous adenine nucleotides at the 3′ of the nucleotide encoding the polypeptide, wherein non-adenine nucleotides are interspersed with adenine nucleotides at regular or irregular intervals.

[0602] In some embodiments, the poly-A tail is encoded in a plasmid used for in vitro transcription of mRNA and becomes part of the transcript. The poly-A sequence encoded in the plasmid (i.e., the number of consecutive adenine nucleotides in the poly-A sequence) may not be precise; for example, a 100-poly-A sequence (SEQ ID NO: 403) in the plasmid may not produce exactly 100-poly-A sequences (SEQ ID NO: 403) in the transcribed mRNA. In some embodiments, the poly-A tail is not encoded in the plasmid and is added by PCR tailing or enzymatic tailing, for example using E. coli poly(A) polymerase.

[0603] In some embodiments, the one or more non-adenine nucleotides are positioned to interrupt consecutive adenine nucleotides, such that the poly(A)-binding protein can bind to a consecutive adenine nucleotide segment. In some embodiments, the one or more non-adenine nucleotides follow at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides (SEQ ID NO: 404). In some embodiments, the one or more non-adenine nucleotides follow 8-50 consecutive adenine nucleotides (SEQ ID NO: 405). In some embodiments, the one or more non-adenine nucleotides follow 8-100 consecutive adenine nucleotides (SEQ ID NO: 406).

[0604] In some embodiments, the poly-A tail comprises or contains a continuous segment of one non-adenine nucleotide or 2-10 non-adenine nucleotides.

[0605] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some cases, where more than one non-adenine nucleotide is present, the non-adenine nucleotide may be selected from: a) guanine and thymine nucleotides; b) guanine and cytosine nucleotides; c) thymine and cytosine nucleotides; or d) guanine, thymine, and cytosine nucleotides.

[0606] E. Modified nucleotides

[0607] In some embodiments, the nucleic acids disclosed herein contain modified uridine at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, for example, by a halogen or C1-C3 alkoxy group. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, for example, by a C1-C3 alkyl group. The modified uridine may be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof.

[0608] In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the uridine sites in the nucleic acids disclosed herein are modified uridines. In some embodiments, 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85-95%, or 90-100% of the uridine sites in the mRNA disclosed herein are modified uridines, such as 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or combinations thereof.

[0609] In some embodiments, at least 10% of the uridine is replaced by modified uridine. In some embodiments, 15% to 45% of the uridine is replaced by modified uridine. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the uridine is replaced by modified uridine.

[0610] F.5' cap

[0611] In some embodiments, the nucleic acids disclosed herein contain a 5′ cap, such as cap 0, cap 1, or cap 2. The 5′ cap is typically a 7-methylguanine ribonucleotide (which may be further modified, as discussed below for example with regard to ARCA), which is linked via a 5′-triphosphate to the 5′ position of the first nucleotide (i.e., the first cap proximal nucleotide) of the 5′ to 3′ chain in the nucleic acid. In cap 0, the ribose of both the first and second cap proximal nucleotides of the mRNA contains a 2′-hydroxyl group. In cap 1, the ribose of the first and second transcriptional nucleotides of the nucleic acid contains a 2′-methoxy group and a 2′-hydroxyl group, respectively. In cap 2, the ribose of both the first and second cap proximal nucleotides of the nucleic acid contains a 2′-methoxy group. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33): 12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11): E2106-E2115. Most endogenous higher eukaryotic nucleic acids (including mammalian nucleic acids, such as human nucleic acids) contain cap 1 or cap 2. Cap 0 and other cap structures different from cap 1 and cap 2 can be immunogenic in mammals (such as humans) because they are recognized as “non-self” by components of the innate immune system (such as IFIT-1 and IFIT-5), which can lead to elevated levels of cytokines (including type I interferon). Components of the innate immune system (such as IFIT-1 and IFIT-5) can also competitively bind to nucleic acids with caps other than cap 1 or cap 2 with eIF4E, potentially inhibiting nucleic acid translation.

[0612] Caps can be co-transcribed. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3′-methoxy-5′-triphosphate linked to the 5′ position of a guanine ribonucleotide, which can be incorporated into the transcript in vitro at initiation. ARCA produces a cap-0 cap or a cap-0-like cap, wherein the 2′ position of the proximal nucleotide of the first cap is a hydroxyl group. For example, see Stepinski et al. (2001), “Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3′-O-methyl)GpppG and 7-methyl(3′deoxy)GpppG,” RNA 7: 1486-1495. The structure of ARCA is shown below.

[0613]

[0614] CleanCap TM AG(m7G(5′)ppp(5′)(2′OMeA)pG; TriLink Biotechnologies catalog number N-7113) or CleanCap TM GG(m7G(5′)ppp(5′)(2′OMeG)pG; TriLink Biotechnologies catalog number N-7133) can be used for co-transcription to provide the Cap1 structure. CleanCap TM AG and CleanCap TM The 3′-O-methylated form of GG is also available from TriLink Biotechnologies under catalog numbers N-7413 and N-7433, respectively. Clean Cap TM The AG structure is shown below. CleanCap TM The structure is sometimes referred to in this article using the last three digits of the catalog number listed above (e.g., "CleanCap"). TM "113" is TriLink Biotechnologies catalog number N-7113.

[0615]

[0616] Alternatively, the cap can be added to the RNA post-transcriptionally. For example, vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S) and possesses RNA triphosphatase and guanylate transferase activity (provided by its D1 subunit) and guanine methyltransferase activity (provided by its D12 subunit). Therefore, 7-methylguanine can be added to RNA in the presence of S-adenosylmethionine and GTP to obtain the cap 0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuhuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For further discussion on caps and capping methods, see, for example, WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.

[0617] V. Cells

[0618] In some implementations, the cells that come into contact with the first or second genome editing tool are human cells.

[0619] In some embodiments, the cell is contacted with: (a) a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the first genome editor; and (b) a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA that targets at least one genomic locus and is homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor, thereby generating at least two genome edits in the cell.

[0620] In some embodiments, cells are contacted with: (a) a first genome editing tool comprising a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and (b) a second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase, thereby producing at least two genome edits in the cells.

[0621] In some embodiments, the cells are contacted with: (a) a first genome editing tool comprising a first genome editor containing a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and (b) a second genome editing tool comprising a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase; and in some embodiments, (c) the cells are cultured to produce a cell population comprising edited cells, each of the edited cells containing at least two genome edits.

[0622] In some embodiments, cells are treated in vitro using any of the methods or compositions disclosed herein. In some embodiments, cells are treated in vivo using any of the methods or compositions disclosed herein.

[0623] In some embodiments, the cells in any of the embodiments provided herein are engineered using a first genome editing tool and a second genome editing tool. In some embodiments, the first genome editing tool comprises a C-to-T base editor or an A-to-G base editor. In some embodiments, the first genome editing tool comprises a first genome editor containing a cytidine deaminase and an RNA-guided nickase or nucleic acid encoding a polypeptide. In some embodiments, the cytidine deaminase is APOBEC3A deaminase (A3A). In some embodiments, the first genome editor contains at least 80%, 85%, 90%, 95%, 98%, or 100% of the same amino acid sequence as SEQ ID NO: 3, SEQ ID NO: 146, or SEQ ID NO: 311. In some embodiments, the nucleic acid encoding the first genome editor contains at least 80%, 85%, 90%, 95%, 98%, or 100% of the same sequence as SEQ ID NO: 1, SEQ ID NO: 147, or SEQ ID NO: 310. In some embodiments, the first genome editor contains at least 80%, 85%, 90%, 95%, 98%, or 100% of the same amino acid sequence as any one of SEQ ID NO: 9, 12, 18, and 21.

