Plant leaf curl protein BrmPHB as well as coding gene and application thereof

Abstract

The invention discloses a plant leaf curl protein BrmPHB as well as a coding gene and application thereof, and belongs to the field of gene functions. According to the invention, a specific primer is designed, a PCR technology is utilized, and a gene is cloned from an EMS mutant with increased leaf rolling degree of Chinese cabbage, and is named as BrmPHB; qPCR (quantitative polymerase chain reaction) analysis finds that the gene is massively expressed in a Chinese cabbage leaf roll mutant; a BrmPHB overexpression transgenic line is obtained through a transgenic technology, and it is observed that the leaf curling degree of the overexpression transgenic line is high. Therefore, the BrmPHB is a functional acquisition type gene capable of improving the leaf curling degree, can be used as a gene resource for improving the plant morphology, can realize plant gene editing accurate design breeding, and has important theoretical significance and application value in the aspects of creating new germplasm and improving yield and quality.

Description

Technical Field

[0001] The invention belongs to the field of gene function, and specifically relates to a plant leaf curling protein BrmPHB and a coding gene and application thereof. Background Art

[0002] Chinese cabbage (Brassica rapa L.ssp.pekinensis) belongs to the genus Brassica in the family Cruciferae. It is an important vegetable crop in my country, and its planting area and consumption are among the highest in the vegetable crops. In recent years, people have put forward further requirements for the variety characteristics of Chinese cabbage. The head is one of the most important agronomic traits of Chinese cabbage. The shape and size of the head are closely related to consumer demand, and therefore directly affect the quality and economic value of this vegetable crop. The wrinkles, curling and folding of the cabbage head are the main factors that determine the shape and size of the head. As the main edible organ of Chinese cabbage, the head is mainly formed by the inward bending of the leaves. This biological process is mainly affected by multiple factors such as genes, plant hormones and the external environment, and the regulatory network is complex. At present, there are few studies on the molecular mechanism of how leaves curl to promote head formation in Chinese cabbage.

[0003] In view of the above problems, it is particularly important to study a gene that can improve the curling degree and quality of plant leaves. Summary of the invention

[0004] In order to make up for the shortcomings of the prior art and improve the curling degree of plant leaves, the present invention provides a BrPHB single amino acid mutation, a protein BrmPHB and a coding gene capable of improving the curling degree of leaves and applications thereof.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0006] The first object of the present invention is to provide a protein BrmPHB for improving the curling degree of Chinese cabbage leaves, which is a protein as shown in (a) or (b):

[0007] (a) the amino acid sequence is a protein represented by the amino acid sequence of BrPHB in the original Chinese cabbage, and the amino acid sequence of the protein BrPHB is represented by SEQ ID NO.1;

[0008] (b) The protein shown in (a) is derived by replacing one amino acid to obtain the protein BrmPHB with the function of improving leaf curling. The amino acid sequence of the protein BrmPHB is shown in SEQ ID NO.2.

[0009] Preferably, the gene encoding the protein BrmPHB is obtained from a DNA molecule encoding the protein BrmPHB according to claim 1, wherein the DNA molecule is:

[0010] (1) The nucleotide sequence is a DNA molecule of the BrPHB gene, and the nucleotide sequence of the BrPHB gene is shown in SEQ ID NO.3;

[0011] (2) The nucleotide sequence is the BrmPHB gene derived by replacing, deleting or / and inserting one or more bases based on the nucleotide sequence of the BrPHB gene. The nucleotide sequence of the BrmPHB gene is shown in SEQ ID NO.4.

[0012] Preferably, the open reading frame of the BrmPHB gene is 2532 bp, encoding 844 amino acid residues.

[0013] Preferably, the amplification primer pair for the BrmPHB gene is as shown in SEQ ID NO.5.

[0014] The invention also provides an application of a gene encoding protein BrmPHB, which is applied to cultivating and improving the curling degree of Chinese cabbage leaves.

