Method for producing deoxyuridine triphosphate from recombinant strain
By CRISPR/Cas9 gene editing of E. coli, the recombinant strain was constructed, which solved the problems of low production efficiency and cumbersome purification in the prior art, and achieved efficient and economical production of deoxyuridine triphosphate and high purity extraction.
Patent Information
- Application Number
- CN202211727957.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-30
- Publication Date
- 2025-02-07
AI Technical Summary
The prior art has problems with long reaction time, low yield and lack of general methods and cumbersome purification schemes when producing deoxyuridine triphosphate (dNTP).
Through CRISPR/Cas9-mediated gene editing method, E. coli was targetedly modified, knocked out nucleotide enzyme and nucleoside pyrophosphate genes, integrated uridine kinase and dUMP kinase genes, and constructed recombinant strains to efficiently produce deoxyuria Glycoside triphosphate.
It has achieved efficient production of deoxyuridine triphosphate, with a conversion rate of 80% to 90%. After purification by ion exchange chromatography, the purity can reach more than 99%, providing economical and environmentally friendly production technology.
Smart Images
Figure CN119391736A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and in particular to a method for producing deoxyuridine triphosphate using a recombinant strain. Background Art
[0002] Nucleosides and their derivatives play an important role in cell metabolism and are widely used in medicine, food and scientific research. Among them, deoxynucleoside-5′-triphosphates (dNTPs) are important precursors in DNA synthesis and are indispensable reagents in molecular biology research. The polymerase chain reaction (PCR) and other PCR applications for DNA synthesis require deoxynucleoside triphosphates (dNTPs) as essential precursors and substrates. There are four components of dNTP: deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP) and deoxythymidine triphosphate (dTTP). Due to the increasing number of PCR applications for DNA biosynthesis in the biotechnology research community and industry, the demand for dNTPs is steadily increasing.
[0003] Traditionally, dNTPs are chemically synthesized. For example, deoxynucleosides are directly phosphorylated by phosphorus oxychloride (POCl3) in a solvent to generate the corresponding deoxynucleotides. Many deoxynucleotide derivatives have been synthesized by this method. However, there are many challenges when using chemical synthesis, such as long reaction times and low yields. In addition, the main disadvantages are the lack of a universal method applicable to all nucleosides and cumbersome purification schemes.
[0004] Patent CN1269422A discloses a method for preparing deoxyribonucleoside triphosphates, using natural DNA as raw material to prepare dNTPs through enzymatic hydrolysis-enzymatic-chemical synthesis, with a total yield of 45-80%. However, the source and cost of natural DNA, the purification cost of byproducts of chemical reactions, and yield stability are limiting factors. The use of whole microbial cells (such as yeast or Escherichia coli) can be directly used as a biocatalyst to avoid expensive protein purification processes. However, due to the presence of various enzymes in the cells, such reactions are uncontrollable and the product yield is not ideal. However, if the genes of microbial cells are directed to be modified and the key enzymes for synthesizing specific products are overexpressed, the reaction can be effectively controlled to obtain a stable yield.
[0005] Based on the above reasons, the inventors provide a method for producing deoxyuridine triphosphate using a recombinant strain. Summary of the invention
[0006] 1. Technical problems to be solved: In view of the above technical problems, the present invention provides a method for producing deoxyuridine triphosphate by a recombinant strain.
[0007] 2. Technical solution: A method for producing deoxyuridine triphosphate by a recombinant strain comprises the following steps: Step 1: Use CRISPR / Cas9-mediated gene editing to modify the E. coli genome. The modification includes the following: a. Knockout nucleotidase genes (yfbR / yfdR / ushA / umpH / umpG / yjjG) to block the degradation of dUMP to dU; b. Integrate the endogenous uridine kinase gene tdk of E. coli at the pseudogene site mbhA to strengthen the phosphorylation pathway of dU; c. Integrate the endogenous dUMP kinase gene tmk of E. coli at the pseudogene site yeeP to strengthen the phosphorylation pathway of dUMP; d. Knockout the nucleoside triphosphate pyrophosphatase gene (dut) to block the degradation of dUTP to dUMP; e. Knockout the thymidylate synthase gene (thyA) to block the degradation of dUMP to dTMP; Step 2: Using deoxyuridine as the starting substrate, genetically modified Escherichia coli is used to ferment and produce deoxyuridine triphosphate.