[0624] In some embodiments, the first or second genome editing tool is delivered to cells via electroporation. In some embodiments, the first or second genome editing tool is delivered to cells via at least one lipid nanoparticle (LNP). In some embodiments, the first or second genome editing tool is contained within at least one LNP. In some embodiments, the first or second genome editing tool is delivered to cells on at least one vector. In some embodiments, the first or second genome editing tool comprises at least one vector. In some embodiments, the first or second genome editing tool is delivered as at least one nucleic acid encoding the first or second genome editing tool. In some embodiments, the first or second genome editing tool comprises at least one nucleic acid encoding the first or second genome editing tool. In some embodiments, the first genome editing tool comprises at least one polypeptide containing the first genome editing tool or at least one nucleic acid encoding the first genome editing tool. In some embodiments, the second genome editing tool comprises at least one polypeptide containing the second genome editing tool or at least one nucleic acid encoding the second genome editing tool. In some embodiments, the at least one nucleic acid comprises at least one mRNA. In some embodiments, the first or second genome editor is delivered to the cell as at least one polypeptide or at least one mRNA. In some embodiments, the first or second genome editor comprises at least one polypeptide or at least one mRNA. In some embodiments, the at least one gRNA is delivered to the cell as at least one polynucleotide encoding the gRNA. In some embodiments, the cell is contacted with nucleic acid encoding a foreign gene for insertion into a genomic locus. In some embodiments, the cell is contacted with nucleic acid encoding a foreign gene for insertion into a TRAC or AAVS1 locus.

[0625] In some embodiments, in any of the methods disclosed herein, steps (a) and (b) of cell contact are performed simultaneously. In some embodiments, steps (a) and (b) of cell contact are performed in any order over a time period of approximately 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, 36 hours, or 48 hours. In some implementations, steps (a) and (b) are each performed independently over time periods of approximately 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, 36 hours, or 48 hours.

[0626] In some embodiments, the cells are immune cells. As used herein, "immune cells" refers to cells of the immune system, including, for example, lymphocytes (e.g., T cells, B cells, natural killer cells ("NK cells," and NKT cells or iNKT cells)), monocytes, macrophages, mast cells, dendritic cells, or granulocytes (e.g., neutrophils, eosinophils, and basophils). In some embodiments, the cells are primary immune cells. In some embodiments, the immune system cells may be selected from CD3+ cells. + CD4 + and CD8 + T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DCs). In some embodiments, the immune cells are allogeneic.

[0627] In some embodiments, the cells are lymphocytes. In some embodiments, the cells are adaptive immune cells. In some embodiments, the cells are T cells. In some embodiments, the cells are B cells. In some embodiments, the cells are NK cells.

[0628] As used herein, a T cell may be defined as a cell that expresses the T cell receptor (“TCR”, “αβ TCR”, or “γδ TCR”). However, in some embodiments, the TCR of a T cell may be genetically modified to reduce its expression (e.g., through genetic modification of the TRAC or TRBC genes), so the expression of the protein CD3 can be used as a marker for identifying T cells using standard flow cytometry methods. CD3 is a multi-subunit signaling complex associated with the TCR. Therefore, a T cell may be referred to as CD3+. In some embodiments, a T cell is a cell that expresses a CD3+ marker as well as a CD4+ or CD8+ marker.

[0629] In some embodiments, the T cells express the glycoprotein CD8 and are therefore CD8+ by standard flow cytometry and may be referred to as “cytotoxic” T cells. In some embodiments, the T cells express the glycoprotein CD4 and are therefore CD4+ by standard flow cytometry and may be referred to as “helper” T cells. CD4+ T cells may differentiate into subsets and may be referred to as Th1 cells, Th2 cells, Th9 cells, Th17 cells, Th22 cells, regulatory T cells (“Treg”), or follicular helper T cells (“Tfh”). Each CD4+ subset releases specific cytokines, which may have pro-inflammatory or anti-inflammatory functions, or survival or protective functions. T cells may be isolated from the subject using CD4+ or CD8+ selection methods.

[0630] In some embodiments, the T cells are memory T cells. In vivo, memory T cells encounter antigens. Memory T cells may be located in secondary lymphoid organs (central memory T cells) or in recently infected tissues (effective memory T cells). Memory T cells may be CD8+ T cells. Memory T cells may be CD4+ T cells.

[0631] As used in this article, “central memory T cells” can be defined as T cells that have experienced antigens and, for example, express CD62L and CD45RO. Central memory T cells can be detected as CD62L+ and CD45RO+, and since central memory T cells also express CCR7, they can be detected as CCR7+ using standard flow cytometry methods.

[0632] As used herein, “early stem cell memory T cells” (or “Tscm”) can be defined as T cells expressing CD27 and CD45RA, and therefore CD27+ and CD45RA+ by standard flow cytometry. Tscm does not express the CD45 isoform CD45RO, and therefore, if stained for this isoform by standard flow cytometry, Tscm will further be CD45RO-. Therefore, CD45RO-CD27+ cells are also early stem cell memory T cells. Tscm cells further express CD62L and CCR7, and can therefore be detected by standard flow cytometry as CD62L+ and CCR7+. Early stem cell memory T cells have been shown to be associated with increased durability and therapeutic efficacy of cell therapy products.

[0633] In some embodiments, the cells are B cells. As used herein, “B cell” can be defined as a cell expressing CD19 or CD20 or B cell maturation antigen (“BCMA”), and therefore, by standard flow cytometry, the B cell is CD19+, or CD20+, or BCMA+. The B cell is further negative for CD3 and CD56 by standard flow cytometry. The B cell can be a plasma cell. The B cell can be a memory B cell. The B cell can be a primary B cell. The B cell can be IgM+, or have a class-switching B cell receptor (e.g., IgG+, or IgA+).

[0634] In some embodiments, the cells are monocytes, such as those derived from bone marrow or peripheral blood. In some embodiments, the cells are peripheral blood mononuclear cells (“PBMCs”). In some embodiments, the cells are PBMCs, such as lymphocytes or monocytes. In some embodiments, the cells are peripheral blood lymphocytes (“PBLs”).

[0635] In some embodiments, the cells are derived from progenitor cells before editing. In some embodiments, the cells are induced pluripotent stem cells (iPSCs).

[0636] Cells used in ACT therapy include, for example, mesenchymal stem cells (e.g., isolated from bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC), or adipose tissue); hematopoietic stem cells (HSCs; e.g., isolated from BM); monocytes (e.g., isolated from BM or PB); endothelial progenitor cells (EPCs; isolated from BM, PB, and UC); neural stem cells (NSCs); limbic stem cells (LSCs); or tissue-specific primary cells or cells derived therefrom (TSCs). Cells used in ACT therapy also include induced pluripotent stem cells (iPSCs; see, for example, Mahla, International J. Cell Biol. 2016 (Article ID 6940283): 1-24 (2016)), which can be induced to differentiate into other cell types, including, for example, pancreatic islet cells, neurons and blood cells; eye stem cells; pluripotent stem cells (PSCs); embryonic stem cells (ESCs); and cells for organ or tissue transplantation, such as pancreatic islet cells, cardiomyocytes, thyroid cells, thymocytes, neurons, skin cells, retinal cells, chondrocytes, muscle cells and keratinocytes.

[0637] In some embodiments, the cells are human cells, such as cells derived from a subject. In some embodiments, the cells are isolated from a human subject. In some embodiments, the cells are isolated from a patient. In some embodiments, the cells are isolated from a donor. In some embodiments, the cells are isolated from human donor PBMCs or leukopak. In some embodiments, the cells are derived from a subject suffering from a disease, ailment, or illness. In some embodiments, the cells are derived from a human donor possessing Epstein-Barr Virus (“Epstein Barr Virus / EBV”).

[0638] In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the cells contain genetic modifications in the HLA-A gene and are homozygous for both HLA-B and HLA-C. In some embodiments, the cells are homozygous for both HLA-A and HLA-C. In some embodiments, the cells contain genetic modifications in the HLA-B gene and are homozygous for both HLA-A and HLA-C. In some embodiments, the cells are homozygous for HLA-C. In some embodiments, the cells contain genetic modifications in both the HLA-A and HLA-B genes and are homozygous for HLA-C.

