Method for enhancing energy metabolism of saccharomyces cerevisiae and application thereof

Abstract

The invention discloses a method for enhancing energy metabolism of saccharomyces cerevisiae and application of the method, and the method comprises the following steps: by taking Crab-negative saccharomyces cerevisiae subjected to sucrose phospholysis as host bacteria, inserting endogenous genes NDE1 and NDE2 of the saccharomyces cerevisiae and an exogenous gene TH through a CRISPR / Cas9 means to obtain recombinant saccharomyces cerevisiae 1. A Crab-negative saccharomyces cerevisiae strain subjected to sucrose phospholysis is used as a host strain, the ATP synthesis capacity of a respiratory chain is improved through the oxidation effect of cytoplasm NADH, and the Crab-negative saccharomyces cerevisiae strain is applied to synthesis of products in different ways. The constructed energy synthesis system can continuously provide energy for cytoplasm and maintain the steady state of NADH and NAD + in the cytoplasm.

Description

Technical Field

[0001] The invention belongs to the technical field of metabolic engineering and synthetic biology, and in particular relates to a method for enhancing the energy metabolism of brewer's yeast and an application thereof. Background Art

[0002] With people's concern about environmental friendliness and energy security, the biological production of a large number of chemicals and food substrates is booming. In the process of designing the synthesis of these substrates in microorganisms, the most critical issue is to maximize the utilization of carbon atoms. Especially in the context of global carbon peak and carbon neutrality, how to maximize the output with the lowest raw material input is particularly important. Microbial metabolism is the sum of a large number of chemical reactions, which constitutes the basis of a complex and highly integrated metabolic network. Each reaction in the metabolic network is both independent and closely connected to form a dynamic equilibrium system. Due to the high complexity and interconnectedness of the topological organization of the metabolic network, any change in a single reaction will have a chain effect on the entire network, thereby increasing the difficulty of our precise adjustment and transformation of these networks. Many reactions in cells are directly related to the basic functions of cells, and all of these reactions are carried out while the cells remain viable and metabolically active. Therefore, the more complex the metabolic network or its regulation, the more difficult the task. Redox metabolism in cells is a balanced process, which is synthesized in appropriate stoichiometric ratios and operates in a highly coordinated manner. In addition, different substrates have different degrees of constraints, which will cause some metabolic intermediates or ATP to lose balance and be wasted. The efficiency of free energy conservation in central metabolism has a great influence on the yield of products. Especially for the synthesis of products that require a net input of ATP, the improvement of energy conservation efficiency means that more substrate carbon can be directed to the desired products. In the natural energy system of Saccharomyces cerevisiae, there are five main pathways for the reoxidation of NADH: (1) ethanol fermentation in the cytoplasm; (2) production of glycerol in the cytoplasm; (3) respiration of NADH in the cytoplasm through NADH dehydrogenases NDE1 and NDE2 outside the mitochondria; (4) respiration of NADH in the cytoplasm through the glycerol-3-phosphate shuttle; (5) oxidation of NADH in the mitochondria by NADH dehydrogenase "inside" the mitochondria. In Crabtree-negative bacteria, due to the absence or inoperability of the ethanol pathway, cells process excess NADH in the cytoplasm mainly through mitochondrial NADH dehydrogenases into the respiratory chain. However, due to the limited efficiency of the respiratory chain, NADH in the cytoplasm cannot be quickly used to generate ATP. Especially when the glycolytic flux is large, the generated NADH cannot be quickly oxidized to NAD+, which in turn causes an imbalance of cytoplasmic cofactors and affects cell growth metabolism. To address this challenge, we proposed a synthetic reductive metabolic pathway as a general approach to cellular energy production and the ability of cells to produce reductive bioproducts. This system includes the coupling of the respiratory chain to ATP and the balance of NADH / NAD+ in the cytoplasm, ultimately achieving energy-efficient synthesis without affecting cell growth. When we evaluated the synthetic system with different compounds, it was shown that the energy metabolism and reductive capacity of the recombinant strain were enhanced. Summary of the invention