[0015] Beneficial effects:

[0016] Compared with the prior art, the present invention designs specific primers, utilizes PCR technology, clones a gene from an EMS mutant of Chinese cabbage leaf curling, and names it BrmPHB; uses Northern blot technology and RT-qPCR technology to detect RNA transcripts and gene expression levels of the BrPHB gene in wild-type Chinese cabbage A03 and Chinese cabbage leaf curling mutant lic1, and uses ImageJ software to analyze the grayscale of the target band, and the results show that the RNA transcripts and gene expression levels of BrmPHB in the Chinese cabbage leaf curling mutant lic1 are higher than those in the wild-type A03; uses VIGS technology to verify the function of the BrmPHB gene, and observes the phenotype to find that the phenotype of the pTY-s silenced strain does not change significantly, the BrPDS silenced strain shows an albino phenotype, and in the wild-type A03 , the phenotype of the BrPHB silenced strain of Chinese cabbage did not change, and the leaf curling degree of the BrmPHB silenced strain of Chinese cabbage was significantly weakened in the leaf curling mutant lic1. The results showed that the BrmPHB gene was the key gene of the leaf curling mutant lic1 of Chinese cabbage; by overexpressing the BrPHB gene in the Arabidopsis background, the phenotype and expression level were analyzed, and the phenotype was observed. It was found that overexpression of BrPHB and BrmPHB genes could change the dorsal-ventral polarity of Arabidopsis leaves, resulting in the phenotype of inward curling of Arabidopsis leaves. Among them, the leaf curling degree of Arabidopsis strains overexpressing the BrmPHB gene was much greater than that of Arabidopsis strains overexpressing the BrPHB gene. Therefore, BrmPHB is a gain-of-function gene that can increase the degree of leaf curling, which can be used as a gene resource for improving plant morphology, and can realize plant gene editing and precise design breeding. It has important theoretical significance and application value in creating new germplasm and improving yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 To identify the phenotype of the Chinese cabbage mutant lic1;

[0018] Figure 2 The expression and transcription level analysis of BrPHB gene in Chinese cabbage A03 and mutant lic1;

[0019] Figure 3 Verification of BrPHB gene function for Chinese cabbage VIGS;

[0020] Figure 4 The expression level analysis of target genes in Chinese cabbage VIGS lines;

[0021] Figure 5 To analyze the phenotypes of overexpressed BrPHB and BrmPHB genes in Arabidopsis;

[0022] Figure 6 is the expression of BrPHB gene in Arabidopsis;

[0023] Need to explain:

[0024] Figure 1 A is the seedling stage; C is the rosette stage; D is the head stage; B is the leaf morphology; E-F are the cross sections of the leaf head; G is the phenotypic analysis of the hybrid offspring;

[0025] Figure 2 Figure A is the RNA transcription level of BrPHB gene in A03 and lic1, Figure B is the expression level of BrPHB gene in A03 and lic1, M is marker, 0.06 and 0.04 are ImageJ grayscale analysis, and a represents extremely significant difference at the 0.01 level;

[0026] Figure 3 From top to bottom in the figure are the phenotypes produced after bombardment of BrPHB gene in A03 and lic1, PDS is the positive control, PTY is the negative control, and the red dots represent the shooting and sampling sites.

[0027] Figure 5 35S::BrPHB is the BrPHB gene in the overexpressed Chinese cabbage A03, 35S::Brphb is the BrPHB gene in the overexpressed mutant lic1, Bar=3cm;

[0028] Figure 6 Figure A shows the expression of BrPHB gene in Arabidopsis, and different letters represent significant differences. Figure B shows the translation level of BrPHB protein in Arabidopsis. Figure C shows Coomassie brilliant blue staining of extracted Arabidopsis total protein. DETAILED DESCRIPTION

[0029] The following description is used to disclose the present invention so that those skilled in the art can implement the present invention. The preferred embodiments described below are only examples, and those skilled in the art can think of other obvious variations. The basic principles of the present invention defined in the following description can be applied to other embodiments, variations, improvements, equivalents, and other technical solutions that do not deviate from the spirit and scope of the present invention.

[0030] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments:

[0031] Example 1

[0032] 1. Experimental Materials and Reagents

[0033] The wild type WT of Chinese cabbage was used to create the homozygous genotype of EMS mutants and contained the BrPHB gene. The leaf curl mutant lic1 was obtained by screening after EMS mutagenesis of wild type seeds and contained the BrmPHB gene. Escherichia coli 'DH5α' competent cells and Agrobacterium tumefaciens strain 'GV3101' were preserved by the State Key Laboratory of Crop Improvement and Regulation in North China, Hebei Agricultural University. Various restriction endonucleases and buffers were purchased from TaKaRa, the column-type plant total RNA isolation, extraction and purification kit was purchased from Shanghai Shenggong Biotechnology Co., Ltd., and the plasmid miniprep kit (upgraded centrifugal column type) was purchased from Shanghai Jierui Biotechnology Co., Ltd. Taq DNA polymerase, dNTPs, Taq Buffer, T4 DNA ligase, PCR purification and recovery kit, PCR gel excision recovery kit, cloning vector pEASY-T1 kit, EasyScript One-Step gDNA Removall andcDNA Synthesis SuperMix kit, and TransStart Top Green qPCR SuperMix kit were all purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0034] 2. Experimental methods and results analysis: Cloning and expression analysis of BrPHB and BrmPHB genes in Chinese cabbage