[0639] In some embodiments, the methods disclosed herein are performed ex vivo. As used herein, "ex vivo" refers to an in vitro method in which cells can be transferred into a subject, for example, as an ACT therapy. In some embodiments, the ex vivo method is an in vitro method involving ACT therapy cells or cell populations.

[0640] In some embodiments, the cells are maintained in a culture. In some embodiments, the cells are transplanted into a patient. In some embodiments, cells are removed from a subject, genetically modified in vitro, and then administered back to the same patient. In some embodiments, cells are removed from a subject, genetically modified in vitro, and then administered back to a subject other than the subject from whom the cells were removed.

[0641] In some embodiments, the cells are derived from a cell line. In some embodiments, the cell line is derived from a human subject. In some embodiments, the cell line is a lymphoblast-like cell line (“LCL”). The cells can be cryopreserved and thawed. The cells may not have been previously cryopreserved.

[0642] In some embodiments, the cells are derived from a cell bank. In some embodiments, the cells are genetically modified and then transferred to a cell bank. In some embodiments, cells are taken from a subject, genetically modified in vitro, and then transferred to a cell bank. In some embodiments, a population of genetically modified cells is transferred to a cell bank. In some embodiments, a population of genetically modified immune cells is transferred to a cell bank. In some embodiments, a population of genetically modified immune cells is transferred to a cell bank, the population comprising a first subpopulation and a second subpopulation, wherein the first subpopulation and the second subpopulation have at least one common genetic modification and at least one different genetic modification.

[0643] In some implementations, the cell population comprises any cells edited using any of the methods or compositions disclosed herein.

[0644] In some embodiments, the cell population comprises edited T cells, and at least 30%, 40%, 50%, 55%, 60%, or 65% of the cells in the population have a memory phenotype (CD27+, CD45RA+).

[0645] In some embodiments, the cell population comprises inactive immune cells. In some embodiments, the cell population comprises activated immune cells.

[0646] In some implementations, the cell population comprises T cells and responds to repeated stimuli after editing. In some implementations, the cell population is cultured, expanded, differentiated, or proliferated in vitro.

[0647] VI. Guide RNA and donor nucleic acid

[0648] In some embodiments, the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the first genome editor. In some embodiments, the first genome editing tool comprises a first genome editor containing a base editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the base editor.

[0649] In some embodiments, the second genome editing tool comprises a second genome editor and at least one gRNA targeting at least one genomic locus and homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor. In some embodiments, the second genome editing tool comprises a second genome editor containing an RNA-guided lyase and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lyase, wherein the base editor is orthogonal to the RNA-guided lyase.

[0650] In some embodiments, the at least one gRNA homologous to a first genome editor or base editor is not homologous to a second genome editor or RNA-guided lyase.

[0651] In some embodiments, the at least one gRNA homologous to a first genome editor or base editor comprises at least two gRNAs targeting at least two different genomic loci. In some embodiments, the at least one gRNA homologous to a second genome editor or RNA-guided lyase comprises at least two gRNAs targeting at least two different genomic loci. In some embodiments, the at least one gRNA homologous to a first genome editor or base editor comprises at least three gRNAs targeting at least three different genomic loci. In some embodiments, the at least one gRNA homologous to a second genome editor or RNA-guided lyase comprises at least three gRNAs targeting at least three different genomic loci. In some embodiments, the at least one gRNA homologous to a first genome editor or base editor comprises at least four gRNAs targeting at least four different genomic loci. In some embodiments, the at least one gRNA homologous to a second genome editor or RNA-guided lyase comprises at least four gRNAs targeting at least four different genomic loci. In some embodiments, the at least one gRNA homologous to a first genome editor or base editor comprises at least five gRNAs targeting at least five different genomic loci. In some embodiments, the at least one gRNA homologous to a second genome editor or an RNA-guided lyase comprises at least five gRNAs targeting at least five different genomic loci. In some embodiments, the at least one gRNA homologous to a first genome editor or a base editor comprises at least six gRNAs targeting at least six different genomic loci. In some embodiments, one, two, three, four, five, or six of the first genome editor and the at least one gRNA homologous to the first genome editor or a base editor and targeting different genomic loci are contained in the same lipid nanoparticle (LNP). In some embodiments, the base editor or the at least one gRNA homologous to a second genome editor or an RNA-guided lyase comprises at least six gRNAs targeting at least six different genomic loci.

[0652] A. Target sequences and genes

[0653] In some embodiments, the methods and compositions of this disclosure utilize a CRISPR / Cas system to cleave a target sequence at at least one genomic locus targeted by a guide RNA. For example, the target sequence may be recognized and cleaved by a Cas nuclease. In some embodiments, the target sequence of the Cas nuclease is located near a homologous PAM sequence of the nuclease. In some embodiments, a class 2 Cas nuclease may be guided by gRNA to the target sequence of the gene, wherein the gRNA hybridizes with the target sequence and the class 2 Cas protein cleaves the target sequence. In some embodiments, the guide RNA hybridizes with the target sequence and the class 2 Cas nuclease cleaves the target sequence, the target sequence being adjacent to or containing its homologous PAM. In some embodiments, the target sequence may be complementary to the target sequence of the guide RNA. In some embodiments, the degree of complementarity between the target sequence of the guide RNA and the portion of the corresponding target sequence that hybridizes with the guide RNA may be about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the percentage of identity between the target sequence of the guide RNA and the portion of the corresponding target sequence that hybridizes with the guide RNA may be about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the homologous region of the target is adjacent to a homologous PAM sequence. In some embodiments, the target sequence may contain a sequence that is 100% complementary to the target sequence of the guide RNA. In other embodiments, the target sequence may contain at least one mismatch, deletion, or insertion compared to the target sequence of the guide RNA.

[0654] The length of the target sequence may depend on the nuclease system used. For example, the target sequence for guide RNA used in a CRISPR / Cas system may contain 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more nucleotides, and the target sequence has the corresponding length, optionally adjacent to the PAM sequence. In some embodiments, the target sequence may contain 15-24 nucleotides. In some embodiments, the target sequence may contain 17-21 nucleotides. In some embodiments, the target sequence may contain 20 nucleotides. In some embodiments, the target sequence may contain 24 nucleotides. When a nicking enzyme is used, the target sequence may contain a pair of target sequences that are recognized by a pair of nicking enzymes that cleave the opposite strands of the DNA molecule. In some embodiments, the target sequence may comprise a pair of target sequences recognized by a pair of cleavage enzymes on the same strand of the DNA molecule. In some embodiments, the target sequence may comprise a portion of a target sequence recognized by one or more Cas nucleases.

[0655] The target nucleic acid molecule can be any DNA or RNA molecule, whether endogenous or exogenous within the cell. In some embodiments, the target nucleic acid molecule can be free DNA, plasmid, genomic DNA, viral genome, or chromosomal DNA. In some embodiments, the target sequence of the gene can be a genomic sequence derived from or within a cell, including human cells.

[0656] In other embodiments, the target sequence may be a viral sequence. In other embodiments, the target sequence may be a pathogen sequence. In other embodiments, the target sequence may be a synthetic sequence. In other embodiments, the target sequence may be a chromosomal sequence. In some embodiments, the target sequence may contain translocation adapters, such as cancer-related translocations. In some embodiments, the target sequence may be on a eukaryotic chromosome, such as a human chromosome.

[0657] In some embodiments, the target sequence may be located within a genomic locus; for example, the target sequence may be located within the coding sequence of a gene, an intronic sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or a non-coding sequence between genes (e.g., intergenetic space). In some embodiments, the gene may be a protein-coding gene. In other embodiments, the gene may be a non-coding RNA gene. In some embodiments, the target sequence may comprise all or part of a disease-related gene. In some embodiments, the target sequence may be located at a non-gene functional site in the genome, such as a site controlling aspects of chromatin organization, like a scaffold site or a locus control region.