[0003] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art, provide a method for providing energy metabolism for Saccharomyces cerevisiae and apply the method to the synthesis of various compounds. The present invention starts from the metabolic network of central carbon metabolism while maintaining NADH / NAD +The present invention provides a method for enhancing the energy metabolism of Saccharomyces cerevisiae, the method comprising: using Crabtree-negative Saccharomyces cerevisiae that can phosphorylate sucrose as a host bacterium, inserting the endogenous genes NDE1 and NDE2 of Saccharomyces cerevisiae and the exogenous gene TH by means of CRISPR / Cas9, and obtaining a recombinant yeast 1, wherein the DNA sequence of NDE1 is shown in SEQ ID NO.1, the DNA sequence of NDE2 is shown in SEQ ID NO.2, and the DNA sequence of TH is shown in SEQ ID NO.3. Further, the fragment X2A-TDH3p-NDE1-ADH1t-TEF1p-NDE2-PGK1t-SED1p-TH-TPS1t-X2B is integrated into the X-2 site of the genome by CRISPR / Cas9. The connection between the fragments is performed by homologous recombination. The NDE1 and NDE2 are extramitochondrial NADH dehydrogenases, and TH is a transhydrogenase derived from Azotobacterchroococcum. The above method further uses the recombinant yeast 1 as a host strain, inserts the LmPK gene and the CkPTA gene by means of CRISPR / Cas9, and the DNA sequence of the LmPK gene is shown in SEQ ID NO.4. The DNA sequence of CkPTA is shown in SEQ ID NO.5, and the recombinant yeast 2 is obtained. The phosphoketolase LmPK is derived from Leuconostocmesenteroides; the phosphotransacetylase CkPTA is derived from Clostridium kluyveri. Further, LmPK and CkPTA are expressed using the endogenous promoters TDH3p and TEF1p of Saccharomyces cerevisiae, respectively. The above method, further, uses the recombinant yeast 2 as a host, and knocks out the genes ADH1, ADH3, GPP1 and GPP2 in Saccharomyces cerevisiae through the CRISPR / Cas9 system, the DNA sequence of ADH1 is shown in SEQ ID NO.6; the DNA sequence of ADH3 is shown in SEQ ID NO.7; the DNA sequence of GPP1 is shown in SEQ ID NO.8; the DNA sequence of GPP2 is shown in SEQ ID NO.9. ADH1 and ADH3 are alcohol dehydrogenases; GPP1 and GPP2 are glycerol-3-phosphate phosphatases. Based on a general technical concept, the present invention also provides a method for enhancing the energy metabolism of Saccharomyces cerevisiae to obtain a recombinant yeast in the synthesis of lactic acid, 3-hydroxypropionic acid, p-coumaric acid and farnesene. The above application, further, the method for synthesizing lactic acid comprises the following steps: integrating the lactate dehydrogenase gene LlLDH into the XII-1 site of the recombinant yeast genome through CRISPR / Cas9, the DNA sequence of LlLDH is shown in SEQ ID NO.10.Lactate dehydrogenase L1LDH is derived from Lactococcus lactis. The above application, further, the method for synthesizing 3-hydroxypropionic acid comprises the following steps: dividing the malonyl CoA reductase gene CaMCR into two structural segments MCR-C. N941V K1107W S1115R and MCR-N, the MCR-C N941V K1107W S1115R and MCR-N were integrated into the XII-1 site of the recombinant yeast genome via CRISPR / Cas9. N941V K1107W S1115R The DNA sequence of the MCR-N is shown in SEQ ID NO.11; the DNA sequence of the MCR-N is shown in SEQ ID NO.12. Malonyl CoA reductase CaMCR is derived from Chloroflexus aurantiacus. The above-mentioned application, further, and the method for synthesizing p-coumaric acid include the following steps: integrating the tyrosine ammonia lyase gene FjTAL into the XII-1 site of the recombinant yeast genome through CRISPR / Cas9, and the DNA sequence of the tyrosine ammonia lyase gene FjTAL is shown in SEQ ID NO.13. The tyrosine ammonia lyase FjTAL is derived from Flavobacterium johnsoniae. The above-mentioned application, further, and the method for synthesizing farnesene include the following steps: integrating the farnesene synthase gene MdAFS into the XII-1 site of the recombinant yeast genome through CRISPR / Cas9, and the DNA sequence of the farnesene synthase gene MdAFS is shown in SEQ ID NO.14. The farnesene synthase MdAFS is derived from Malus domestica. The above enzymes are used for the synthesis of corresponding target products, such as p-coumaric acid, 3-hydroxypropionic acid, etc. This part uses the products of different metabolic nodes to verify the advantages of the energy synthesis system in the synthesis of certain products. The products currently verified are mainly the above four.) In the present invention, the genotype of the Crabtree-negative bacteria capable of phosphorylating sucrose as a host cell is (SUC2Δ; IMA1Δ; IMA2Δ; IMA3Δ; IMA4Δ; IMA5Δ; MPH2Δ; MPH3Δ; MAL12Δ; MAL32Δ; MAL11Δ; X-3::(TDH1p-PvSUF-ADH1t)+(PGK1p-LmSP-Ter22)+(SED1p-MAL11-Ter22); PGI1Δ).