[0035] (1) Total RNA extraction and first-chain cDNA synthesis

[0036] The extraction of RNA from Chinese cabbage leaves was carried out according to the method of Promega Biotechnology Co., Ltd. RNA was extracted using the method in the Super Total RNA Extraction Kit. The first-strand cDNA synthesis was performed according to the instructions of the EasyScript One-Step gDNA Removaland cDNA Synthesis SuperMix Kit.

[0037] (2) Cloning of BrPHB and BrmPHB genes in Chinese cabbage

[0038] Primers were designed, and the primers were ZJ1:ATGATGGTCCACACGATGCACAG; ZJ2:TCAAACGAAGGACCAATTAACGAAC. PCR amplification was performed using the cDNA of Chinese cabbage leaves as a template, and the PCR product was connected to a T vector for sequencing, which was completed by Shanghai Sangon Biotechnology Co., Ltd. The results showed that the size of the obtained fragment was consistent with the expected size. The fragment was 2532 bp in length, with a mutation site at position 589, containing a complete ORF reading frame starting from ATG and ending with TGA, encoding 844 amino acid residues (see sequence 3 and sequence 4 in the sequence list).

[0039] (3) Expression analysis of BrPHB and BrmPHB genes in Chinese cabbage

[0040] Total RNA was extracted from Chinese cabbage leaves and reverse transcribed into cDNA. The cDNA was used as a template for RT-qPCR analysis. The expression of BrPHB and BrmPHB genes in Chinese cabbage was detected by RT-qPCR. The primers for amplifying BrPHB and BrmPHB genes were: ZJ1: ATGATGGTCCACAC GATGCACAG; ZJ2: TCAAACGAAGGACCAATTAACGAAC. The Chinese cabbage Actin2 gene (BAA05g28840) was used as the internal reference gene, and the amplification primers were: F: 5'-ACGTGGACATCAGG AAGGAC; R: 5'-GAACCACCGATCCAGACACT. The reaction system used for RT-qPCR was 20 μL, with cDNA as the template. The specific reaction system was configured according to the instructions of the kit. Cha mQ Universal SYBR q-PCR Master Mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The relative expression of genes was analyzed by real-time fluorescence quantitative PCR technology. Amplification conditions were as follows: pre-denaturation at 95°C for 2 min; 95°C for 30 s, annealing at 58°C for 10 s, extension at 68°C for 10 s, 40 cycles; then reaction melting curve analysis at 60-95°C. Three technical replicates were set for each reaction. Gene expression was analyzed using the CFX Connect Optics Module Bio-Rad fluorescent quantitative PCR instrument, using 2 -ΔCT Methods Data analysis and processing. The RNA transcripts and gene expression levels of BrPHB in wild-type A03 and leaf curl mutant lic1 were detected by Northern blot and RT-qPCR. ImageJ software was used to analyze the grayscale of the target bands. The results showed that the RNA transcripts and gene expression levels of BrPHB in the leaf curl mutant lic1 were higher than those in the wild-type A03. Figure 2 .

[0041] (4) Functional verification of BrPHB and BrmPHB genes in Chinese cabbage using VIGS technology

[0042] According to the specific requirements for constructing VIGS vector, a gene sequence with a length of 40bp was selected, and the selected fragments were specifically detected on the Chinese cabbage BRAD website (www.brassicabd.com); the vectors required for VIGS were provided by Nanjing Jinruis Biotechnology Co., Ltd.; the wild type A03 and the leaf curl mutant lic1 with the same growth status were selected, and the cabbage was bombarded with gene guns after the two cotyledons were unfolded. After the bombardment, the cabbage was cultured in the dark for 24 hours and then cultured normally; the RT-qPCR technology was used to determine the expression level of the BrPHB gene in the pTY-s silenced strain and the Chinese cabbage BrPHB silenced strain, and the results showed that the expression level of the BrPHB gene in the Chinese cabbage BrPHB silenced strain was significantly lower than that in the pTY-s silenced strain. Phenotypic observations revealed that the phenotype of the pTY-s silenced strain did not change significantly, the BrPDS silenced strain showed an albino phenotype, and the phenotype of the BrPHB silenced strain of Chinese cabbage did not change in the wild type A03. In the leaf curl mutant lic1, the leaf curling degree of the BrPHB silenced strain of Chinese cabbage was significantly weakened. The results showed that the BrPHB gene is the key gene of the leaf curl mutant lic1 of Chinese cabbage, see Figure 3 , 4 .