[0658] In some embodiments involving Cas nucleases (such as class 2 Cas nucleases), the target sequence may be adjacent to a protospacer adjacent motif (“PAM”). In some embodiments, the PAM may be adjacent to or within 1, 2, 3, or 4 nucleotides at the 3′ end of the target sequence. The length and sequence of the PAM may depend on the Cas protein used. For example, the PAM may be selected from a specific SpyCas9 protein or a consistent or specific PAM sequence of a SpyCas9 ortholog, including those PAM sequences disclosed in Figure 1 of Ran et al., Nature, 520:186-191 (2015) and Figure S5 of Zetsche 2015, the relevant disclosures of which are incorporated herein by reference. In some embodiments, the length of the PAM may be 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. Non-limiting exemplary PAM sequences include NGG, NGNNG, NG, NAAAAN, NNAAAAW, NNNNACA, GNNNCNNA, TTN, and NNNNGATT (where N is defined as any nucleotide and W is defined as A or T). In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGNNG. In some embodiments, the PAM sequence may be TTN. In some embodiments, the PAM sequence may be NNAAAAW.

[0659] In some embodiments, the PAM may be selected from a specific Nme Cas9 protein or a consistent or specific PAM sequence of an Nme Cas9 ortholog (Edraki et al., 2019). In some embodiments, the Nme Cas9 PAM may contain 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. Non-limiting exemplary PAM sequences include NCC, N4GAYW, N4GYTT, N4GTCT, NNNNCC(a), NNNNCAAA (where N is defined as any nucleotide, W is defined as A or T, and R is defined as A or G; and (a) is a preferred but not required A following the second C). In some embodiments, the PAM sequence may be NCC.

[0660] In some embodiments, the at least one gRNA homologous to a first genome editor or a base editor, or the at least one gRNA homologous to a second genome editor or an RNA-guided lyase, comprises at least one single guide RNA (sgRNA). In some embodiments, the at least one gRNA homologous to a first genome editor or a base editor, or the at least one gRNA homologous to a second genome editor or an RNA-guided lyase, is a short single guide RNA (short sgRNA), the short sgRNA comprising a conserved portion of sgRNA containing a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides, and wherein the short sgRNA contains a 5′ end modification or a 3′ end modification or both.

[0661] In some embodiments, the at least one gRNA homologous to a first genome editor or base editor targets one or more genes selected from the following loci: TRBC, HLA-A, HLA-B, CIITA, HLA-DR, HLA-DQ, and HLA-DP. In some embodiments, the at least one gRNA homologous to a second genome editor or RNA-guided lyase targets one or more genomic loci selected from the following loci: TRAC, AAVS1, and CIITA.

[0662] In some embodiments, (i) the at least one gRNA homologous to a first genome editor or base editor comprises a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to a second genome editor or RNA-guided lyase comprises a gRNA targeting the TRAC locus; (ii) the at least one gRNA homologous to a first genome editor or base editor comprises a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to a second genome editor or RNA-guided lyase comprises a gRNA targeting the TRBC locus. (iii) The at least one gRNA homologous to the first genome editor or base editor comprises a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or RNA-guided lyase comprises a gRNA targeting the TRAC locus; (iv) The at least one gRNA homologous to the first genome editor or base editor comprises a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or RNA-guided lyase comprises a gRNA targeting the TRAC locus; (v) At least one gRNA homologous to a second genome editor or an RNA-guided lyase contains a gRNA targeting the TRAC locus; (vi) the at least one gRNA homologous to a first genome editor or a base editor contains a gRNA targeting the HLA-A locus and a gRNA targeting the HLA-DR, HLA-DQ, or HLA-DP locus, and the at least one gRNA homologous to a second genome editor or an RNA-guided lyase contains a gRNA targeting the TRAC locus; (vi) the at least one gRNA homologous to a first genome editor or a base editor contains a gRNA targeting the TRBC locus and a gRNA targeting the HLA-A locus. NA and gRNAs targeting the HLA-DR, HLA-DQ, or HLA-DP loci, wherein at least one gRNA homologous to a second genome editor or RNA-guided lyase contains a gRNA targeting the TRAC locus; (vii) at least one gRNA homologous to a first genome editor or base editor contains a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR, HLA-DQ, or HLA-DP locus, wherein at least one gRNA homologous to a second genome editor or RNA-guided lyase contains a gRNA targeting the TRAC locus;(viii) The at least one gRNA homologous to the first genome editor or base editor comprises a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, the HLA-DQ locus, or the HLA-DP locus, and the at least one gRNA homologous to the second genome editor or RNA-guided lyase comprises a gRNA targeting the TRBC locus; (ix) The at least one gRNA homologous to the first genome editor or base editor comprises a gRNA targeting the TRBC locus, a gRNA targeting the TRBC locus, and a gRNA targeting the TRBC locus. RNA, gRNA targeting the CIITA locus and gRNA targeting the HLA-A locus, wherein at least one gRNA homologous to a second genome editor or RNA-guided lyase includes a gRNA targeting the TRAC locus; (x) at least one gRNA homologous to a first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, wherein at least one gRNA homologous to a second genome editor or RNA-guided lyase includes a gRNA targeting the AAVS1 locus; (xi) at least one gRNA homologous to a first genome editor or base editor includes a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus and a gRNA targeting the CIITA locus, wherein at least one gRNA homologous to a second genome editor or RNA-guided lyase includes a gRNA targeting the AAVS1 locus; The gRNA homologous to the genome editor or base editor includes gRNA targeting the TRBC locus, gRNA targeting the HLA-A locus, gRNA targeting the HLA-B locus, and gRNA targeting the CIITA locus, and the at least one gRNA homologous to the second genome editor or RNA-guided lyase includes gRNA targeting the AAVS1 locus; (xii) the at least one gRNA homologous to the first genome editor or base editor includes gRNA targeting the TRBC locus, gRNA targeting the HLA-A locus, and gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus. (xiii) The at least one gRNA homologous to the second genome editor or RNA-guided lyase contains a gRNA targeting the AAVS1 locus; and the at least one gRNA homologous to the first genome editor or base editor contains a gRNA targeting the TRBC locus, a gRNA targeting the HLA-A locus, a gRNA targeting the HLA-B locus, and a gRNA targeting the HLA-DR locus, HLA-DQ locus, or HLA-DP locus, and the at least one gRNA homologous to the second genome editor or RNA-guided lyase contains a gRNA targeting the AAVS1 locus.

[0663] In some embodiments, in any of the above subsections (i) to (ix), the at least one gRNA homologous to the second genome editor or RNA-guided lyase comprises another gRNA targeting the AAVS1 locus. In some embodiments, in any of the above subsections (x) to (xiii), the at least one gRNA homologous to the second genome editor or RNA-guided lyase comprises another gRNA targeting the TRAC locus. In some embodiments, after contacting the cells with the gRNA targeting the TRAC locus, the cells are contacted with another gRNA targeting the AAVS1 locus. In some embodiments, after contacting the cells with the gRNA targeting the AAVS1 locus, the cells are contacted with another gRNA targeting the TRAC locus.

[0664] B. Modified gRNA

[0665] In the case of sgRNA, the guide sequence may also contain other nucleotides to form sgRNA, such as the following exemplary nucleotide sequence after the 3′ end of the guide sequence: 5′ to 3′ oriented GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SE QID NO: 226).

[0666] In the case of sgRNA, the guide sequence may also contain other nucleotides to form sgRNA, such as the following exemplary nucleotide sequence after the 3′ end of the guide sequence: 5′ to 3′ oriented GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU U (SEQ ID NO: 227).

