Hypoxanthine hepatic targeting nano-liposome as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a tibinoside liver-targeting nano-liposome as well as a preparation method and application of the tibinoside liver-targeting nano-liposome. The liposome provided by the invention is prepared from a phospholipid membrane material, a cholesterol membrane material, functionalized phospholipid, hypericum japonicum, a liver targeting substance, a phosphate buffer solution, an organic solvent and the like. The hypericum japonicum liver targeting nano-liposome prepared by the invention can directly target liver parenchymal cells and bile duct epithelial cells, and improves liver functions and bile excretion by reducing the levels of ALT, AST, ALP, TBA, TBIL and gamma-GGT, improving mitochondrial structures and functions and inhibiting liver oxidative stress and inflammatory factors, thereby playing a role in treating cholestatic liver injury. The invention provides a novel medicine with exact curative effect and small side effect for clinically treating cholestatic liver disease.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a xanthoglobin liver-targeted nanoliposome and a preparation method and application thereof. Background Art

[0002] Cholestasis is a phenomenon in which bile acid accumulates in liver cells and bile ducts due to the disorder of bile formation and distribution in the body. Cholestasis can lead to the occurrence of cholestatic liver disease. The causes of cholestatic liver disease are relatively complex. Viral infection, drugs, pregnancy, immunity, genetics, parenteral nutrition, etc. can all cause intrahepatic cholestasis. In severe cases, it may progress to liver fibrosis, cirrhosis, liver failure and liver tumors. Among them, intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-specific disease characterized by varying degrees of itching, elevated serum bile acid and / or liver function disorders in the middle and late stages of pregnancy. It mainly affects the prognosis of the perinatal infant and can lead to spontaneous premature birth, fetal distress and stillbirth. ICP has been included in the category of high-risk pregnancy and is a major problem that plagues obstetricians and parturients.

[0003] At present, the main drugs for the treatment of cholestasis (including ICP) in clinical practice include ursodeoxycholic acid (UDCA), S-adenosylmethionine (SAM), cholestyramine, etc. Among them, UDCA is the first-line drug recommended in clinical practice, and its main function is to improve clinical symptoms and liver damage caused by cholestasis. However, UDCA has a slow onset of action, and about 30% of patients are ineffective for UDCA. In addition, there are adverse reactions such as gastrointestinal dysfunction in patients. More effective drugs are urgently needed in clinical practice.

[0004] Quercetin-7-rhamnoside, Q7R, is a flavonoid active ingredient found in the traditional Chinese medicine Radix Glehniae. Radix Glehniae, also known as Radix Glehniae, is a traditional Chinese medicine in my country. It is often used to treat diseases such as liver fibrosis, damp-heat jaundice, and liver damage. It has a good liver-protecting and jaundice-relieving effect. Modern pharmacological studies have shown that Radix Glehniae has anti-inflammatory, antioxidant, and antiviral effects. Radix Glehniae can treat α-naphthyl isothiocyanate (ANIT)-induced cholestatic hepatitis and liver fibrosis in rats by improving bile excretion and inhibiting inflammatory response. However, due to the poor solubility of Radix Glehniae, the solubility in water is only 0.004 mg / mL, poor stability, and low bioavailability of Radix Glehniae, and Radix Glehniae will be rapidly metabolized in the body, resulting in a low concentration at the site of action, which restricts the therapeutic effect. Therefore, there are very few studies on its dosage forms at home and abroad.

[0005] In conclusion, the development of a liver-targeted nanoformulation of tannin is of great significance for the treatment of cholestatic hepatitis and ICP, and will help to further expand the application scope of tannin. Summary of the invention

[0006] Based on this, in order to increase the targeting effect and improve the bioavailability, the present invention provides a hepatic targeting nanoliposome of xanthoglobin, which can target the liver parenchymal cells and bile duct epithelial cells of the liver, and improve liver function by regulating the structure and function of hepatocyte mitochondria, improving oxidative stress, inhibiting liver inflammatory factors, and restoring bile excretion, thereby playing a role in treating cholestatic liver injury.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A xanthoside liver-targeted nanoliposome is prepared from xanthoside, phospholipid membrane materials, cholesterol membrane materials, functionalized phospholipid substances, antioxidants, liver-targeted substances, phosphate buffer solutions, and organic solvents; the mass fractions of each substance are as follows: 2-20 parts of xanthoside, 10-200 parts of phospholipid membrane materials, 3-30 parts of cholesterol membrane materials, 1-10 parts of functionalized phospholipid substances, 0.1-5 parts of liver-targeted substances, 20-200 parts of phosphate buffer solutions, and 20-200 parts of organic solvents.

[0009] The tannin liver-targeted nanoliposomes provided by the present invention use phospholipid membrane materials as carriers to coat tannin to form a sustained-release coating structure, and at the same time, the liver-targeted substance modifies the surface of the nanoliposomes, so that the preparation has good liver targeting. The organic solvent selected by the present invention must meet the two conditions of having good solubility in the phospholipid membrane materials and being miscible with the ammonia solution to achieve full dissolution of each substance, and the phosphate buffer solution serves as the aqueous phase liquid to provide a better dispersion medium for the organic phase, which can effectively improve the dispersibility of tannin in the aqueous phase liquid, thereby forming nanometer-level particles.

[0010] Preferably, the mass fractions of each substance in the xanthoglobulin liver-targeted nanoliposomes are as follows: 5-10 parts of xanthoglobulin, 50-150 parts of phospholipid membrane materials, 10-20 parts of cholesterol membrane materials, 2-6 parts of functionalized phospholipid substances, 0.5-2 parts of liver-targeted substances, 50-100 parts of phosphate buffer solution, and 50-100 parts of organic solvents.

[0011] Preferably, the phospholipid membrane material is selected from one or more of natural soybean lecithin, natural egg yolk lecithin, hydrogenated soybean lecithin, and distearoyl phosphatidylcholine; the functionalized phospholipid substance is DSPE-PEG2000-Mal; the cholesterol membrane material is selected from one of sodium cholesterol sulfate and cholesterol; the liver-targeting substance is selected from one or more of A20FMDV2 peptide, SP94 peptide, N-acetylgalactosamine, and galactose.

[0012] The phospholipid membrane material in the present invention is selected from natural phospholipids and hydrogenated soybean lecithin, which can increase the sustained release time of the tannin liposome injection in the body and prolong the half-life; at the same time, adding cholesterol membrane materials such as sodium cholesterol sulfate, cholesterol, etc. to the organic phase can effectively increase the stability of the phospholipid bilayer, thereby increasing the stability of the liposome; and adding functionalized phospholipids to the organic phase can be combined with liver targeting substances through derivatization, thereby achieving the targeting of liposomes to liver parenchymal cells and bile duct epithelial cells.