[0008] Furthermore, the gene sequence of the uridine kinase gene tdk is: 1ATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACAGCATTGTTG 61CAATCTTCATACAATTACCAGGAACGCGGCATGCGCACTGTCGTATATACGGCAGAAATT 121GATGATCGCTTTGGTGCCGGGAAAGTCAGTTCGCGTATAGGTTTGTCATCGCCTGCAAAA 181TTATTTAACCAAAATTCATCATTATTTGATGAGATTCGTGCGGAACATGAACAGCAGGCA 241ATTCATTGCGTACTGGTTGATGAATGCCAGTTTTTAACCAGACAACAAGTATATGAATTA 301TCGGAGGTTGTCGATCAACTCGATATACCCGTACTTTGTTATGGTTTACGTACCGATTTT 361CGAGGTGAATTATTTATTGGCAGCCAATACTTACTGGCATGGTCCGACAAACTGGTTGAA 421TTAAAAACCATCTGTTTTTGTGGCCGTAAAGCAAGCATGGTGCTGCGTCTTGATCAAGCA 481GGCAGACCTTATAACGAAGGTGAGCAGGTGGTAATTGGTGGTAATGAACGATACGTTTCT 541GTATGCCGTAAACACTATAAAGAGGCGTTACAAGTCGACTCATTAACGGCTATTCAGGAA 601AGGCATCGCCACGATTAA。
[0009] Furthermore, the gene sequence of the dUMP kinase gene tmk is as follows: 1ATGCGCAGTAAGTATATCGTCATTGAGGGGCTGGAAGGCGCAGGCAAAACTACCGCGCGT 61AATGTGGTGGTTGAGACGCTCGAGCAACTGGGTATCCGCGACATGGTTTTCACTCGGGAA 121CCTGGCGGTACGCAACTTGCCGAAAAGTTAAGAAGCCTGGTGCTGGATATCAAATCGGTA 181GGCGATGAAGTCATTACCGATAAAGCCGAAGTTCTGATGTTTTATGCCGCGCGCGTTCAA 241CTGGTAGAAACGGTCATCAAACCAGCTCTGGCTAACGGCACCTGGGTGATTGGCGATCGC 301CACGATCTCTCCACTCAGGCGTATCAGGGCGGCGGACGTGGTATTGACCAACATATGCTG 361GCAACACTGCGTGATGCTGTTCTCGGGGATTTTCGCCCCGACTTAACGCTCTATCTCGAT 421GTTACCCCGGAAGTTGGCTTAAAACGCGCGCGTGCGCGCGGCGAGCTGGATCGTATTGAG 481CAAGAATCTTTCGATTTCTTTAATCGCACCCGCGCCCGCTATCTGGAACTGGCAGCACAA 541GATAAAAGCATTCATACCATTGATGCCACCCAGCCGCTGGAGGCCGTGATGGATGCAATC 601CGCACTACCGTGACCCACTGGGTGAAGGAGTTGGACGCATGA.
[0010] Furthermore, the plasmids used in the CRISPR / Cas9-mediated gene editing method are pTarget and pCas9, respectively, wherein pCas carries the elimination system of pTarget, the Red recombination system of λ phage and the Cas9 protein expression system, and pTarget contains the sgRNA sequence, the N20 sequence and the donor DNA fragment.
[0011] Furthermore, in step 1, the nucleotidase gene (yfbR / yfdR / ushA / umpH / umpG / yjjG), the nucleoside triphosphate pyrophosphatase gene (dut) and the thymidylate synthase gene (thyA) are knocked out by the following steps: S1: According to the corresponding gene sequence to be knocked out, use the tool CRISPRRGENTools to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence; S2: construct according to the instructions of the plasmid vector kit, and synthesize the sgRNA expression frame and recombinant fragment containing the N20 sequence by gene synthesis; S3: After gene synthesis, use the primers provided by the plasmid vector kit to amplify the PCR product-sgRNA fragment, connect the sgRNA fragment to the pTarget plasmid to obtain the gene editing plasmid pTarget-X, where X is the gene to be knocked out. pTarget-X is electroporated into the competent cells in the previous transformation stage, and single colonies are obtained by recovery culture. Positive recombinants are obtained by PCR colony verification; S4: Cultivate the positive strain expressing sgRNA, prepare electroporation competent cells, electroporate the pCas9 plasmid into electroporation competent cells, resuscitate and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then remove the gene editing plasmids pTarget-X and pCas9 in turn.