[0667] In the case of sgRNA, the guide sequence can be integrated into the following modified motif: mN*mN*mN*NNNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmGmCmAmCmCmGmAmGmUmGmGmCmGmGmGmGmCmU*mU*mU*mU (SEQ ID NO: 228), where “N” can be any natural or non-natural nucleotide, preferably an RNA nucleotide; the sugar portion of the nucleotide can be ribose, deoxyribose, or a similar compound with substitution; m is a 2′-O-methyl modified nucleotide, and * is a phosphate thioester bonded to an adjacent nucleotide residue; and N together form the nucleotide sequence of the guide sequence. In the case of modified sequences, unless otherwise indicated, A, C, G, N, and U are unmodified RNA nucleotides, i.e., 2′-OH sugar moieties with phosphodiesterase bonds to adjacent nucleotide residues, or 5′-terminal PO4.

[0668] In the case of sgRNA, the guide sequence may also include a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in Table YY (SEQ ID NO: 226: GUUUUAGAGC UAGAAAUAGC AAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGC - "Exemplary SpyCas9 sgRNA-1"), which is included at the 3′ end of the guide sequence and is provided together with the domains shown in Table YY below. LS is the lower stem. B is the protrusion. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 are collectively referred to as the hairpin region. The model of the structure is in WO2019237069. Figure 10A The document is provided in [the document name], and is incorporated herein by reference.

[0669] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can be used as a template sequence for specific chemical modifications, sequence substitutions, and truncations.

[0670] In some embodiments, the gRNA is, for example, sgRNA or dgRNA, and optionally contains chemical modifications. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, such as the exemplary SpyCas9sgRNA-1. The gRNA (such as sgRNA) may include modifications at the 5′ end of the guide sequence or the 3′ end of the SpyCas9 sgRNA sequence, such as at one or more terminal nucleotides in the exemplary SpyCas9sgRNA-1, for example at 1, 2, 3, or 4 nucleotides at the 3′ or 5′ end. In some embodiments, the modified nucleotide is selected from 2′-O-methyl (2′-OMe) modified nucleotides, 2′-O-(2-methoxyethyl) (2′-O-moe) modified nucleotides, 2′-fluoro (2′-F) modified nucleotides, phosphate thioester (PS) linked nucleotides, or reverse-base-free nucleotides; or combinations thereof. In some embodiments, the modified nucleotide includes 2′-OMe modified nucleotides. In some embodiments, the modified nucleotide includes a PS bond. In some embodiments, the modified nucleotide includes a 2′-OMe modified nucleotide and a PS bond.

[0671] In some embodiments, using SEQ ID NO: 226 (“Exemplary SpyCas9 sgRNA-1”) as an example, Exemplary SpyCas9 sgRNA-1 further includes one or more of the following: (A) a shortened hairpin 1 region or a substituted and optionally shortened hairpin 1 region, wherein (1) at least one of the following nucleotide pairs in hairpin 1 is substituted with Watson-Crick paired nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and said hairpin 1 region is optionally absent. (a) any one or both of H1-5 to H1-8, (b) one, two or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or (c) 1-8 nucleotides in hairpin region 1; or (2) the shortened hairpin region 1 is missing 4-8 nucleotides, preferably 4-6 nucleotides, and (a) relative to the exemplary SpyCas9 (a) sgRNA-1 (SEQ ID NO: 226), where one or more of positions H1-1, H1-2, or H1-3 are missing or substituted; or (b) relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), where one or more of positions H1-6 to H1-10 are substituted; or (c) the shortened hairpin 1 region is missing 5-10 nucleotides, preferably 5-6 nucleotides, and relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), where one or more of positions N18, H1-12, or n are substituted; or (b) the shortened upper stem region, wherein the shortened upper stem region is missing 1-6 nucleotides and wherein, relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226), 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include fewer than or equal to 4 substitutions; or (c) relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 226) is substituted at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine followed by adenine nor an adenine preceded by a pyrimidine.Or (D) an exemplary SpyCas9sgRNA-1 (SEQ ID NO: 226) having an upper stem region, wherein the upper stem modification comprises modification of any one or more of US1-US12 in the upper stem region, wherein (1) the modified nucleotide is optionally selected from 2′-O-methyl (2′-OMe) modified nucleotides, 2′-O-(2-methoxyethyl)(2′-O-moe) modified nucleotides, 2′-fluoro (2′-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof; or (2) the modified nucleotide optionally includes 2′-OMe modified nucleotides.

[0672] In some embodiments, the sgRNA comprises a modified motif disclosed herein, including a modified motif of any of SEQ ID NOs: 228-242 and 246-250, 312-314, or any other modified motif shown in the sequence listing, wherein “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; the sugar portion of the nucleotide may be ribose, deoxyribose, or a similar compound with substitutions; m is a 2′-O-methyl modified nucleotide, and * is a phosphate thioester bonded to an adjacent nucleotide residue; and wherein N together form a nucleotide sequence of a guide sequence.

[0673] In some embodiments, using SEQ ID NO: 400 (“Exemplary NmeCas9sgRNA-1” as shown in Table 20) as an example, Exemplary NmeCas9 sgRNA-1 comprises: (A) a guide RNA (gRNA) comprising a guide region and a conserved region, the conserved region comprising one or more of the following: (a) a shortened repeat / anti-repetition sequence region, wherein the shortened repeat / anti-repetition sequence region is missing 2-24 nucleotides, wherein (i) relative to SEQ ID NO: 400, one or more of nucleotides 37-48 and 53-64 are missing and optionally one or more of nucleotides 37-64 are substituted; and (ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or (b) a shortened hairpin 1 region, wherein the shortened hairpin 1 is missing 2-10, optionally 2-8 ... the shortened hairpin 1 is missing 2-10, optionally 2-8 nucleotides, wherein (i) relative to SEQ ID NO: 400, the shortened hairpin 1 is missing 2-10, optionally 2-8 nucleotides; and (ii) relative to SEQ ID NO: 400, the shortened hairpin 1 is missing 2-10, optionally 2-8 nucleotides; wherein (i) relative to SEQ ID NO: 400, the NO: 400, one or more of nucleotides 82-86 and 91-95 are missing and optionally one or more of positions 82-96 are substituted; and (ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or (c) a shortened hairpin 2 region, wherein the shortened hairpin 2 is missing 2-18, optionally 2-16 nucleotides, wherein (i) relative to SEQ ID NO: 400, one or more of nucleotides 113-121 and 126-134 are missing and optionally one or more of nucleotides 113-134 are substituted; and (ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein relative to SEQ ID NO: 400, one or both of nucleotides 144-145 are optionally missing; wherein optionally at least 10 nucleotides are modified nucleotides.

[0674] Exemplary unmodified conserved partial nucleotide sequences include: GUUGUAGCUCCCUUUCUCAUUUCGGAAACGAAAUGAGAACCGUUGCUACAAUAAGGCCGUCUGAAAAGAUGUGCCGCAACGCUCUGCCCCUUAAAGCUUCUGCUUUAAGGGGCAUCGUUUA (SEQ ID NO: 243); GUUGUAGCU CCCUGAAACCGUUGCUACAAUAAGGCCGUCGAAAGAUGUGCCGCAACGCUCUGCCUUCUGGCAUCGUU (SEQ ID NO: 244); and GUUGUAGCUCCCU GGAAACCCGUUGCUACAAUAAGGCCGUCGAAAGAUGUGCCGCAACGCUCUGCCUUCUGGCAUCGUUUAUU (SEQ ID NO: 245).

[0675] In the case of sgRNA, the guide sequence can be integrated into one of the following exemplary modified conserved motifs: GUUGmUmAmGmCUCCCmUmGmAmAmCmCG UUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmGmAmUGUGCmCGCmAmAmCmGCUCUmGmCCmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 246) and GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUm GmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU (SEQ ID NO: 247).