[0013] The present invention also provides a method for preparing the xanthoglobin liver-targeted nanoliposome, comprising the following steps:

[0014] S1. Dissolving tannin, phospholipid membrane materials, cholesterol membrane materials and functionalized phospholipid substances in an organic solvent, placing the mixed solution in a round-bottom flask, removing the organic solvent in a water bath, and forming a uniform lipid film on the wall of the round-bottom flask;

[0015] S2, adding phosphate buffer to the round-bottom flask in which the lipid film is formed in step S1, forming a liposome primary suspension after hydration, and then breaking it by ultrasonic wave with a probe in an ice bath to obtain a liposome solution;

[0016] S3. Add the liver targeting substance to the liposome solution prepared in step S2, incubate at room temperature, then dialyze in ultrapure water and sterilize to obtain the product.

[0017] The method provided by the present invention is to first form an organic phase into a film, then disperse it in an aqueous phase, and form liposomes with small particle size by physical force through ice bath ultrasound; finally, free tansylate in the liposome solution is removed by filtration, thereby obtaining tansylate nanoliposomes with low blood health risks. The carrier of the tansylate liver-targeted nanoliposomes can be degraded under natural physiological conditions, and thus be excreted from the body through metabolism, without causing irritation or foreign body reaction to the body.

[0018] The invention disperses the tannin raw material and the phospholipid carrier through an organic solvent to form a uniformly dispersed organic phase, then forms a lipid film by rotating and evaporating the organic phase to wrap the aqueous phase liquid, and ultrasonically disperses the liposome suspension to form nano-scale liposomes with the tannin and the phospholipid carrier.

[0019] Preferably, the organic solvent in step S1 is one of methanol and ammonia-methanol solution; and the water bath condition is 45-55° C. for 1-2 hours.

[0020] Preferably, the hydration condition in step S2 is a treatment at 50-60° C. for 5-10 min, and the ice bath condition is an ice water bath at 0-5° C.

[0021] Preferably, the incubation condition in step S3 is incubation at 25° C. for 6 to 24 hours; the dialysis process uses phosphate buffer as the dialysis fluid, and the dialysis time is 8 to 16 hours.

[0022] The present invention also provides an application of the xanthoglobin liver-targeted nanoliposome in the preparation of a medicine for treating cholestatic liver injury.

[0023] Preferably, the cholestatic liver injury includes cholestatic hepatitis and intrahepatic cholestasis of pregnancy.

[0024] Nanoliposome drug delivery system helps to improve the bioavailability of drugs, reduce side effects and increase the targeting of therapeutic drugs. By surface modification of nanoliposomes, active targeting can be better achieved, thereby ensuring targeted delivery and enrichment of drugs. Nanoliposome drug delivery system has become a research hotspot in the fields of pharmaceutics and modern biomedicine as an effective means to optimize drug efficacy. Based on this, the present invention provides a hepato-targeted nanoliposome of tansylate, which forms a liposome-like nanoparticle structure in an aqueous phase liquid through the coating effect of a phospholipid carrier and the solubilizing and dispersing effect of an organic solvent. The liposome-type nanoparticle structure improves the sustained release of tansylate in plasma and tissue fluid, and its half-life is relatively controllable, so that tansylate can reach the affected area.

[0025] Compared with the prior art, the present invention has the following technical advantages:

[0026] (1) The tannin liver-targeted nanoliposomes provided by the present invention are nanoliposome structures, with a particle size of 60-100 nm, a drug loading of 4%, an encapsulation rate of more than 90%, and a uniform and stable particle size distribution, stable encapsulation rate and drug loading;

[0027] (2) The concentration of tansylate in the tansylate liver-targeted nanoliposome solution provided by the present invention is greater than 0.5 mg / mL, which increases the solubility of tansylate in an aqueous solution at a pH acceptable to human physiological conditions by more than 100 times;

[0028] (3) The hepatotoxicity nanoliposomes provided by the present invention have good liver targeting effect, can effectively control the sustained release rate of hepatotoxicity nanoliposomes, and increase its residence time in liver tissue, thereby improving the clinical treatment effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The appearance and characterization diagram of the preparation of Example 1;

[0030] Figure 2 This is a graph showing the stability of the xanthophyllotoxin liver-targeted nanoliposomes prepared in Example 1;

[0031] Figure 3 This is an in vitro drug release curve of the xanthoglobin liver-targeted nanoliposomes of Example 1;

[0032] Figure 4 The cytotoxicity results of liver-targeted nanoliposomes of xanthophyllotoxin with different concentrations are shown in the figure;

[0033] Figure 5 The results of the hemolytic investigation of liver-targeted nanoliposomes with different concentrations of xanthophyllotoxin are shown in FIG.

[0034] Figure 6 The images are the laser confocal fluorescence imaging and analysis results of HCCC cell uptake of different samples at different time points;

[0035] Figure 7 The results of near-infrared fluorescence imaging after intravenous administration of free DiR, DiR-LIP and t-DiR-LIP to KM mice;

[0036] Figure 8 This is the result of analyzing biochemical indexes in rats with cholestasis model after administration of different preparations;

[0037] Fig. 9 The figure shows the liver histopathological results of rats with cholestasis model after administration of different preparations;

[0038] Fig.10 The figure shows the results of RT-PCR analysis of cholestasis model rats after administration of different preparations;

[0039] Fig.11 The graph shows the observation results of liver and feces of rats with intrahepatic cholestasis of pregnancy model;

[0040] Fig.12 This is the analysis result of liver index and stillbirth rate in rats with intrahepatic cholestasis of pregnancy model after administration of different preparations;

[0041] Fig.13 The results of liver tissue staining in rats with intrahepatic cholestasis of pregnancy model after administration of different preparations;

[0042] Fig.14 The graph shows the test results of liver function and oxidative stress-related biochemical indexes in rats with intrahepatic cholestasis of pregnancy after administration of different preparations;

[0043] Fig.15 This is a graph showing the results of mitochondrial-related biochemical index detection in rats with intrahepatic cholestasis of pregnancy after administration of different preparations;

[0044] Fig.16The results of Western Blot detection of the expression levels of bile acid metabolism-related proteins FXR, CYP7A1, and CYP27A1 in rats with intrahepatic cholestasis of pregnancy after administration of different preparations;

[0045] Fig.17 This is the result of Western Blot detection of the expression levels of mitochondrial function-related proteins CDS2, MFN2, and LCAT in rats with intrahepatic cholestasis of pregnancy after administration of different preparations;

[0046] Fig.18 Transmission electron microscopy image of the liver mitochondrial structure of rats with intrahepatic cholestasis of pregnancy model treated with hepatic targeted nanoliposomes of xanthophyllotoxin.

[0047] Fig.19 This is the result of the effect of xanthoglobulin liver-targeted nanoliposomes on the bile acid metabolic profile of rats with intrahepatic cholestasis of pregnancy model. DETAILED DESCRIPTION

[0048] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments. The raw materials, equipment, etc. used in the following embodiments can be purchased through conventional channels unless otherwise specified.

[0049] Example 1 A liver-targeted nanoliposome of Xanthophyllotoxin

[0050] The xanthoside liver-targeted nanoliposomes are made of the following components: 10 mg of xanthoside, 45 mg of hydrogenated soybean lecithin, 135 mg of natural soybean lecithin, 12 mg of DSPE-mPEG2000-Mal, 30 mg of sodium cholesterol sulfate, 8 mg of A20FMDV2 peptide, 0.4 mL of concentrated ammonia water, 20 mL of methanol and 20 mL of PBS buffer at pH 5.8.