[0012] Further, the steps of integrating the endogenous uridine kinase gene tdk of Escherichia coli into the pseudogene site mbhA are as follows: S1: Based on the mbhA gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the tool CRISPRRGENTools to design the N20 sequence; S2: According to the instructions of the plasmid vector kit, the sgRNA expression frame containing the N20 sequence and the recombinant endogenous tdk sequence were first synthesized by gene synthesis; S3: After gene synthesis, use the primers provided in the kit to amplify the PCR product-sgRNA-tdk fragment, then connect the sgRNA-tdk fragment to the pTarget plasmid, electroporate pTarget-mbhA-tdk into the competent cells in the previous transformation stage, resuscitate and culture to obtain a single colony, and verify the positive recombinant by PCR colony; S4: Cultivate the positive strain expressing sgRNA, prepare the electroporation competent state, electroporate the pCas9 plasmid into the electroporation competent cells, resuscitate and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then remove the gene editing plasmids pTarget-mbhA-tdk and pCas9 in turn.
[0013] Further, the steps of integrating the endogenous dUMP kinase gene tmk of Escherichia coli into the pseudogene site yeeP are as follows: S1: Based on the yeeP gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the tool CRISPRRGENTools to design the N20 sequence; S2: According to the instructions of the plasmid vector kit, the sgRNA expression frame containing the N20 sequence and the recombinant endogenous tmk sequence were first synthesized by gene synthesis; S3: After gene synthesis, use the primers provided in the kit to amplify the PCR product-sgRNA-tmk fragment, then connect the sgRNA-tmk fragment to the pTarget plasmid, electroporate pTarget-yeeP-tmk into the competent cells after the previous transformation stage, resuscitate and culture to obtain a single colony, and verify the positive recombinant by PCR colony; S4: Cultivate the positive strain expressing sgRNA, prepare the electroporation competent state, electroporate the pCas9 plasmid into the electroporation competent cells, resuscitate and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then remove the gene editing plasmids pTarget-yeeP-tmk and pCas9 in turn.
[0014] Furthermore, the operation method of step 2 is: inoculating the genetically modified Escherichia coli strain into a seed culture medium, and culturing it to a secondary seed by a seed expansion culture method; inoculating the seed liquid into a fermentation medium containing nutrients and a starting substrate deoxyuridine according to an inoculation amount of 10-15%, and starting fermentation culture; the initial pH of the fermentation is controlled at 7.0±0.2, and after fermentation for 8-10 hours, the pH is maintained at 6.55±0.1 by adding ammonia water, and after fermentation for 12 hours, feedback control is started to add nutrients and starting substrates. During the whole process, the dissolved oxygen is controlled at 30-40%, the temperature is controlled at 37°C, and the fermentation cycle is 36 hours.
[0015] 3. Beneficial effects: The present invention provides a method for producing deoxyuridine triphosphate by a recombinant strain, which uses a CRISPR / Cas9-mediated genome editing method to perform a series of metabolic engineering modifications on Escherichia coli, by knocking out the genes of nucleoside triphosphate pyrophosphatase, thymidylate synthase and nucleotidase, blocking the related enzymes of the degradation pathway of deoxyuridine triphosphate and its precursors; by integrating the endogenous uridine kinase and dUMP kinase genes of Escherichia coli, overexpressing the key enzymes of synthesis, promoting the synthesis of deoxyuridine triphosphate, and constructing a strain with high deoxyuridine triphosphate production. The recombinant strain is constructed by knocking out the enzymes related to the degradation pathway and overexpressing the key enzymes of the synthesis pathway (tdk / tmk) to obtain the metabolic pathway. In the first step, deoxyuridine is used as the starting substrate, and the substrate is converted into dUMP through tdk catalysis. In the second step, dUMP is converted into dUDP through tmk catalysis. Finally, deoxyuridine triphosphate is produced through the recombinant strain's own phosphokinase. The conversion rate reaches 80%~90%. After purification by ion exchange chromatography, the purity can reach more than 99%, which will provide industry and research with an economically competitive and environmentally friendly feasible technology. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 This is the metabolic pathway of the strain after gene-directed modification in Example 1. DETAILED DESCRIPTION
[0017] The present invention will be described in detail below with reference to the accompanying drawings.