[0043] Example 2

[0044] 1. Experimental Materials and Reagents

[0045] Same as Example 1.

[0046] 2. Experimental methods and results analysis: Phenotypic and leaf roll analysis of BrPHB and BrmPHB overexpressing transgenic Arabidopsis thaliana strains

[0047] Homozygous screening was performed on the T1 generation K303-35S::BrPHB-GFP Arabidopsis strains; Arabidopsis seeds were placed in 75% alcohol for 1-2 minutes, rinsed once with ddH2O, and 5% sodium hypochlorite for 6 minutes, and finally rinsed with ddH2O for 5 times until clean; the seeds were disinfected and sown on 1 / 2MS solid culture medium containing Kan+100-200 mg / L, and cultured in an incubator at 20°C, 12h light / 12h dark. Arabidopsis was transplanted after growing 2 true leaves and cultured in a light incubator under the same conditions until the seeds were harvested. T2 seeds were harvested from a single plant, and each plant was a strain; the screened T3 generation strains of K303-35S::BrPHB-GFP and K303-35S::BrmPHB-GFP and Arabidopsis wild type col were sown in a light incubator for culture, and the phenotypic differences were observed; RT-qPCR and Western The expression of BrPHB gene and the translation level of BrPHB protein in Arabidopsis were detected by blot, and the results showed that BrPHB gene was successfully overexpressed in Arabidopsis; after the BrPHB gene before and after mutation was successfully overexpressed in Arabidopsis, T3 generation strains were obtained after homozygous screening; after sowing the T3 generation strains, the phenotype was observed and it was found that overexpression of BrPHB and BrmPHB genes could change the dorsoventral polarity of Arabidopsis leaves, resulting in the phenotype of inward curling of Arabidopsis leaves, among which the curling degree of leaves of Arabidopsis strains overexpressing BrmPHB gene was much greater than that of Arabidopsis strains overexpressing BrPHB gene, see Figure 6 .

[0048] In summary, the BrmPHB of the present invention is a gain-of-function gene that can increase the degree of leaf curling. The leaf curling degree of Chinese cabbage containing the BrmPHB gene is increased, and the appearance quality is significantly improved. The BrmPHB overexpressing transgenic strain is obtained by transgenic technology, and the leaves of the overexpressing transgenic strain are measured, and the leaf curling degree of the overexpressing transgenic strain is significantly increased.

[0049] SEQ ID NO.1

[0050] MMVHTMHRESPDKGLDSGKYVRYTPEQVEALERVYTECPKPSSLRRQQLIRECPILSNIEPKQIKVWFQNRRCREKQRKEAARLQTVNRKLNAMNKLLMEENDRLQKQVSHLVYENGHMKHQIHTASGTTTDNSCESVVVASGQQHQQQNPNPQHLQRDANNPAGLLSIAKEALAEFLSKATGTAVDWVQMIGMKPGPDSIGIVAISRNCSGIAARACGLVSLEPMKVAEILKDRPSWLRDCRSVDTLSVIPAGNGGTIELIYTQMYAPTTLAAARDFWTLRYTTCLEDGSYVVCEGSLSAATGGPTGPPSSNFVRAEMRPSGFLIRPCDGGGSILHIVDHVDLDALSVPEVMRPLYESSKILAQKMTVAALRHVRQIAQETSGEVQYGGGRQPAVLRTFSQRLSRGFNDAVNGFVDDGWSPLGSDGAEDITLMINLSPGKFGGNSFLPSFGSGVLCAKASMLLQNVPPAVLVRFLREHRSEWADYGVDAYAAASLRASPFAVPCARAGGLPSNQVILPLAQTVEHEEFLEVVRLEGHAYSPKDMGLARDMYLLQLCSGVDEDVVGGCAQLVFAPIDESFADDAPLLPSGFRVIPLEPKSTSNNASVNRTLDLASALEGSTRQGGEADPNGCHFRSVLTIAFQFTFDNHTRDNVASMARQYVRNIVGSIQRVALAIAPRPDSSISPISAPTSPEALTLVRWISRSYRVHTGVDLFGSDSQTSGDTLLHQVWSHTDAILCCSMKTNASPVFTFANQTGLDMLETTLVSLQDITLDKTLDEPGRKALCSEFPKIMQQGYAHLPAGVCASSMGRLVSYEQATVWKVLEDDESNHCLAFMFVNWSFV*