[0051] The preparation method of the xanthoglobin liver-targeted nanoliposomes is as follows:

[0052] S1. Weigh xanthoglobin, hydrogenated soybean lecithin, natural soybean lecithin, DSPE-mPEG2000-Mal, and sodium cholesterol sulfate, and dissolve them in 20 mL of a methanol solution containing 2% ammonia water. Place the organic phase in a round-bottom flask, and evaporate the organic solvent using a rotary evaporator in a 50°C water bath to form a lipid film on the wall of the round-bottom flask.

[0053] S2, adding 20 mL of PBS buffer at pH 5.8 to the lipid film formed in step S1, hydrating at 50° C. for 5 min to form a liposome primary suspension, and reducing the particle size by probe ultrasound in an ice bath at a power of 200 W for 6 min until the film is slightly opalescent to obtain a liposome solution;

[0054] S3. Add 2 mL of 4 mg / mL A20FMDV2 peptide solution to the liposome solution prepared in step S2, incubate at room temperature for 10 h, then take the tannin-loaded liposome suspension into a dialysis bag with a relative molecular weight of 14000 Da, use pH 5.8 phosphate buffer as the dialysis fluid, dialyze at 4°C for 12 h to remove free polypeptides, and filter through a 0.22 μm microporous filter membrane for sterilization.

[0055] Example 2 A liver-targeted nanoliposome of Xanthophyllotoxin

[0056] The xanthoside liver-targeted nanoliposomes are made of the following components: 5 mg xanthoside, 10 mg natural egg yolk lecithin, 15 mg natural soybean lecithin, 2.5 mg DSPE-mPEG2000-Mal, 7.5 mg sodium cholesterol sulfate, 0.25 mg SP94 peptide, 0.2 mL concentrated ammonia water, 10 mL methanol and 10 mL PBS buffer at pH 5.8.

[0057] The preparation method of the xanthoglobin liver-targeted nanoliposomes is similar to that in Example 1.

[0058] Example 3 A liver-targeted nanoliposome of Xanthophyllotoxin

[0059] The xanthoside liver-targeted nanoliposomes are prepared from the following components: 50 mg xanthoside, 200 mg natural egg yolk lecithin, 320 mg natural soybean lecithin, 15 mg DSPE-mPEG2000-Mal, 75 mg sodium cholesterol sulfate, 11 mg N-acetylgalactosamine, 4 mL concentrated ammonia water, 200 mL methanol and 200 mL PBS buffer at pH 5.8.

[0060] The preparation method of the xanthoglobin liver-targeted nanoliposomes is similar to that in Example 1.

[0061] Experimental Example 1 Investigation of the basic properties of xanthophyllotoxin-targeted liposomes

[0062] 1. Test sample: Xanthophyllotoxin liver-targeted nanoliposomes prepared in Example 1;

[0063] 2. Experimental process: The basic properties of the xanthophyllotoxin nanoliposomes obtained in Example 1 were evaluated, including appearance, average particle size, potential, and encapsulation efficiency.

[0064] The particle size, particle size distribution and potential of the nanoparticles were determined by Malvern laser particle size analyzer; the appearance of the liposomes was observed by Thermofisher Talos L120c transmission electron microscope, the test condition: 120kV; the drug content was determined by high performance liquid chromatography, using the standard substance of tanycin, and the content of tanycin in the preparation was calculated by external standard method, chromatographic column: Thermo HyPURITYTM C18 chromatographic column (4.6mm×150mm, 3μm); mobile phase: acetonitrile-water (80:20, v / v); column temperature: 35℃; flow rate: 1.0mL / min; injection volume: 10μL; UV detection wavelength: 375nm. The drug content was calculated by substituting the peak area into the standard curve equation Y=163.34X-92.664, and the liposome encapsulation efficiency and drug loading were calculated.

[0065] The formula for calculating the encapsulation rate is: Encapsulation rate = encapsulated drug amount / total content of main drug × 100%

[0066] 3. Experimental results: The physicochemical properties and in vitro stability of the xanthophyllotoxin liver-targeted nanoliposomes prepared in Example 1 were investigated. Figure 1 As shown, Figure 1 In the figure, A is the appearance of nanoliposome (t-QL); B is the particle size diagram of t-QL, C is the transmission electron microscope diagram of t-QL, and D is the result diagram of HPLC detection. It can be seen that the particle size distribution and transmission electron microscope diagram of the nanoliposome prepared by the present invention show that the obtained liposome solution is evenly distributed and spherical; the average particle size is 82.16±4.92nm, the potential is -21.73±4.68mV, and the polydispersity coefficient PDI=0.15±0.02; the drug content measured by HPLC is 0.57±0.06mg / mL, and the encapsulation rate is 97.11±6.08%. It shows that this preparation meets the requirements of nano preparations and can be used in later in vivo and in vitro experiments.

[0067] The stability of the tansylated hepatic targeting nanoliposomes obtained in Example 1 was further determined. The tansylated hepatic targeting nanoliposomes obtained in Example 1, a mixture of tansylated hepatic targeting nanoliposomes and PBS buffer (1:1), and a mixture of tansylated hepatic targeting nanoliposomes and plasma (plasma diluted with PBS 1:1) (1:1) were placed at room temperature, taken out at 0, 1, 2, 4, 6, 8, 12, and 24 hours, respectively, diluted 50 times with N,N-dimethylformamide and methanol solution, and the content of tansylated hepatic targeting nanoliposomes was determined using a high performance liquid chromatograph. The results are as follows: Figure 2 As shown, Figure 2 In the figure, A is the stability of the liposome PBS mixture, and B is the liposome plasma stability. It can be seen that the liver-targeted nanoliposomes obtained by the present invention have good stability.

[0068] 1. Test sample: Xanthophyllotoxin liver-targeted nanoliposomes prepared in Example 1;

[0069] 2. Experimental process: Dynamic dialysis was used to study the in vitro drug release of t-QL liver-targeted liposomes. The specific steps are as follows: Before the experiment, the dialysis bag was pre-treated and activated and then soaked in a PBS solution of pH 5.0 at 37°C. 1 mL of t-QL liver-targeted liposome solution was accurately pipetted and placed in the dialysis bag. When the temperature of the dissolution medium was constant at 37°C ± 0.5°C, the sealed dialysis bag (12000-14000 kd) was placed in 100 mL of PBS buffer dialysis medium for stirring dialysis (containing 5% Tween-80 as a solubilizer) at 37°C and 100 rpm. At the specified sampling time points (0, 1, 2, 4, 6, 8, 10, 12, 24, 36, 48h), 1 mL of sample solution was drawn and supplemented with an equal volume of fresh PBS buffer of pH 5.0 (containing 5% Tween-80) at a temperature of 37°C ± 0.5°C. The sample was concentrated and dried under vacuum, and then 20 μL of pure water, 20 μL of DMF and 60 μL of methanol solution were added. The peak area of ​​tanycyrosin was detected by high performance liquid chromatography tandem mass spectrometry, and the concentration of the drug released at each time point was calculated using a standard curve.