[0018] Example 1 Construction of a strain with high production of deoxyuridine triphosphate The CRISPR / Cas9-mediated gene editing method was used to perform targeted modification of the Escherichia coli genome. The targeted modification included the following: a. Knockout of nucleotidase genes (yfbR / yfdR / ushA / umpH / umpG / yjjG) to block the degradation of dUMP to dU; b. Integrate the endogenous uridine kinase gene tdk of Escherichia coli at the pseudogene site mbhA to strengthen the phosphorylation pathway of dU; c. Integrate the endogenous dUMP kinase gene tmk of Escherichia coli at the pseudogene site yeeP to strengthen the phosphorylation pathway of dUMP; d. Knockout of the nucleoside triphosphate pyrophosphatase gene (dut) to block the degradation of dUTP to dUMP; e. Knockout of the thymidylate synthase gene (thyA) to block the degradation of dUMP to dTMP.
[0019] The metabolic pathways of the strains modified by gene targeting are as follows Figure 1 shown.
[0020] The gene sequence of the uridine kinase gene tdk is: 1ATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACAGCATTGTTG 61CAATCTTCATACAATTACCAGGAACGCGGCATGCGCACTGTCGTATATACGGCAGAAATT 121GATGATCGCTTTGGTGCCGGGAAAGTCAGTTCGCGTATAGGTTTGTCATCGCCTGCAAAA 181TTATTTAACCAAAATTCATCATTATTTGATGAGATTCGTGCGGAACATGAACAGCAGGCA 241ATTCATTGCGTACTGGTTGATGAATGCCAGTTTTTAACCAGACAACAAGTATATGAATTA 301TCGGAGGTTGTCGATCAACTCGATATACCCGTACTTTGTTATGGTTTACGTACCGATTTT 361CGAGGTGAATTATTTATTGGCAGCCAATACTTACTGGCATGGTCCGACAAACTGGTTGAA 421TTAAAAACCCATCTGTTTTTGTGGCCGTAAAGCAAGCATGGTGCTGCGTCTTGATCAAGCA 481GGCAGACCTTATAACGAAGGTGAGCAGGTGGTAATTGGTGGTAATGAACGATACGTTTCT 541GTATGCCGTAAACACTATAAAGAGGCGTTACAAGTCGACTCATTAACGGCTATTCAGGAA 601AGGCATCGCCACGATTAA。
[0021] The gene sequence of the dUMP kinase gene tmk is as follows: 1ATGCGCAGTAAGTATATCGTCATTGAGGGGCTGGAAGGCGCAGGCAAAACTACCGCGCGT 61AATGTGGTGGTTGAGACGCTCGAGCAACTGGGTATCCGCGACATGGTTTTCACTCGGGAA 121CCTGGCGGTACGCAACTTGCCGAAAAGTTAAGAAGCCTGGTGCTGGATATCAAATCGGTA 181GGCGATGAAGTCATTACCGATAAAGCCGAAGTTCTGATGTTTTATGCCGCGCGCGTTCAA 241CTGGTAGAAACGGTCATCAAACCAGCTCTGGCTAACGGCACCTGGGTGATTGGCGATCGC 301CACGATCTCTCCACTCAGGCGTATCAGGGCGGCGGACGTGGTATTGACCAACATATGCTG 361GCAACACTGCGTGATGCTGTTCTCGGGGATTTTCGCCCCGACTTAACGCTCTATCTCGAT 421GTTACCCCGGAAGTTGGCTTAAAACGCGCGCGTGCGCGCGGCGAGCTGGATCGTATTGAG 481CAAGAATCTTTCGATTTCTTTAATCGCACCCGCGCCCGCTATCTGGAACTGGCAGCACAA 541GATAAAAGCATTCATACCATTGATGCCACCCAGCCGCTGGAGGCCGTGATGGATGCAATC 601CGCACTACCGTGACCCACTGGGTGAAGGAGTTGGACGCATGA.