[0676] In some embodiments, the guide sequence is 20-25 nucleotides in length ((N)20-25), wherein each nucleotide may be modified independently. In some embodiments, each of the nucleotides 1-3 at the 5' end of the guide is modified independently. In some embodiments, each of the nucleotides 1-3 at the 5' end of the guide is modified independently by 2'-OMe modification. In some embodiments, each of the nucleotides 1-3 at the 5' end of the guide is modified independently by phosphate thioester bonding with adjacent nucleotide residues. In some embodiments, each of the nucleotides 1-3 at the 5' end of the guide is modified independently by 2'-OMe modification and phosphate thioester bonding with adjacent nucleotide residues.

[0677] In the case of sgRNA, the modified guide sequence can be integrated into one of the following exemplary modified conserved motifs: mN*mNNNNNNNNmNNNmNNNNNNN NNNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGCmAmAmCmGCUCUmGmCCmUmUmCmUGmGCmAmUC*mG*mU*mU (SEQ ID NO: 248); (N) 20-25GUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCU AmCAAU*AAGmGmCCmGmUmCmGm AmAmAmGmAmUGUGC mCGCmAmAmCmGCUCUmGmCCmUmUmCmUGmGCmAmUC*mG*mU*mU(SEQ ID NO: 249); mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU(SEQ ID NO: 250); or mN*mN*mN*mNmNNNmN mNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*mU(SEQ ID NO: 312), mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNN mNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGmCmUmCmUmGmCCmUmUmCmUGGCAUCG*mU*mU(SEQ ID NO: 313); mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmCUCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAmAmAmGmAmUGUGCmCGmCAAmCGmCmUmCmUmGmCCmUmUmCmUGGCAUCG*mU*mU(SEQ ID NO: 314), any one of them.

[0678] In some embodiments, the exemplary SpyCas9sgRNA-1 or sgRNA (e.g., sgRNA containing the exemplary SpyCas9sgRNA-1) further includes a 3′ tail, such as a 3′ tail of 1, 2, 3, 4, or more nucleotides. In some embodiments, the tail includes one or more modified nucleotides. In some embodiments, the modified nucleotide is selected from 2′-O-methyl (2′-OMe) modified nucleotides, 2′-O-(2-methoxyethyl) (2′-O-moe) modified nucleotides, 2′-fluoro (2′-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free modified nucleotides; or combinations thereof. In some embodiments, the modified nucleotide includes a 2′-OMe modified nucleotide. In some embodiments, the modified nucleotide includes a PS bond between nucleotides. In some embodiments, the modified nucleotide includes a 2′-OMe modified nucleotide and a PS bond between nucleotides.

[0679] In some embodiments, the hairpin region includes one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2′-O-methyl (2′-OMe) modified nucleotides, 2′-O-(2-methoxyethyl)(2′-O-moe) modified nucleotides, 2′-fluoro (2′-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof. In some embodiments, the modified nucleotides include 2′-OMe modified nucleotides.

[0680] In some embodiments, the upper stem region includes one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2′-O-methyl (2′-OMe) modified nucleotides, 2′-O-(2-methoxyethyl) (2′-O-moe) modified nucleotides, 2′-fluoro (2′-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof. In some embodiments, the modified nucleotides include 2′-OMe modified nucleotides.

[0681] In some embodiments, the exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is pyrimidine, and the YA dinucleotide comprises a modified nucleotide. In some embodiments, the modified nucleotide is selected from 2′-O-methyl (2′-OMe) modified nucleotides, 2′-O-(2-methoxyethyl) (2′-O-moe) modified nucleotides, 2′-fluoro (2′-F) modified nucleotides, phosphate thioester (PS) bonds between nucleotides, reverse-base-free nucleotides, or combinations thereof. In some embodiments, the modified nucleotide comprises a 2′-OMe modified nucleotide.

[0682] In some embodiments, the exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is pyrimidine, and the YA dinucleotide includes a sequence-substituted nucleotide in which pyrimidine replaces a purine. In some embodiments, when pyrimidine forms a Watson-Crick base pair in a single guide, the sequence-substituted pyrimidine nucleotide of the Watson-Crick-based nucleotide is substituted to maintain the Watson-Crick base pairing.

[0683] In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nucleosides or nucleotides is referred to as "modified" gRNA or "chemically modified" gRNA to describe the presence of one or more non-natural or naturally occurring components or configurations used to replace or complement canonical A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized using non-canonical nucleosides or nucleotides, and is referred to herein as "modified". Modified nucleosides and nucleotides may include one or more of the following: (i) altering (e.g., replacing) one or two non-linked phosphate oxygens or one or more linked phosphate oxygens in the phosphodiester backbone (exemplary backbone modification); (ii) altering (e.g., replacing) a component of the ribose (e.g., the 2′ hydroxyl group on the ribose) (exemplary sugar modification); (iii) modifying or replacing a native nucleobase, including using a non-canonical nucleobase (exemplary base modification); and (iv) modifying the 3′ or 5′ end of an oligonucleotide to provide external nuclease stability, such as ribose modified with 2′O-me, 2′ halide, or 2′ deoxy substitution; or a reverse base-free terminal nucleotide, or replacing the phosphodiester with a thiophosphate.

[0684] Chemical modifications (such as those listed above) can be combined to provide modified gRNA or mRNA comprising two, three, four, or more modified nucleosides and nucleotides (collectively, “residues”). For example, the modified residues may have modified sugars and modified nucleobases. In some embodiments, all or substantially all phosphate groups of the gRNA molecule are replaced with thiophosphate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5′ end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3′ end of the RNA.

[0685] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of the modified gRNA is a modified nucleoside or nucleotide. In some embodiments, at least 5% of the modified guide RNA is a modified nucleotide or nucleoside. In some embodiments, at least 10% of the modified guide RNA is a modified nucleotide or nucleoside. In some embodiments, at least 15% of the modified gRNA is a modified nucleotide or nucleoside. In some embodiments, preferably at least 20% of the modified gRNA is a modified nucleotide or nucleoside. In some embodiments, no more than 65% of the modified gRNA is a modified nucleotide. In some embodiments, no more than 55% of the modified gRNA is a modified nucleotide. In some embodiments, no more than 50% of the modified gRNA is a modified nucleotide. In some embodiments, 10%-70% of the modified gRNA consists of modified nucleotides. In some embodiments, 20%-70% of the modified gRNA consists of modified nucleotides. In some embodiments, 20%-50% of the modified gRNA consists of modified nucleotides, and the nuclease is SpyCas9. In some embodiments, 30%-70% of the modified gRNA consists of modified nucleotides, and the nuclease is NmeCas9.

[0686] Unmodified nucleic acids are readily degraded by, for example, intracellular nucleases or those found in serum. Nucleases, for instance, can hydrolyze the phosphodiester bonds of nucleic acids. Therefore, in one respect, the gRNAs described herein may contain one or more modified nucleosides or nucleotides, for example, to introduce stability against intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit a reduced innate immune response when introduced into a cell population in vivo and in vitro. The term "innate immune response" includes cellular responses to exogenous nucleic acids (including single-stranded nucleic acids) involving the induction of cytokine expression and release (particularly interferons), and cell death.

[0687] In some embodiments of main-chain modification, the phosphate ester group of the modified residue can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, the modified residue (e.g., the modified residue present in a modified nucleic acid) may include replacing an unmodified phosphate ester moiety with a modified phosphate ester group as described herein. In some embodiments, main-chain modification of the phosphate ester backbone may include alterations that produce uncharged joints or charged joints with an asymmetric charge distribution.