[0070] 3. Test results: Specific test results are as follows: Figure 3 As shown, it can be seen that the cumulative release rate of the drug in the first 12 hours of t-QL is about 20%; the drug release is relatively slow, and the cumulative release amount at 48 hours is about 50%. The peptide-modified liposomes prolong the release time of the drug and show a good sustained-release effect.

[0071] Test Example 3 Cytotoxicity test of xanthophyllotoxin liver-targeted liposomes

[0072] 1. Test sample: Xanthophyllotoxin liver-targeted nanoliposomes prepared in Example 1;

[0073] 2. Experimental process: The MTT method was used to determine the cytotoxicity of the hepatotoxic liposomes of the present invention to HepG2 cells. HepG2 cells were cultured at 1×10 4The inoculum size of each well was inoculated into a 96-well plate and placed in a 5% CO2, 37°C incubator. After culturing for 24 h in DMEM medium containing 10% fetal bovine serum, the hepatic targeting nanoliposomes of tannin of Example 1 were added to the DMEM medium containing 10% fetal bovine serum, respectively, so that the concentrations of hepatic targeting nanoliposomes were 300 μg / mL, 100 μg / mL, 31.7 μg / mL, 10 μg / mL, 3.17 μg / mL, 1 μg / mL, 0.317 μg / mL, 0.1 μg / mL, 0.0317 μg / mL and 0 μg / mL, respectively. The experiment of each concentration was repeated three times. After the liposomes at these concentrations were treated for 24 h, 36 h and 48 h, respectively, their cytotoxicity was detected.

[0074] 3. Test results: The specific test results are shown in the figure below. Figure 4 As shown by Figure 4 It can be seen that the liver-targeted nanoliposomes of tannin had no significant inhibitory effect on the growth of HepG2 cells. The IC 50 The IC value after 36 hours of administration is 1012 μg / mL. 50 The IC value after 48 hours of administration is 763.1 μg / mL. 50 The value was 633.6 μg / mL, indicating that tannin has good safety.

[0075] Experimental Example 4 Hemolysis Detection of Xanthophyllotoxin Liver-Targeted Liposomes

[0076] 1. Test sample: Xanthocyanin liver-targeted nanoliposomes (Q7R) prepared in Example 1;

[0077] 2. Experimental process: Take 2.5kg healthy adult male New Zealand white rabbits, take 5mL of blood from the heart, put the blank whole blood into a centrifuge tube containing sodium heparin, stir with a glass rod to remove impurities such as fibrin, then centrifuge at 3000rpm, 4℃ for 10min, discard the supernatant and wash 3 times with saline to purify red blood cells, dilute the red blood cells with saline to a cell suspension with a concentration of 2% (v / v). Prepare Q7R concentrations of 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50, 100, 200, 400μg / mL of tanycin liver-targeted liposome solutions, take 0.25mL of different concentrations of preparations into centrifuge tubes, add 0.25mL of 2% cell suspension, and make the final concentrations: 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50, 100, 200μg / mL. Take two 0.25mL 2% red blood cell suspensions and add equal volumes of saline and 0.1% Triton as negative control and positive control groups, respectively. After incubating the above samples at 37°C for 2h, centrifuge at 3000rpm for 10min, take 100μL of the supernatant in a 96-well plate, and measure the absorbance at a wavelength of 541nm to evaluate the hemolysis.

[0078] 3. Test results: Specific test results are as follows: Figure 5 As shown, it can be seen that no hemolysis occurs in the concentration range of 0.05-50 μg / mL of tannin liver-targeted liposomes, and there is no significant difference compared with the normal saline group, indicating that the preparation of the present invention has good safety.

[0079] Experimental Example 5 Investigation of Cellular Uptake of Liver-Targeted Drug-Loaded Liposomes

[0080] 1. Experimental purpose: This experiment uses a laser confocal scanning microscope to observe the effect of cell phagocytosis of liposomes, so as to evaluate the bile duct targeting of peptide-modified liposomes. Relevant literature reports that A20FMDV2 polypeptide molecules can bind to αvβ6 receptors, which is considered to be the main cell phagocytosis principle of A20FMDV2 polypeptide-modified nanoparticles; bile duct epithelial cells are rich in αvβ6 receptors, which can be used to simulate the interaction between bile ducts and A20FMDV2 polypeptide-modified nanoliposomes. Therefore, this experiment selected HCCC as the research object, and used coumarin-6 (C6) fluorescent dye to label liposomes, and co-incubated liposomes with cells, so as to more intuitively and accurately observe the cell phagocytosis of liposomes and the approximate distribution of liposomes.

[0081] 2. Experimental process: C6-loaded liver-targeted liposomes (t-C6-LIP) and non-liver-targeted C6 ordinary liposomes (C6-LIP) were prepared according to Example 1, and the cell uptake after incubation with different preparations was observed using a laser confocal microscope. The specific process is as follows: HCCC-9810 cells were passaged on a cover glass in a 6-well culture dish (density of 8×10 4 / mL), incubated for 24h in RPMI 1640 medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. The above culture medium was discarded, washed 3 times with PBS, and 1mL of C6 solution, ordinary liposome C6-LIP solution, and targeted liposome t-C6-LIP solution were added respectively. The C6 concentration in all solutions was 0.01mg / mL, and incubated at 37°C in the dark for 1, 2, and 4h (among which 2mL of fresh RPMI 1640 medium containing 10% fetal bovine serum was added to the blank control group). After the incubation, the culture medium was discarded, washed 3 times with PBS, and then fixed in the dark for 20min with 4% paraformaldehyde solution, the paraformaldehyde solution was discarded and the cells were washed 3 times with PBS. 2-3 drops of anti-fluorescence quenching sealing agent (containing DAPI) were added to the slide, and the treated sample coverslip was placed on the slide with the cell side facing down, and the whole process was protected from light. Finally, the fluorescence distribution of DAPI and C6 was observed by laser confocal microscopy.

[0082] 3. Test results: Specific test results are as follows: Figure 6 As shown, Figure 6 In the figure, A is a 1h laser confocal fluorescence imaging image; B is a 2h laser confocal fluorescence imaging image; C is a 4h laser confocal fluorescence imaging image; D is a laser confocal fluorescence imaging statistics. *, p < 0.05, **, p < 0.01, ***, p < 0.001. It can be seen that compared with the free C6 and C6-LIP groups without peptide targeting modification, the liver cells have a stronger uptake ability for liver-targeted liposomes (t-C6-LIP) and are time-dependent. This result shows that peptide-modified liposomes can be better enriched in liver cells.