[0022] The present invention adopts a CRISPR / Cas9-mediated genome editing method to construct an engineering strain. The plasmids used in this method are pTarget and pCas9, respectively. pCas carries the elimination system of pTarget, the Red recombination system of lambda phage and the Cas9 protein expression system; pTarget contains an sgRNA sequence, an N20 sequence and a donor DNA fragment.
[0023] The specific transformation process is as follows: a1) yfbR gene knockout According to the yfbR gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The plasmid vector kit instructions were followed for construction. First, the sgRNA expression frame and recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the PCR product-sgRNA fragment was amplified using the primers provided by the kit, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-yfbR was electrotransformed into the competent cells of Escherichia coli, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmids pTarget-yfbR and pCas9 were removed in sequence, that is, strain UT1.
[0024] a2) yfdR gene knockout According to the yfdR gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The plasmid vector kit instructions were followed for construction. First, the sgRNA expression frame and recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the PCR product-sgRNA fragment was amplified using the primers provided by the kit, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-yfdR was electrotransformed into UT1 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmids pTarget-yfdR and pCas9 were removed in sequence, that is, strain UT2.
[0025] a3) ushA gene knockout According to the ushA gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The construction was carried out according to the instructions of the plasmid vector kit. First, the sgRNA expression frame and the recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the primers provided by the kit were used to amplify the PCR product-sgRNA fragment, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-ushA was electrotransformed into UT2 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmids pTarget-ushA and pCas9 were removed in sequence, that is, strain UT3.
[0026] a4) UpH gene knockout According to the umpH gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The plasmid vector kit instructions were followed for construction. First, the sgRNA expression frame and recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the primers provided in the kit were used to amplify the PCR product-sgRNA fragment, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-umpH was electrotransformed into UT3 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmids pTarget-umpH and pCas9 were removed in sequence, that is, strain UT4.
[0027] a5) umpG gene knockout According to the umpG gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The plasmid vector kit instructions were followed for construction. First, the sgRNA expression frame and recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the primers provided in the kit were used to amplify the PCR product-sgRNA fragment, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-umpG was electrotransformed into UT4 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmids pTarget-umpG and pCas9 were removed in sequence, that is, strain UT5.
[0028] a6) yjjG gene knockout According to the yjjG gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The construction was carried out according to the instructions of the plasmid vector kit. First, the sgRNA expression frame and the recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the primers provided by the kit were used to amplify the PCR product-sgRNA fragment, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-yjjG was electrotransformed into UT5 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmid pTarget-yjjG and pCas9 were removed in sequence, that is, the strain UT6.
[0029] b) Integration of the tdk gene at the mbhA locus According to the mbhA gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The construction was carried out according to the instructions of the plasmid vector kit. First, the sgRNA expression frame containing the N20 sequence and the recombinant endogenous tdk sequence were synthesized by gene synthesis. After gene synthesis, the PCR product-sgRNA-tdk fragment was amplified using the primers provided by the kit, and then the sgRNA-tdk fragment was connected to the pTarget plasmid. The pTarget-mbhA-tdk was electrotransformed into UT6 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmid pTarget-mbhA-tdk and pCas9 were removed in sequence, that is, the strain UT7.
[0030] c) Integration of the tmk gene at the yeeP site According to the yeeP gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The plasmid vector kit instructions were followed for construction. First, the sgRNA expression frame containing the N20 sequence and the recombinant endogenous tmk sequence were synthesized by gene synthesis. After gene synthesis, the PCR product-sgRNA-tmk fragment was amplified using the primers provided by the kit. The sgRNA-tmk fragment was then connected to the pTarget plasmid, and the pTarget-yeeP-tmk was electrotransformed into UT7 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmid pTarget-yeeP-tmk and pCas9 were removed in sequence, that is, strain UT8.