[0051] SEQ ID NO.2

[0052] MMVHTMHRESPDKGLDSGKYVRYTPEQVEALERVYTECPKPSSLRRQQLIRECPILSNIEPKQIKVWFQNRRCREKQRKEAARLQTVNRKLNAMNKLLMEENDRLQKQVSHLVYENGHMKHQIHTASGTTTDNSCESVVVASGQQHQQQNPNPQHLQRDANNPAGLLSIAKEALAEFLSKATGTAVDWVQMIGMKPSPDSIGIVAISRNCSGIAARACGLVSLEPMKVAEILKDRPSWLRDCRSVDTLSVIPAGNGGTIELIYTQMYAPTTLAAARDFWTLRYTTCLEDGSYVVCEGSLSAATGGPTGPPSSNFVRAEMRPSGFLIRPCDGGGSILHIVDHVDLDALSVPEVMRPLYESSKILAQKMTVAALRHVRQIAQETSGEVQYGGGRQPAVLRTFSQRLSRGFNDAVNGFVDDGWSPLGSDGAEDITLMINLSPGKFGGNSFLPSFGSGVLCAKASMLLQNVPPAVLVRFLREHRSEWADYGVDAYAAASLRASPFAVPCARAGGLPSNQVILPLAQTVEHEEFLEVVRLEGHAYSPKDMGLARDMYLLQLCSGVDEDVVGGCAQLVFAPIDESFADDAPLLPSGFRVIPLEPKSTSNNASVNRTLDLASALEGSTRQGGEADPNGCHFRSVLTIAFQFTFDNHTRDNVASMARQYVRNIVGSIQRVALAIAPRPDSSISPISAPTSPEALTLVRWISRSYRVHTGVDLFGSDSQTSGDTLLHQVWSHTDAILCCSMKTNASPVFTFANQTGLDMLETTLVSLQDITLDKTLDEPGRKALCSEFPKIMQQGYAHLPAGVCASSMGRLVSYEQATVWKVLEDDESNHCLAFMFVNWSFV*

[0053] SEQ ID NO.3

[0054]

[0055] SEQ ID NO.4

[0056]

[0057] SEQ ID NO.5

[0058] ZJ1:ATGATGGTCCACACGATGCACAG

[0059] ZJ2:TCAAACGAAGGACCAATTAACGAAC

[0060] Those skilled in the art should understand that the embodiments of the present invention described above and shown in the accompanying drawings are only examples and do not limit the present invention. The objectives of the present invention have been fully and effectively achieved. The functional and structural principles of the present invention have been demonstrated and explained in the embodiments. Without departing from the principles, the implementation methods of the present invention may be deformed or modified in any way.

Claims

1. A protein BrmPHB for improving the curling degree of Chinese cabbage leaves, characterized in that: is a protein as shown in (a) or (b): (a) the amino acid sequence is a protein represented by the amino acid sequence of BrPHB in the original Chinese cabbage, wherein the amino acid sequence of the protein BrPHB is represented by SEQ ID NO.1; (b) The protein shown in (a) is derived by replacing one amino acid to obtain the protein BrmPHB with the function of improving leaf curling. The amino acid sequence of the protein BrmPHB is shown in SEQ ID NO.

2.

2. A gene encoding a protein BrmPHB that increases the curling degree of Chinese cabbage leaves, characterized in that: The gene encoding the protein BrmPHB is obtained from a DNA molecule encoding the protein BrmPHB according to claim 1, wherein the DNA molecule is: (1) The nucleotide sequence is a DNA molecule of the BrPHB gene, and the nucleotide sequence of the BrPHB gene is shown in SEQ ID NO.3; (2) The nucleotide sequence is a BrmPHB gene derived by replacing, deleting or / and inserting one or more bases based on the nucleotide sequence of the BrPHB gene. The nucleotide sequence of the BrmPHB gene is shown in SEQ ID NO.

4.

3. A gene encoding plant leaf curling protein BrmPHB according to claim 2, characterized in that: The open reading frame of the BrmPHB gene is 2532 bp, encoding 844 amino acid residues.

4. A set of primer pairs for amplifying gene BrmPHB, as shown in SEQ ID NO.

5.

5. Use of a protein BrmPHB or a coding gene for improving the curling degree of Chinese cabbage leaves in cultivating Chinese cabbage with improved leaf curling degree.

Images