[0083] Experimental Example 6 Investigation of the in vivo targeting of targeted drug-loaded liposomes

[0084] 1. Test samples: Take the prescribed amount of fluorescent material DiR, and prepare DiR liposomes without targeting modification (DiR-LIP, 50 μg / mL) and peptide-modified DiR targeted liposomes (i.e., t-DiR-LIP containing targeting substance and fluorescent material, 50 μg / mL) according to the preparation method and steps of Example 1; and prepare a DiR solution (Free-DiR) with a concentration of 50 μg / mL as a control;

[0085] 2. Experimental animals: KM mice (purchased from Guangzhou Ruige Biotechnology Co., Ltd., license number: SCXK (Guangdong) 2022-0059), 6 mice in each group, divided into 3 groups in total;

[0086] 3. Experimental process: The distribution of liposomes in liver tissue in vivo was observed using a small animal in vivo optical imaging system. The day before the experiment, the mice were fasted overnight and had free access to water. During the experiment, each mouse was injected with a free DiR solution (Free-DiR), a DiR liposome (DiR-LIP), and a peptide-modified DiR liposome (t-DiR-LIP) through the tail vein (DiR dose was 400 μg / kg). At 1, 5, 8, and 24 hours after administration, the mice were anesthetized by intraperitoneal injection of sodium pentobarbital, and imaging was performed using a small animal in vivo optical imaging system. The maximum excitation wavelength of DiR was 748 nm, and the maximum emission wavelength was 780 nm. After 24 hours of imaging, the mice were immediately killed by dislocation, the liver tissue was removed, the blood stains were cleaned with an appropriate amount of saline, and organ fluorescence imaging was performed.

[0087] 4. Test results: The test results are as follows: Figure 7 As shown in the figure, A is the distribution of whole body near-infrared fluorescence of mice at 1, 5, 8, and 24 hours after administration; B is the result of liver near-infrared fluorescence uptake of mice at 24 hours after administration; C is the statistical result of liver near-infrared fluorescence uptake of mice at 24 hours after administration. **p<0.01, ***p<0.001. It can be seen that the accumulation of DIR-LIP or t-DIR-LIP group in the liver was significantly higher than that of free DIR group, which may be due to the passive liver targeting effect of liposomes, and the effect of peptide-modified liposomes on the αvβ6 receptor on the surface of bile duct endothelial cells to promote the enrichment of peptide-modified liposomes in the liver through receptor-mediated endocytosis.

[0088] Experimental Example 7 Therapeutic effect of xanthophyllotoxin liver-targeted nanoliposomes on ANIT-induced cholestasis model rats

[0089] 1. Experimental animals: 36 8-week-old SD male rats weighing 180-220 g (purchased from Guangzhou Ruige Biotechnology Co., Ltd., license number: SCXK (Guangdong) 2022-0059) were randomly divided into 6 groups (6 rats in each group);

[0090] 2. Experimental process: specifically divided into: (1) blank control group (CTR): gavage with normal saline; (2) model group (MOD): gavage with normal saline; (3) positive control group: gavage with ursodeoxycholic acid suspension (UDCA, 50 mg / kg); (4) tansylate solution group (Q7R group, 0.5 mg / mL Q7R solution, tail vein injection dose 0.5 mg / kg); (5) unmodified tansylate liposome group (QL group, 0.5 mg / mL QL solution, tail vein injection dose 0.5 mg / kg); (6) peptide-modified tansylate liposome group (t-QL group, 0.5 mg / mL t-QL solution, tail vein injection dose 0.5 mg / kg). After 1 week of pre-administration, rats in all groups except the blank control group were intraperitoneally injected with ANIT (75 mg / kg). After 60 hours of ANIT injection, the animals were fasted for 12 hours. Each group of rats was anesthetized with sodium pentobarbital (60 mg / kg), blood was collected from the abdominal aorta for biochemical evaluation, the liver was separated, the blood remaining on the surface was washed with PBS and wiped with filter paper, and then accurately weighed. The liver index was calculated as follows: liver index = liver weight / rat body weight × 100%.

[0091] 2.1 Histopathological and biochemical analysis: Rat livers were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned. H&E and Masson staining were performed. Fields of view were randomly selected under a microscope to evaluate histological changes. The levels of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), γ-glutamyltransferase (γ-GGT), total bile acid (TBA), total bilirubin (TBIL), and direct bilirubin (DBIL) were determined using a Chemray 240 automatic biochemical analyzer. Liver homogenates were prepared to detect SOD, MDA, and GSH-Px levels.

[0092] 2.2 Reverse transcription polymerase chain reaction (RT-PCR) analysis: Use The total RNA in liver tissue samples was extracted by After the mRNA was purified by mRNADIRECTTM kit, III reverse transcriptase for reverse transcription, ViiA TM 7Real-time fluorescence quantitative PCR system was used to detect the relevant mRNA levels in each group of samples. The rat RT-PCR gene primers were synthesized by Shanghai Biotechnology Co., Ltd., and the sequences are shown in Table 1. Normal animal tissues were used as negative controls, and Gapdh was used as an internal reference. Relative quantitative analysis was performed using the 2^-△△CT method.

[0093] Table 1 RT-PCR gene primer sequence list

[0094] Gene name Sequence (5'-3') PTGS1-F GGTCTGATGCTCTTCTCCACG PTGS1-R GATGGTTTCCCCTATAAGGATGA FXR-F CCATTTACAAGCCACGGACG FXR-R CCCAGGTTGGAATAATAGGACG PTGS2-F GTGTTGACGTCCAGATCACATTTG PTGS2-R GCAGTCATCAGCCACAGGAG TNF-α-F CCAGGTTCTCTTCAAGGGACAA TNF-α-R GGTATGAAATGGCAAATCGGCT IL-1β-F GAACAACAAAAATGCCTCGTGC IL-1β-R GACAAACCGCTTTTCCATCTTCT NF-κB-F GGCCCATACCTTCAAATACTAGAGC NF-κB-R CCTGCGGGTAAGATTTCTTGTTC GAPDH-F CTGGAGAAACCTGCCAAGTATG GAPDH-R GGTGGAAGAATGGGAGTTGCT

[0095] 3. Test results: Biochemical and pathological analysis results are as follows: Figure 8 , Fig. 9 As shown, Figure 8 In the model group, the liver index, ALT, AST, TBA, ALP, TBIL, DBIL, MDA and γ-GGT levels were significantly increased, and the SOD and GSH-PX levels were significantly decreased (compared with the Control group: ###, p < 0.001; compared with the Model group: *, p < 0.05; **, p < 0.01; ***, p < 0.001; compared with the t-QL group: Φ, p < 0.05; ΦФ , p<0.01; ФΦФ , p<0.001). All indicators were improved after drug intervention, and the improvement in the t-QL group was the most obvious, indicating that the cholestasis rat model was successfully established, and t-QL had a better therapeutic effect on the cholestasis of ANIT-induced model rats, confirming that t-QL can more effectively improve the liver function and oxidative stress of cholestasis model rats.