[0031] d) Dut gene knockout According to the dut gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The construction was carried out according to the instructions of the plasmid vector kit. First, the sgRNA expression frame and the recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the primers provided by the kit were used to amplify the PCR product-sgRNA fragment, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-dut was electrotransformed into UT8 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmid pTarget-dut and pCas9 were removed in sequence, that is, the strain UT9.
[0032] e) thyA gene knockout According to the thyA gene sequence, the tool CRISPRRGENTools was used to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence. The construction was carried out according to the instructions of the plasmid vector kit. First, the sgRNA expression frame and the recombinant fragment containing the N20 sequence were synthesized by gene synthesis. After gene synthesis, the primers provided by the kit were used to amplify the PCR product-sgRNA fragment, and then the sgRNA fragment was connected to the pTarget plasmid. The pTarget-thyA was electrotransformed into UT9 competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; the positive strain expressing sgRNA was cultured to prepare the electrotransformation competent state, and the pCas9 plasmid was electrotransformed into the competent cells, and a single colony was obtained by recovery culture. The positive recombinant was obtained by PCR colony verification; then the gene editing plasmid pTarget-thyA and pCas9 were removed in sequence, that is, the strain UT10.
[0033] Example 2 Fermentation of deoxyuridine triphosphate (dUTP) using strain UT10: Take the seeds (strain UT10) preserved in the glycerol tube and inoculate them into the seed culture medium, and culture them at 37°C, 200rpm, overnight, for primary seed culture; take the primary seed solution and inoculate it into the seed culture medium, and culture them at 37°C, 200rpm, for 8-10h, for secondary seed expansion culture; take the seed solution and inoculate it into the fermentation medium containing nutrients and the starting substrate deoxyuridine at an inoculation rate of 10-15%, and start fermentation culture. The initial pH of the fermentation is controlled at 7.0±0.2, and the fermentation is carried out for 8-10h. The pH value was then maintained at 6.55±0.1 by adding ammonia water. Feedback control of adding nutrients and starting substrates was started after 12 hours of fermentation. The dissolved oxygen was controlled at 30-40% during the whole process. The start and stop of the feed were controlled according to the dissolved oxygen feedback. The starting substrate was added twice at 12 hours and 24 hours. The temperature of the whole process was controlled at 37°C and the fermentation cycle was 36 hours. Under these conditions, the product yield reached 57.86 g / L and the conversion rate reached 82.4%. After purification by ion exchange chromatography, the purity could reach more than 99%.
[0034] Example 3 Fermentation of deoxyuridine triphosphate (dUTP) using strain UT10: The seeds (strain UT10) stored in the glycerol tube were inoculated into the seed culture medium, and cultured overnight at 37°C, 200rpm for primary seed culture; the primary seed solution was inoculated into the seed culture medium, and cultured for 8-10h at 37°C, 200rpm for secondary seed expansion culture; the seed solution was inoculated into the fermentation medium containing nutrients and the starting substrate deoxyuridine at an inoculum of 10-15%, and the fermentation culture was started. The initial pH of the fermentation was controlled at 7.0±0.2, and after 8-10h of fermentation, the fermentation medium was supplemented with The pH of ammonia water was maintained at 6.55±0.1. Feedback control of adding nutrients and starting substrates was started after 12 hours of fermentation. The dissolved oxygen was controlled at 30-40% during the whole process. The start and stop of feeding were controlled according to the dissolved oxygen feedback. The starting substrate was added in 4 times at 12h, 18h, 24h and 30h respectively. The temperature of the whole process was controlled at 37℃ and the fermentation cycle was 36h. Under these conditions, the product yield reached 62.56g / L and the conversion rate reached 89.1%. After purification by ion exchange chromatography, the purity could reach more than 99%.
[0035] Although the present invention has been disclosed as above in terms of preferred embodiments, they are not intended to limit the present invention. Anyone skilled in the art can make various changes or modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection defined by the claims of this application.