[0004] Compared with the prior art, the advantages of the present invention are: the present invention uses a Crabtree-negative saccharomyces cerevisiae strain that can phosphorylate sucrose as a host strain, increases the ability of the respiratory chain to synthesize ATP through the oxidation of cytoplasmic NADH and applies it to the synthesis of products in different pathways. The energy synthesis system constructed by the present invention can continuously provide energy to the cytoplasm and maintain the NADH and NAD in the cytoplasm. + steady state. BRIEF DESCRIPTION OF THE DRAWINGS

[0005] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Figure 1 Schematic diagram of the energy synthesis system and central carbon metabolism regulation principle in an embodiment of the present invention. Figure 2 Figure 1 is the energy synthesis system and the effect of optimization on cell growth in Experiment 1 of the present invention; Figure a is the effect of energy synthesis and the introduction of PK and PTA on cell growth; Figure b is the effect of knocking out genes in the ethanol and glycerol synthesis pathways on cell growth. Figure 3 This is the accumulation of ethanol and glycerol during the optimization of the energy synthesis system in Experiment 2 of the present invention; a in the figure is the accumulation of ethanol during the optimization of the energy synthesis system; b in the figure is the accumulation of glycerol during the optimization of the energy synthesis system. Figure 4 This is the result of applying the energy synthesis system in Experiment 3 of the present invention to the synthesis of lactic acid. Figure 5 This is the result of applying the energy synthesis system in Experiment 4 of the present invention to the synthesis of 3-hydroxypropionic acid. Figure 6 This is the result of applying the energy synthesis system in Experiment 5 of the present invention to the synthesis of p-coumaric acid. Figure 7 This is the synthesis result of farnesene using the energy synthesis system in Experiment 6 of the present invention. DETAILED DESCRIPTION