[0096] H&E staining (×200) Masson staining (×200) results are as follows Fig. 9 As shown, it can be seen that the liver tissue structure of rats in the normal control group was normal, the liver cell structure was intact and tightly arranged, and no inflammation and necrosis were observed; the liver tissue structure of the model group was abnormal, the liver cells were of different sizes, the cytoplasm was loose, there were gaps between cells, and inflammatory infiltration occurred. All drug intervention groups improved to varying degrees. The results of Masson staining showed that no obvious blue collagen fiber deposition was observed in the liver tissue sections of the blank control group. In the liver tissue sections of the model group, blue collagen fiber deposition was observed around the liver cells, indicating that the liver was damaged and fibrosis occurred, and all drug intervention groups improved to varying degrees. The results of H&E staining and Masson staining showed that drug treatment significantly reduced the degree of liver necrosis, fibrosis and inflammatory cell infiltration, especially in the t-QL group. The improvement effect was the most significant. These results show that t-QL can more effectively prevent inflammation, necrosis and fibrosis of liver tissue in rats with cholestasis model.

[0097] RT-PCR analysis results Fig.10 As shown in the data, the mRNA levels of IL-1β, TNF-α, NF-κB, PTGS1, and PTGS2 in the model group rats were significantly increased, and the mRNA level of FXR was significantly decreased. All of them improved after administration, and the improvement in the t-QL group was the most obvious, confirming that t-QL can more effectively improve the inflammation-related indicators of ANIT-induced cholestasis model rats at the mRNA level.

[0098] Experimental Example 8 Therapeutic effect of xanthophyllotoxin liver-targeted nanoliposomes on rats with intrahepatic cholestasis of pregnancy

[0099] 1. Experimental animals: 36 8-week-old female SD rats and 12 male SD rats (purchased from Guangzhou Ruige Biotechnology Co., Ltd., license number: SCXK (Guangdong) 2022-0059). Female rats were divided into 6 groups, 6 rats in each group; male rats were divided into 6 groups, 2 rats in each group;

[0100] 2. Experimental process: The rats were raised in an environment with a room temperature of 18-28℃ and a relative humidity of 40%-70%, with free access to water and food, and were adaptively raised. The rats in estrus (i.e., experimental animals) were housed in a cage at a male-female ratio of 3:1. The female rats were tested for pregnancy by vaginal smear, and sperm was found on the first day of pregnancy. The rats were raised until the 12th day of pregnancy for use. The SD rats on the 12th day of pregnancy were randomly divided into a normal control group (CTR), a model control group (MOD), a positive control group (adenosylmethionine butanedisulfonate, SAM group), a tansylate solution group (Q7R group), a tansylate liposome group (QL group), and a peptide-modified tansylate liposome group (t-QL group). During the modeling treatment, rats in each modeling group were intramuscularly injected with estradiol benzoate 2.5 mg / kg, and the control group was intramuscularly injected with an equal amount of normal saline. Once a day for 7 consecutive days, an ICP animal model was constructed. The total bile acid concentration was determined by taking blood from the tail vein. When the total bile acid level was >10μmol / L, it indicated that the ICP model was successfully established. The animals in each group were given drugs 1 hour after modeling, once a day, for 7 consecutive days. The positive control group was given 0.1mg / kg SAM; the Q7R solution group (0.5mg / kg) was intraperitoneally injected; the QL group and t-QL group were injected with liposomes (0.5mg / kg) through the tail vein, and the normal control group and the model control group were given an equal volume of normal saline. All groups terminated pregnancy when vaginal bloody secretions were seen, and 5mL of blood was taken from the abdominal vein. After half an hour, it was centrifuged at 4℃ and 4000rpm for 20min to separate the serum, and the liver and placenta were frozen. Another small piece was taken out and immediately placed in the electron microscope fixative, and the number of embryonic deaths and survivals was recorded to calculate the embryonic lethality.

[0101] 2.1 Analysis of liver index and stillbirth rate: Liver index and stillbirth rate are important indicators of the ICP model. According to the rat body weight, liver weight, total number of embryos and number of embryonic deaths, liver index and stillbirth rate were calculated. The formula is as follows: liver index = liver weight / body weight × 100%; stillbirth rate = number of embryonic deaths / total number of embryos × 100%;

[0102] 2.2 Biochemical index detection and liver tissue pathological evaluation: The serum ALT, AST, TBA, and AKP levels were determined using a Chemray 240 automatic biochemical analyzer. Liver homogenate was prepared, and the levels of liver oxidative stress indicators SOD and MDA were detected using a commercial kit from Nanjing Jiancheng Bioengineering Institute. The liver tissue was fixed with 4% paraformaldehyde, embedded, and sectioned, and then stained with H&E and Masson, respectively. The images were viewed and analyzed under an upright microscope.

[0103] 2.3 Detection of biochemical indicators related to mitochondrial function: Liver homogenate was prepared, and the enhanced ATP detection kit and enhanced NAD+ / NADH detection kit of Shanghai Biotech Co., Ltd. and the Rat GDF-15 ELISA kit of Boster Biotech Co., Ltd. were used to determine the ATP level, NAD+ / NADH ratio, and GDF-15 level related to mitochondrial function in liver tissue.

[0104] 2.4 Evaluation of the levels of proteins related to bile acid metabolism in liver tissue: The main manifestation of intrahepatic cholestasis of pregnancy is abnormal bile acid metabolism. FXR is a bile acid-activated receptor that plays an important role in the synthesis of bile acids and the regulation of bile acid enterohepatic circulation. It can inhibit the synthesis of bile acids by inhibiting the expression of cholesterol 7α-hydroxylase gene (CYP7A1). CYP7A1 and CYP27A1 are key rate-limiting enzymes in the bile acid synthesis pathway and can regulate the synthesis of various bile acids. Therefore, in order to further study the therapeutic effect of liposomes of tannin on intrahepatic cholestasis of pregnancy, the expression of CYP7A1, CYP27A1, and FXR proteins was experimentally studied. The specific process is as follows: weigh about 0.1g of liver tissue from the above-mentioned ICP model rats, homogenize and lyse, and then use the BCA kit to quantify the protein, take 10μL of the sample supernatant (containing 30μg of protein), perform SDS-PAGE electrophoresis, and transfer it to a PVDF membrane. After blocking with skim milk powder, incubate with rat FXR, CYP7A1, CYP27A1 antibodies and secondary antibodies, respectively, and then expose and develop, and use ImageJ for semi-quantitative calculations.

[0105] 2.5 Mitochondrial function damage:

[0106] Intrahepatic cholestasis of pregnancy is often accompanied by mitochondrial dysfunction. Therefore, in order to further study the therapeutic effect of t-QL on mitochondrial dysfunction, this experiment investigated the expression levels of CDS2, MFN2, and LCAT proteins, and the detection was carried out according to Experiment 2.4.