[0688] Examples of modified phosphate groups include thiophosphates, boroalkyl phosphates, methylphosphonates, aminophosphates, dithiophosphates, alkyl or aryl phosphonates, and phosphate triesters. The phosphorus atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygen atoms with one of the aforementioned atoms or groups can make the phosphorus atom chiral. The stereosource phosphorus atom can have an "R" configuration (Rp in this document) or an "S" configuration (Sp in this document). The backbone can also be modified by replacing the bridging oxygen (i.e., the oxygen linking the phosphate to the nucleoside) with nitrogen (bridging aminophosphates), sulfur (bridging thiophosphates), and carbon (bridging methylenephosphonates). The substitution can occur at any of the linked oxygens or at both linked oxygens.

[0689] In certain main-chain modifications, the phosphate ester group may be replaced by a phosphorus-free linking group (e.g., an amide bond). In some embodiments, the charged phosphate ester group may be replaced by a neutral portion. Examples of portions that can replace the phosphate ester group may include (but are not limited to) methylphosphonates, carboxymethyl groups, carbamates, amides, and thioethers. Other examples of portions that can replace the phosphate ester group may include (but are not limited to) ethylene oxide connectors, sulfonates, sulfonamides, thiomethyl acetals, methyl acetals, methyleneimino, methylenemethylimino, methylenehydrazine, methylenedimethylhydrazine, and methyleneoxymethylimino.

[0690] Nucleic acid-mimicking scaffolds can also be constructed in which phosphate linkers and ribose are replaced by nuclease-resistant nucleosides or nucleotide substitutes. Such modifications can include backbone and sugar modifications. In some embodiments, nucleobases can be bound by substituted backbones. Examples may include (but are not limited to) morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes.

[0691] Modified nucleosides and modified nucleotides may include one or more modifications to the sugar group, i.e., sugar modification. For example, the 2′ hydroxyl group (OH) may be modified, for example, by substitution with various different “oxygen” or “deoxy” substituents. In some embodiments, modification of the 2′ hydroxyl group can enhance the stability of nucleic acids because the hydroxyl group can no longer be deprotonated to form a 2′-alkoxide ion.

[0692] Examples of 2′ hydroxyl modification may include alkoxy or aryloxy (OR, where “R” can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG); O(CH2CH2O)nCH2CH2OR, where R can be, for example, H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, 2′ hydroxyl modification may be 2′-O-Me. In some embodiments, 2′ hydroxyl modification may be 2′-fluorinated, where the 2′ hydroxyl group is replaced by a fluoride. In some embodiments, the 2′ hydroxyl...

Claims

1. A method for genetically modifying a cell, the method comprising: (a) contacting the cell with a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the first genome editor; and (b) contacting the cell with a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA that targets at least one genomic locus and is homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor, Thereby, at least two genome edits are produced in the cell.

2. The method of claim 1, wherein the first genome editor or the second genome editor is delivered to the cell as at least one polypeptide or at least one polynucleotide encoding the polypeptide.

3. The method of claim 2, wherein the at least one polynucleotide is at least one mRNA.

4. The method of any one of claims 1-3, wherein the at least one gRNA is delivered to the cell as at least one polynucleotide encoding the gRNA.

5. The method of any one of claims 1-4, wherein the first genome editor comprises a lyase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

6. The method of any one of claims 1-5, wherein the second genome editor comprises a lyase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

7. The method of any one of claims 1-6, wherein one of the first genome editor and the second genome editor comprises a base editor, optionally a C to T base editor or an A to G base editor, and the other of the first genome editor and the second genome editor comprises a lytic enzyme.

8. The method of claim 7, further comprising contacting the cell with a nucleic acid encoding an exogenous gene.

9. The method of any one of claims 1-8, wherein one of the first genome editor and the second genome editor comprises a Neisseria meningitidis (Nme) RNA-guided nickase or lyase, and the other of the first genome editor and the second genome editor comprises a Streptococcus pyogenes (Spy) RNA-guided nickase or lyase.

10. The method of any one of claims 1-9, wherein the first genome editor or the second genome editor comprises Nmel Cas9, Nme2Cas9, Nme3 Cas9 or SpyCas9.

11. A method for genetically modifying a cell, the method comprising: (a) contacting the cell with a first genome editing tool comprising a first genome editor comprising a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and (b) contacting the cell with a second genome editing tool comprising a second genome editor comprising an RNA-guided lytic enzyme and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lytic enzyme, wherein the base editor is orthogonal to the RNA-guided lytic enzyme, Thereby, at least two genome edits are produced in the cell.

12. A method for producing a cell population comprising edited cells, the method comprising: (a) contacting the cell with a first genome editing tool comprising a first genome editor comprising a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; (b) contacting the cell with a second genome editing tool comprising a second genome editor comprising an RNA-guided lytic enzyme and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lytic enzyme, wherein the base editor is orthogonal to the RNA-guided lytic enzyme; and (c) culturing the cells to thereby produce a cell population comprising edited cells, each of which comprises at least two genome edits.

13. The method of claim 11 or 12, wherein the base editor is a C to T base editor, optionally comprising a cytidine deaminase, or is an A to G base editor, optionally comprising an adenosine deaminase.

14. The method of any one of claims 1-13, wherein one of the at least two genome edits comprises a double strand break and the other of the at least two genome edits comprises a transition or a base editor (e.g., A to G or C to T).

15. The method of any one of claims 1-14, wherein the first genome editing tool or the second genome editing tool is delivered to the cell via at least one lipid nanoparticle (LNP).

16. The method of claims 1-15, wherein step (a) and step (b) are performed simultaneously.

17. The method of any one of claims 1-16, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 3, 146 or 311.

18. The method of any one of claims 1-17, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 1, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to any one of SEQ ID NOs: 180-190.

19. The method of any one of claims 1-18, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 147 or 310, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 293 or 295.

20. The method of any one of claims 1-16, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to any one of SEQ ID NOs: 9, 12, 18 and 21.

21. The method of any one of claims 1-20, wherein the first genome editor or the base editor comprises a cytidine deaminase, and wherein the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO:

22.

22. The method of claim 21, wherein the cytidine deaminase comprises APOBEC3A deaminase (A3A).

23. The method of any one of claims 1-22, wherein the first genome editor or the base editor comprises a Cas9 nickase.

24. The method of any one of claims 1-23, wherein the first genome editor or the base editor comprises a Neisseria meningitidis (Nme) Cas9 nickase.

25. The method of any one of claims 1-24, wherein the first genome editor or the base editor comprises a D16A NmeCas9 nickase, optionally D16ANme2Cas9.

26. The method of any one of claims 1-25, wherein the second genome editor or the RNA-guided lyase comprises a Cas9 lyase.

27. The method of any one of claims 1-26, wherein the second genome editor or the RNA-guided lytic enzyme comprises a Streptococcus pyogenes (Spy) Cas9 lytic enzyme.

28. The method of any one of claims 1-23, wherein the first genome editor or the base editor comprises a Streptococcus pyogenes (Spy) Cas9 nickase.

29. The method of any one of claims 1-23 and 28, wherein the first genome editor or the base editor comprises a D10A SpyCas9 nickase.

30. The method of any one of claims 1-23 and 29, wherein the second genome editor or the RNA-guided lytic enzyme comprises a Neisseria meningitidis (Nme) Cas9 lytic enzyme.

31. The method of any one of claims 1-30, wherein at least one gRNA homologous to the first genome editor or the base editor is not homologous to the second genome editor or the RNA-guided lytic enzyme.

32. The method of any one of claims 1-31, wherein at least one gRNA homologous to the second genome editor or the RNA-guided lytic enzyme is not homologous to the first genome editor or the base editor.

33. The method of any one of claims 1-32, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

34. The method of any one of claims 1-33, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

35. The method of any one of claims 1-34, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci.

36. The method of any one of claims 1-35, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

37. A composition comprising: (a) a first genome editing tool, wherein the first genome editing tool comprises a first genome editor and at least one guide RNA (gRNA) that targets at least one genomic locus and is homologous to the first genome editor; and (b) a second genome editing tool, wherein the second genome editing tool comprises a second genome editor and at least one gRNA targeting at least one genomic locus and homologous to the second genome editor, wherein the first genome editor is orthogonal to the second genome editor.