[0006] The present invention is further described below in conjunction with specific preferred embodiments, but the scope of protection of the present invention is not limited thereby. The materials, reagents, and instruments used in the following embodiments can all be purchased from commercial channels. The experimental methods in the following embodiments, unless otherwise specified, are conventional methods in the art. Terminology: The term "expression" described in the present invention refers to the expression of genes in metabolic pathways, for example: using the promoter TDH3p to express the gene NDE1, indicating that the promoter TDH3p endogenous to Saccharomyces cerevisiae is connected to the gene NDE1 for the initiation of gene transcription. The term "overexpression" described in the present invention refers to the use of a strong promoter or a promoter stronger than its local expression in front of the gene for gene expression. The term "knockout" described in the present invention refers to the method of deleting a gene from the genome by means of CRISPR / Cas9. For example, knocking out the gene ADH1 means completely deleting the gene ADH1 from the genome, thereby achieving the purpose of ADH1 being unable to function. The term "XII-1 site" described in the present invention refers to a specific sequence present in the genome of Saccharomyces cerevisiae, which is commonly used for sites for gene integration on the genome. The symbol "Δ" used in the present invention indicates gene knockout, such as PGIΔ indicates knockout of gene PGI1. The symbol "::" used in the present invention indicates gene insertion, such as A::B indicates that gene B is inserted into gene locus A.

[0007] Example 1: A method for enhancing energy metabolism in Saccharomyces cerevisiae. In Saccharomyces cerevisiae, NDE1 and NDE2 are outer mitochondrial NADH dehydrogenases that participate in the respiratory chain on the outer membrane of mitochondria. Their main function is to oxidize NADH in the cytoplasm to NAD + , while transferring electrons to coenzyme Q of the mitochondrial respiratory chain, thereby participating in the oxidative phosphorylation process. NDE1 and NDE2 play an important role in the energy metabolism and electron transport chain of Saccharomyces cerevisiae, helping to maintain metabolic balance and energy production in cells. The principle is shown in Figure 1 However, overexpression of NDE1 / NDE2 can cause intracellular NADH / NAD + The imbalance of NADH / NAD in the cell will directly cause the cell to die. The transhydrogenase TH can convert NADPH in the cytoplasm into NADH. Therefore, when NADH in the cytoplasm is used for energy synthesis, TH can convert the excess NADPH in the cell into NADH. On this basis, the cell will not only not have NADH / NAD + imbalance, and more NADH can be used for energy synthesis.

[0008] We used the CRISPR / Cas9 system to simultaneously integrate the above three genes into the X-2 site of the Saccharomyces cerevisiae genome.