[0107] 2.6 Evaluation of hepatocyte mitochondrial structure:

[0108] (1) Sample fixation: remove the tissue from the electron microscope fixative and wash it with PBS buffer for 3 times, 15 min each time; post-fix it with 1% osmium tetroxide for 2 h and store it in a refrigerator at 4°C for later use; (2) Dehydration: wash the post-fixed tissue with PBS, then perform ethanol gradient dehydration (50%, 70%, 80%, 90%, each for 15 min / time; 100%, 15 min, repeated twice); perform acetone dehydration (100%, 15 min, 2 times) ; (3) Infiltration: Infiltrate with a ratio of 100% acetone: resin embedding solution = 3:1 and leave at room temperature for 0.5 h; then infiltrate with a ratio of 100% acetone: resin embedding solution = 1:1 and leave at room temperature for 4 h; finally, infiltrate with pure embedding solution and leave at 4°C overnight; (4) Embedding: Embed the sample in an embedding plate with a resin embedding agent; (5) Polymerization: Place the embedding plate in an oven and bake at 37°C for 24 h, then bake at 60°C for 48 h; (6) Sectioning: Use a Leica UC7 ultrathin microtome to cut the sample into ultrathin sections with a thickness of about 100 nm; (7) Electron staining: Use uranyl acetate staining for 20 min, then use lead citrate staining for 12 min; (8) Use a FEI Tecnai G2 Spirit transmission electron microscope to observe, photograph and analyze.

[0109] 2.6 Study on characteristic markers of bile acid metabolism: (1) Take out serum samples stored at -80℃, slowly dissolve them at 4℃, then take 100μL of serum from each group, add 500μL of pre-cooled methanol, add 10μL of 200ng / mL mixed internal standard, vortex for 1min, place in a -20℃ refrigerator to precipitate protein, centrifuge at 14000rpm, 4℃ for 20min, take the supernatant, freeze-dry, and store the samples at -80℃ for later use.

[0110] (2) Chromatographic conditions: The samples were separated using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography system. The samples were placed in an autosampler at 4°C, the column temperature was 45°C, the mobile phase A was 0.1% formic acid in water, the mobile phase B was pure methanol, the flow rate was 250 μL / min, and the injection volume was 2 μL. The liquid phase gradient was as follows: 0-7 min, phase B changed linearly from 50% to 70%; 7-15 min, phase B changed linearly from 70% to 90%; 15-17 min, phase B was maintained at 90%; 17-17.1 min, phase B changed linearly from 90% to 60%; 17.1-20 min, phase B was maintained at 60%. (3) Mass spectrometry conditions: Mass spectrometry analysis was performed using a 5500QTRAP mass spectrometer (SCIEX) in negative ion mode. The 5500QTRAP ESI source conditions were as follows: source temperature: 550°C; ion Source Gas1 (Gas1): 55; Ion Source Gas2 (Gas2): 55; Curtain gas (CUR): 40; ion Sapary Voltage Floating (ISVF): -4500 V; the MRM mode was used to detect the ion pairs to be measured. The ion pair information of all target substances is shown in Table 2.

[0111] Table 2 Bile acid detection standard curve and detection limit

[0112]

[0113]

[0114]

[0115] Test results: The liver and feces of SD rats Fig.11 As shown in the figure, A is the appearance of the liver; B is the appearance of the feces. The results show that the liver of the model animal is enlarged and yellowish in color, and the feces are yellow. After t-QL treatment, the condition has improved significantly, indicating that t-QL has a clear effect in improving cholestasis. The analysis results of liver index and stillbirth rate are shown in Fig.12 As shown in the figure, A is the liver index; B is the stillbirth rate. Compared with the Control group: ###, p < 0.001; compared with the Model group: *, p < 0.05; ** < 0.01; ***, p < 0.001; compared with the t-QL group: Φ , p<0.05; ΦФ , p<0.01; ФΦФ, p<0.001. It can be seen that the liver index and stillbirth rate of the model group were significantly higher than those of the normal control group, proving that the ICP model was successfully established. There were differences between the positive control group and the QL group and the model group, and there was a significant difference between t-QL and the model group. It can be seen that QL and t-QL can reduce the liver index and stillbirth rate of ICP rats, increase the possibility of fetal survival and improve liver lesions, and the effect of t-QL is significantly stronger than that of free Q7R and QL without targeted modification, confirming that t-QL can more effectively improve the liver index and stillbirth rate of ICP model rats.

[0116] The results of H&E staining (×200) and Masson staining (×200) are as follows Fig.13 As shown, it can be seen that the liver tissue structure of rats in the normal control group was normal, the liver cell structure was intact, the arrangement was tight, the cell nucleus was intact and clear, and no inflammation and necrosis were observed; the liver tissue structure of the model group was abnormal, the liver cells were of different sizes, the cytoplasm was loose, there were gaps between cells, and inflammatory infiltration occurred. The drug-treated groups all improved to varying degrees, and the improvement in the t-QL group was the most obvious. Masson staining results showed that no obvious blue collagen fiber deposition was observed in the liver tissue sections of the blank control group. However, in the liver tissue sections of the model group, hepatocyte degeneration was observed, and blue collagen fiber deposition was observed around the hepatocytes, indicating that the liver was damaged and fibrosis occurred. Drug treatment significantly reduced the degree of liver necrosis, fibrosis and inflammatory cell infiltration, and the improvement in the t-QL group was the most obvious. These results show that t-QL can more effectively prevent inflammation, necrosis and fibrosis of liver tissue in ICP rats.

[0117] The results of liver function biochemical indicators are as follows Fig.14 As shown in the figure, A is ALT; B is AST; C is γ-GGT; D is TBIL; E is TBA; F is AKP; G is MDA; H is SOD. Compared with the Control group: ###, p < 0.001; Compared with the Model group: *, p < 0.05; **, p < 0.01; ***, p < 0.001; Compared with the t-QL group: Φ , p<0.05; ΦФ , p<0.01; ФΦФ, p<0.001. It can be seen that the levels of serum ALT, AST, AKP, TBA, TBIL and γ-GGT in the model group rats increased significantly, and they all decreased after administration, and the t-QL group had the most obvious downregulation. In addition, cholestasis in ICP rats is often accompanied by changes in the level of oxidative stress. Bile acid can cause liver damage by inducing reactive oxygen species and produce oxidative stress, thereby affecting the levels of SOD and MDA. The results show that the SOD level in the model group decreased, and the MDA level increased significantly. After administration, there was some improvement, and the effect of the t-QL group was the most obvious, proving that t-QL can treat ICP by improving the level of oxidative stress. The experimental results show that the ICP rat model in this study was successfully established, and the peptide-modified tansylate liposomes had a better therapeutic effect on liver damage in ICP rats than the free Q7R group and the unmodified tansylate liposomes group, proving that t-QL can more effectively improve the liver function and oxidative stress of ICP model rats.

[0118] The results of mitochondrial related biochemical test indicators are as follows Fig.15 As shown in the figure, A is GDF-15; B is NAD + / NADH ratio; C is ATP. Compared with the Control group: ###, p < 0.001; Compared with the Model group: *, p < 0.05; **, p < 0.01; ***, p < 0.001; Compared with the t-QL group: Φ , p<0.05; ΦФ , p<0.01; ФΦФ , p<0.001. + The ratio of Q7R / NADH and ATP level were significantly decreased, and GDF-15 was significantly increased, all of which were improved after administration. The improvement effect of the t-QL group was significantly better than that of the free Q7R group and the unmodified xanthoglobin liposome group, proving that t-QL can more effectively treat ICP by improving mitochondrial function.