38. The composition of claim 37, wherein the first genome editor or the second genome editor comprises at least one polypeptide or at least one mRNA.

39. The composition of claim 37 or 38, wherein the at least one gRNA comprises at least one polynucleotide encoding the gRNA.

40. The composition of any one of claims 37-39, wherein the first genome editor comprises a lyase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

41. The composition of any one of claims 37-40, wherein the second genome editor comprises a lyase, a nickase, a catalytically inactive nuclease, a base editor, optionally a C to T base editor or an A to G base editor, or a fusion protein comprising a DNA polymerase and a nickase.

42. The composition of any one of claims 37-41, wherein one of the first genome editor and the second genome editor comprises a base editor, optionally a C to T base editor or an A to G base editor, and the other of the first genome editor and the second genome editor comprises a lytic enzyme.

43. The composition of claim 42, further comprising a nucleic acid encoding an exogenous gene.

44. The composition of any one of claims 37-41, wherein one of the first genome editor and the second genome editor comprises a C to T base editor and the other of the first genome editor and the second genome editor comprises an A to G base editor.

45. The composition of any one of claims 37-44, wherein one of the first genome editor and the second genome editor comprises a Neisseria meningitidis (Nme) RNA-guided nickase and the other of the first genome editor and the second genome editor comprises a Streptococcus pyogenes (Spy) RNA-guided nickase.

46. ​​The composition of any one of claims 37-45, wherein the first genome editor or the second genome editor is Nme1Cas9, Nme2Cas9, Nme3 Cas9, or SpyCas9.

47. A composition comprising: (a) a first genome editing tool, wherein the first genome editing tool comprises a first genome editor comprising a base editor and at least one guide RNA (gRNA) targeting at least one genomic locus and homologous to the base editor; and (b) a second genome editing tool comprising a second genome editor comprising an RNA-guided lytic enzyme and at least one gRNA targeting at least one genomic locus and homologous to the RNA-guided lytic enzyme, wherein the base editor is orthogonal to the RNA-guided lytic enzyme.

48. The composition of claim 47, wherein the base editor is a C to T base editor, optionally comprising a cytidine deaminase, or an A to G base editor, optionally comprising an adenosine deaminase.

49. The composition of any one of claims 37-48, wherein the first genome editing tool or the second genome editing tool is contained in at least one lipid nanoparticle (LNP).

50. The composition of any one of claims 37-49, wherein the first genome editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 3, 146 or 311.

51. The composition of any one of claims 37-50, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 1, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to any one of SEQ ID NOs: 180-190.

52. The composition of any one of claims 37-51, wherein the first genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 147 or 310, and the second genome editor is delivered to the cell as a nucleic acid comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 293 or 295.

53. The composition of any one of claims 37-49, wherein the first genome editor or the base editor comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98% or 100% identical to any one of SEQ ID NOs: 9, 12, 18 and 21.

54. The composition of any one of claims 37-53, wherein the first genome editor or the base editor comprises a cytidine deaminase, and wherein the cytidine deaminase comprises an amino acid sequence that is at least 80%, 85%, 87%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO:

22.

55. The composition of claim 54, wherein the cytidine deaminase comprises APOBEC3A deaminase (A3A).

56. The composition of any one of claims 37-55, wherein the first genome editor or the base editor comprises a Cas9 nickase.

57. The composition of any one of claims 37-56, wherein the first genome editor or the base editor comprises a Neisseria meningitidis (Nme) Cas9 nickase.

58. The composition of any one of claims 37-57, wherein the first genome editor or the base editor comprises a D16ANmeCas9 nickase, optionally D16ANme2Cas9.

59. The composition of any one of claims 37-58, wherein the second genome editor or the RNA-guided lyase comprises a Cas9 lyase.

60. The composition of any one of claims 37-59, wherein the second genome editor or the RNA-guided lytic enzyme comprises a Streptococcus pyogenes (Spy) Cas9 lytic enzyme.

61. The composition of any one of claims 37-56, wherein the first genome editor or the base editor comprises a Streptococcus pyogenes (Spy) Cas9 nickase.

62. The composition of any one of claims 37-56 and 61, wherein the first genome editor or the base editor comprises a D10A SpyCas9 nickase.

63. The composition of any one of claims 37-56, 61, and 62, wherein the second genome editor or the RNA-guided lytic enzyme comprises a Neisseria meningitidis (Nme) Cas9 lytic enzyme.

64. The composition of any one of claims 37-63, wherein the at least one gRNA homologous to the first genome editor or the base editor is not homologous to the second genome editor or the RNA-guided lytic enzyme.

65. The composition of any one of claims 37-64, wherein the at least one gRNA homologous to the second genome editor or the RNA-guided lytic enzyme is not homologous to the first genome editor or the base editor.

66. The composition of any one of claims 37-65, wherein the at least one gRNA comprises at least one single guide RNA (sgRNA).

67. The composition of any one of claims 37-66, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least two gRNAs targeting at least two different genomic loci.

68. The composition of any one of claims 37-67, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least three gRNAs targeting at least three different genomic loci.

69. The composition of any one of claims 37-68, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least four gRNAs targeting at least four different genomic loci.

70. The composition of any one of claims 37-69, wherein the at least one gRNA homologous to the first genome editor or the base editor comprises at least five gRNAs targeting at least five different genomic loci.

71. The composition of any one of claims 68-70, wherein the first genome editor and one, two, three, four, five or six of the at least one gRNA homologous to the first genome editor or the base editor and targeting different genomic loci are contained in the same lipid nanoparticle (LNP).

72. The method or composition of any one of claims 15-36 and 49-71, wherein the LNP comprises an ionizable lipid.

73. The method or composition of claim 72, wherein the ionizable lipid comprises a biodegradable ionizable lipid.

74. A method or composition as described in any one of claims 15-36 and 49-73, wherein the LNP comprises a lipid component and the lipid component comprises: about 50-60mol% amine lipids such as lipid A; about 8-10mol% neutral lipids; and about 2.5-4mol% stealth lipids (e.g., PEG lipids), wherein the remainder of the lipid component is a helper lipid, and wherein the N / P ratio of the lipid LNP is about 3-7.

75. A method or composition as described in any one of claims 15-36 and 49-74, wherein the LNP comprises a lipid component and the lipid component comprises: about 25-45mol% amine lipids, such as lipid A; about 10-30mol% neutral lipids; about 25-65mol% helper lipids; and about 1.5-3.5mol% stealth lipids (e.g., PEG lipids), and wherein the N / P ratio of the LNP is about 3-7.

76. A cell, wherein the cell is treated in vitro with the method or composition of any one of claims 1-75.

77. The cell of claim 76, wherein the cell is a human cell.

78. The cell of claim 76 or 77, wherein the cell is selected from: mesenchymal stem cells; hematopoietic stem cells (HSC); monocytes; endothelial progenitor cells (EPC); neural stem cells (NSC); limbal stem cells (LSC); tissue-specific primary cells or cells derived therefrom (TSC), induced pluripotent stem cells (iPSC); ocular stem cells; pluripotent stem cells (PSC); embryonic stem cells (ESC); and cells for organ or tissue transplantation, and optionally cells for use in ACT therapy.

79. The cell of any one of claims 76-78, wherein the cell is an immune cell.

80. A cell population comprising the cells of any one of claims 76-79.

81. The cell colony of claim 80, wherein the cells are cultured, expanded or proliferated in vitro.

82. A cell, cell colony or composition as described in any one of claims 37-81 for use in treating cancer.

83. Use of a cell, cell population or composition as described in any one of claims 37-82 for the preparation of a medicament for treating cancer.

84. An engineered cell comprising at least three base editors in at least three genomic loci and at least one exogenous gene.

Images