Claims
1. A method for producing deoxyuridine triphosphate by a recombinant strain, characterized in that: The following steps are involved: Step 1: Use CRISPR / Cas9-mediated gene editing to modify the E. coli genome. The modification includes the following: a. Knockout nucleotidase genes (yfbR / yfdR / ushA / umpH / umpG / yjjG) to block the degradation of dUMP to dU; b. Integrate the endogenous uridine kinase gene tdk of E. coli at the pseudogene site mbhA to strengthen the phosphorylation pathway of dU; c. Integrate the endogenous dUMP kinase gene tmk of E. coli at the pseudogene site yeeP to strengthen the phosphorylation pathway of dUMP; d. Knockout the nucleoside triphosphate pyrophosphatase gene (dut) to block the degradation of dUTP to dUMP; e. Knockout the thymidylate synthase gene (thyA) to block the degradation of dUMP to dTMP; Step 2: Using deoxyuridine as the starting substrate, genetically modified Escherichia coli is used to ferment and produce deoxyuridine triphosphate.
2. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 1, characterized in that: The gene sequence of the uridine kinase gene tdk is: 1ATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACAGCATTGTTG 61CAATCTTCATACAATTACCAGGAACGCGGCATGCGCACTGTCGTATATACGGCAGAAATT 121GATGATCGCTTTGGTGCCGGGAAAGTCAGTTCGCGTATAGGTTTGTCATCGCCTGCAAAA 181TTATTTAACCAAAATTCATCATTATTTGATGAGATTCGTGCGGAACATGAACAGCAGGCA 241ATTCATTGCGTACTGGTTGATGAATGCCAGTTTTTAACCAGACAACAAGTATATGAATTA 301TCGGAGGTTGTCGATCAACTCGATATACCCGTACTTTGTTATGGTTTACGTACCGATTTT 361CGAGGTGAATTATTTATTGGCAGCCAATACTTACTGGCATGGTCCGACAAACTGGTTGAA 421TTAAAAACCCATCTGTTTTTGTGGCCGTAAAGCAAGCATGGTGCTGCGTCTTGATCAAGCA 481GGCAGACCTTATAACGAAGGTGAGCAGGTGGTAATTGGTGGTAATGAACGATACGTTTTCT 541GTATGCCGTAAACACTATAAAGAGGCGTTACAAGTCGACTCATTAACGGCTATTCAGGAA 601AGGCATCGCCACGATTAA.
3. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 1, characterized in that: The gene sequence of the dUMP kinase gene tmk is: 1ATGCGCAGTAAGTATATCGTCATTGAGGGGCTGGAAGGCGCAGGCAAAACTACCGCGCGT 61AATGTGGTGGTTGAGACGCTCGAGCAACTGGGTATCCGCGACATGGTTTTCACTCGGGAA 121CCTGGCGGTACGCAACTTGCCGAAAAGTTAAGAAGCCTGGTGCTGGATATCAAATCGGTA 181GGCGATGAAGTCATTACCGATAAAGCCGAAGTTCTGATGTTTTATGCCGCGCGCGTTCAA 241CTGGTAGAAACGGTCATCAAACCAGCTCTGGCTAACGGCACCTGGGTGATTGGCGATCGC 301CACGATCTCTCCACTCAGGCGTATCAGGGCGGCGGACGTGGTATTGACCAACATATGCTG 361GCAACACTGCGTGATGCTGTTCTCGGGGATTTTCGCCCCGACTTAACGCTCTATCTCGAT 421GTTACCCCGGAAGTTGGCTTAAAACGCGCGCGTGCGCGCGGCGAGCTGGATCGTATTGAG 481CAAGAATCTTTCGATTTCTTTAATCGCACCCGCGCCCGCTATCTGGAACTGGCAGCACAA 541GATAAAAGCATTCATACCATTGATGCCACCCAGCCGCTGGAGGCCGTGATGGATGCAATC 601CGCACTACCGTGACCCACTGGGTGAAGGAGTTGGACGCATGA.
4. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 2 or 3, characterized in that: The plasmids used in the CRISPR / Cas9-mediated gene editing method are pTarget and pCas9, respectively, wherein pCas carries the elimination system of pTarget, the Red recombination system of lambda phage and the Cas9 protein expression system, and pTarget contains the sgRNA sequence, the N20 sequence and the donor DNA fragment.
5. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 4, characterized in that: In step 1, the nucleotidase gene (yfbR / yfdR / ushA / umpH / umpG / yjjG), the nucleoside triphosphate pyrophosphatase gene (dut) and the thymidylate synthase gene (thyA) are knocked out by the following steps: S1: According to the corresponding gene sequence to be knocked out, use the tool CRISPRRGENTools to select the target sequence (PAM: 5'-NGG-3') and design the N20 sequence; S2: construct according to the instructions of the plasmid vector kit, and synthesize the sgRNA expression frame and recombinant fragment containing the N20 sequence by gene synthesis; S3: After gene synthesis, use the primers provided by the plasmid vector kit to amplify the PCR product-sgRNA fragment, connect the sgRNA fragment to the pTarget plasmid to obtain the gene editing plasmid pTarget-X, where X is the gene to be knocked out. pTarget-X is electroporated into the competent cells in the previous transformation stage, and single colonies are obtained by recovery culture. Positive recombinants are obtained by PCR colony verification; S4: Cultivate the positive strain expressing sgRNA, prepare electroporation competent cells, electroporate the pCas9 plasmid into electroporation competent cells, resuscitate and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then remove the gene editing plasmids pTarget-X and pCas9 in turn.
6. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 5, characterized in that: The steps for integrating the endogenous uridine kinase gene tdk of E. coli into the pseudogene site mbhA are as follows: S1: Based on the mbhA gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the tool CRISPRRGENTools to design the N20 sequence; S2: According to the instructions of the plasmid vector kit, the sgRNA expression frame containing the N20 sequence and the recombinant endogenous tdk sequence were first synthesized by gene synthesis; S3: After gene synthesis, use the primers provided in the kit to amplify the PCR product-sgRNA-tdk fragment, then connect the sgRNA-tdk fragment to the pTarget plasmid, electroporate pTarget-mbhA-tdk into the competent cells in the previous transformation stage, resuscitate and culture to obtain a single colony, and verify the positive recombinant by PCR colony; S4: Cultivate the positive strain expressing sgRNA, prepare the electroporation competent state, electroporate the pCas9 plasmid into the electroporation competent cells, resuscitate and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then remove the gene editing plasmids pTarget-mbhA-tdk and pCas9 in turn.
7. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 5, characterized in that: The steps for integrating the endogenous dUMP kinase gene tmk of E. coli into the pseudogene site yeeP are as follows: S1: Based on the yeeP gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the tool CRISPRRGENTools to design the N20 sequence; S2: According to the instructions of the plasmid vector kit, the sgRNA expression frame containing the N20 sequence and the recombinant endogenous tmk sequence were first synthesized by gene synthesis; S3: After gene synthesis, use the primers provided in the kit to amplify the PCR product-sgRNA-tmk fragment, then connect the sgRNA-tmk fragment to the pTarget plasmid, electroporate pTarget-yeeP-tmk into the competent cells after the previous transformation stage, resuscitate and culture to obtain a single colony, and verify the positive recombinant by PCR colony; S4: Cultivate the positive strain expressing sgRNA, prepare the electroporation competent state, electroporate the pCas9 plasmid into the electroporation competent cells, resuscitate and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then remove the gene editing plasmids pTarget-yeeP-tmk and pCas9 in turn.
8. The method for producing deoxyuridine triphosphate by a recombinant strain according to claim 6 or 7, characterized in that: The operation method of step 2 is: inoculating the genetically modified Escherichia coli into a seed culture medium, and cultivating it into secondary seeds by using a seed expansion culture method; The seed liquid is inoculated at an inoculation rate of 10-15% into a fermentation medium containing nutrients and a starting substrate, deoxyuridine, and fermentation culture is started; the initial pH of the fermentation is controlled at 7.0±0.2, and after 8-10 hours of fermentation, the pH is maintained at 6.55±0.1 by adding ammonia water. After 12 hours of fermentation, feedback control is started to add nutrients and starting substrates. During the whole process, the dissolved oxygen is controlled at 30-40%, the temperature is controlled at 37°C, and the fermentation cycle is 36 hours.