[0119] The protein expression levels of FXR, CYP7A1, and CYP27A1 were detected by Western Blot. Fig.16As shown, A is a semi-quantitative grayscale image of protein; B is a quantitative image of the relative expression of CYP7A1 protein; C is a quantitative image of the relative expression of CYP27A1 protein; D is a quantitative image of the relative expression of FXR protein. Compared with the Control group: ##, p < 0.01; ###, p < 0.001; compared with the Model group: *, p < 0.05, **, p < 0.01, ***, p < 0.001. It can be seen that the expression of CYP7A1 protein in the model group increased, and the expression of CYP27A1 and FXR proteins decreased, indicating that the model was successfully established; after t-QL treatment, the expression of CYP7A1 protein was significantly reduced, and the expression of CYP27A1 and FXR proteins was significantly increased, indicating that t-QL can improve bile acid homeostasis by inhibiting CYP7A1 and enhancing CYP27A1 and FXR, and has a good effect on improving abnormal bile metabolism.

[0120] Mitochondrial dysfunction results in Fig.17 As shown in the figure, A is a protein grayscale image; B is a relative expression quantification image of CDS2 protein; C is a relative expression quantification image of MFN2 protein; D is a relative expression quantification image of LCAT protein. Compared with the Control group: ##, p < 0.01; ###, p < 0.001; compared with the Model group: *, p < 0.05, **, p < 0.01, ***, p < 0.001. It can be seen that the expression of CDS2, MFN2 and LCAT proteins in the model group decreased, indicating that the model was successfully established; after t-QL treatment, the expression of CDS2, MFN2 and LCAT proteins increased significantly, indicating that t-QL can more effectively play a role in treating ICP by improving mitochondrial function.

[0121] Transmission electron microscopy of liver mitochondria Fig.18 As shown, it can be seen that the mitochondrial structure of the liver cells in the blank group is intact, the cristae structure is clear, and the mitochondrial matrix is ​​abundant; while the mitochondria in the model group are swollen, deformed or ruptured, and the inner cristae are almost disappeared; after administration of t-QL, the morphology of the mitochondria in the liver cells of the model animals was significantly improved, the swelling was reduced, and the inner cristae were clearly arranged, indicating that t-QL can treat ICP by improving the mitochondrial structure.

[0122] SIMCA14.1 software was used to draw the OPLS-DA score graph, and MetaboAnalyst6.0 system was used to draw the Heatmap analysis graph. The results of the effect of Q7R on the bile acid content in rats with cholestasis during pregnancy are shown in Figure 2. Fig.19As shown in the figure, A is the total ion current diagram of bile acid detection, B is the OPLS-DA score diagram; C is the Heatmap analysis diagram; it can be seen that the present invention uses UPLC-MS / MS to analyze 26 bile acids in the serum of ICP model rats, including free bile acids such as CA, CDCA, DCA, LCA, ILCA, α-MCA, β-MCA, γ-MCA, ω-MCA, and bound bile acids such as GCA, GCDCA, TCA, and TCDCA. The results show that in the bile acid profile of ICP model rats, the levels of 16 bile acids, including TCDCA, TCA, TDCA, THDCA, TUDCA, α-TMCA, GCDCA, GCA, GHDCA, LCA, UDCA, DCA, CA, α-MCA, β-MCA, and 12-KLCA, were significantly increased, and the CDCA level decreased, including 5 taurocholic acid substances, 3 glycocholic acid substances, 3 deoxycholic acid substances, and 1 lithocholic acid. PCA analysis and OPLS-DA score chart showed that the control group, drug intervention group, and model group were significantly distinguished, and the Heatmap results clearly reflected the changing trend of the sample bile acid profile. The above results show that after t-QL intervention, the serum bile acid level of ICP model rats is close to the normal value, indicating that t-QL has the effect of significantly improving the serum bile acid profile of ICP model rats and can play a role in treating ICP by regulating the bile acid level.

Claims

1. A liver-targeted nanoliposome containing xanthophyllotoxin, characterized in that: The invention is prepared from tansylated glycosides, phospholipid membrane materials, cholesterol membrane materials, functionalized phospholipid substances, liver-targeted substances, phosphate buffer solutions and organic solvents; the mass fractions of each substance are as follows: 2-20 parts of tansylated glycosides, 10-200 parts of phospholipid membrane materials, 3-30 parts of cholesterol membrane materials, 1-10 parts of functionalized phospholipid substances, 0.1-5 parts of liver-targeted substances, 20-200 parts of phosphate buffer solutions and 20-200 parts of organic solvents.

2. The xanthophyllotoxin liver-targeted nanoliposome according to claim 1, characterized in that: The mass proportions of each substance are as follows: 5-10 parts of tannin, 50-150 parts of phospholipid membrane materials, 10-20 parts of cholesterol membrane materials, 2-6 parts of functionalized phospholipid substances, 0.5-2 parts of liver targeting substances, 50-100 parts of phosphate buffer solutions, and 50-100 parts of organic solvents.

3. The xanthophyllotoxin liver-targeted nanoliposome according to claim 1 or 2, characterized in that: The phospholipid membrane material is selected from one or more of natural soybean lecithin, natural egg yolk lecithin, hydrogenated soybean lecithin, and distearoyl phosphatidylcholine; the functionalized phospholipid substance is DSPE-PEG2000-Mal; the cholesterol membrane material is selected from one of sodium cholesterol sulfate and cholesterol; the liver targeting substance is selected from one or more of A20FMDV2 peptide, SP94 peptide, N-acetylgalactosamine, and galactose.

4. A method for preparing the xanthophyllotoxin liver-targeted nanoliposomes according to any one of claims 1 to 3, characterized in that: The process includes the following: S1. Dissolving tannin, phospholipid membrane materials, cholesterol membrane materials and functionalized phospholipid substances in an organic solvent, placing the mixed solution in a round-bottom flask, removing the organic solvent in a water bath, and forming a uniform lipid film on the wall of the round-bottom flask; S2, adding phosphate buffer to the round-bottom flask in which the lipid film is formed in step S1, forming a liposome primary suspension after hydration, and breaking it by ultrasonication with a probe in an ice bath to obtain a liposome solution; S3. Add the liver targeting substance to the liposome solution prepared in step S2, incubate at room temperature, then dialyze in ultrapure water and sterilize to obtain the product.

5. The preparation method according to claim 4, characterized in that: The organic solvent in step S1 is one of methanol and ammonia-methanol solution; the water bath condition is 45-55° C. for 1-2 hours.

6. The preparation method according to claim 4, characterized in that: The hydration condition in step S2 is to treat at 50-60° C. for 5-10 min, and the ice bath condition in step S2 is to perform an ice water bath at 0-5° C.

7. The preparation method according to claim 4, characterized in that: The incubation condition in step S3 is incubation at 25° C. for 6 to 24 hours; the dialysis process uses phosphate buffer as the dialysis fluid, and the dialysis time is 8 to 16 hours.

8. Use of the xanthoglobin liver-targeted nanoliposomes as claimed in claim 1 in the preparation of a drug for treating cholestatic liver injury.

9. The use according to claim 8, characterized in that The cholestatic liver injury includes cholestatic hepatitis and intrahepatic cholestasis of pregnancy.

Images