[0009] (1) The three genes NDE1, NDE2 and TH are simultaneously integrated into the X-2 site of the Saccharomyces cerevisiae genome. The DNA sequence of NDE1 is shown in SEQ ID NO.1. The DNA sequence of NDE2 is shown in SEQ ID NO.2. The DNA sequence of TH is shown in SEQ ID NO.3. The specific steps include: 1.1. Using the Saccharomyces cerevisiae genome as a template (the sequence of the fragment on the Saccharomyces cerevisiae genome can be queried through the Saccharomyces Genome Database (SGD), the website information is: https: / / www.yeastgenome.org / ), and the fragments X2A, TDH3p, ADH1t, TEF1p, PGK1t, SED1p, TPS1t, and X2B were amplified by PCR. Among them, X2A and X2B are the upstream and downstream sequences of the X2 site, respectively, TDH3p, TEF1p, and SED1p are endogenous promoters of Saccharomyces cerevisiae, and ADH1t, PGK1t, and TPS1t are endogenous terminators of Saccharomyces cerevisiae. The primers for amplifying X2A include: X2A-F and X2A-R; X2A-F: tatgtgttagagagagacgagttaagtatg; X2A-R: gtgaccacttcgagagcaagttg. Primers for amplifying TDH3p include: TDH3p-F and TDH3p-R, TDH3p-F: caacttgctctcgaagtggtcactcattatcaatactgccatttcaaagaatacg; TDH3p-R: ctgttttcattaatgattgtctaatcattttgtttgtttatgtgtgtttattcgaaac. Primers for amplifying ADH1t include: ADH1t-F and ADH1t-R; ADH1t-F: gcgaatttcttatgatttatgatttttattattaaataag; ADH1t-R: ccggtagaggtgtggtcaataag. Primers for amplifying TEF1p include: TEF1p-F and TEF1p-R; TEF1p-F: cttattgaccacacctctaccggccacacaccatagcttcaaaatgtttc; TEF1p-R: tttgtaattaaaacttagattagattgctatgctttc. Primers for amplifying PGK1t include: PGK1t-F and PGK1t-R; PGK1t-F: ggaagggattcctccgtgtagattgaattgaattgaaatcgatagatcaatttttttc; PGK1t-R: aacgcagaattttcgagttattaaacttaaaatac. Primers for amplifying SED1p include: SED1p-F and SED1p-R; SED1p-F: gtattttaagtttaataactcgaaaattctgcgttaattatctcccagacggcaccg; SED1p-R: cttaatagagcgaacgtattttattttgcttgtc.The primers for amplifying TPS1t include: TPS1t-F / TPS1t-R; TPS1t-F: cgcttatgatggcttaaaccgtcttttctaatgaacccgatgcaaatgagac; TPS1t-R: ggccgattatgcaggcctagattttgtcttcttcaaattgaagttactttctaaaatgg. The primers for amplifying X2B include: X2B-F and X2B-R. X2B-F: tctaggcctgcataatcggcc; X2B-R: attctcgccaaggcattaccatc. Genes NDE1 and NDE2 are endogenous genes of Saccharomyces cerevisiae. Their amplification also uses the Saccharomyces cerevisiae genome as a template, and uses NDE1-F / NDE1-R; NDE2-F / NDE2-R as primers, respectively, to obtain fragments NDE1 and NDE2 by PCR amplification. NDE1-F: atgattagacaatcattaatgaaaacagtgtgg; NDE1-R: taataataaaaatcataaatcataagaaattcgcctagatagatgaatctctacccaag. NDE2-F: gaaagcatagcaatctaatctaagttttaattacaaaatgctgcccagacttggttttg; NDE2-R: ctacacggaggaatcccttcc. Using pUC57-TH as template and TH-F / TH-R as primers, PCR amplification was performed to obtain the fragment TH. TH-F: caagcaaaataaaatacgttcgctctattaagatggcagtatataactacgacgtgg; TH-R: ttagaaaagacggtttaagccatcataagcg. Gene TH was synthesized by Sequence Synthesis Company. 1.2. Through fusion PCR, the obtained small fragments were connected in the order of X2A-TDH3p-NDE1-ADH1t-TEF1p-NDE2-PGK1t-SED1p-TH-TPS1t-X2B to obtain donor DNA.

[0010] (2) Construct the Cas9-sgRNA plasmid of the X-2 site. The CRISPR / Cas9 system requires the simultaneous work of donor DNA and Cas9 protein for gene editing of Saccharomyces cerevisiae. The specific steps are as follows: 2.1. Using plasmid pRS426-Cas9 as a template, fragments SCAS1, SCAS2, SCAS3 (X-2), and SCAS4 (X-2) were obtained by PCR amplification. The primers for amplifying SCAS1 include SCAS1-F and SCAS1-R; SCAS1-F: ggtgagtactcaaccaagtcattctgag; SCAS1-R: gagtagaaacattttgaagctatgcctgatg. The primers for amplifying SCAS2 include SCAS2-F and SCAS2-R; SCAS2-F: caggcatagcttcaaaatgtttctactcc; SCAS2-R: caatcatctccctatcttcaaacaacgtaagg. The primers for amplifying SCAS3 include SCAS3-F and SCAS3(X-2)-R; SCAS3-F: attgtcctcacccttacgttgtttgaag; SCAS3(X-2)-R: cacgtgaccacttcgagagcgatcatttatctttcactgcggagaag. The primers for amplifying SCAS4 include SCAS4(X-2)-F and SCAS4-R; SCAS4(X-2)-F: gctctcgaagtggtcacgtggttttagagctagaaatagcaagttaaaataaggc; SCAS4-R: cactattctcagaatgacttggttgagtac. 2.2. The amplified fragments were connected into a circle by Gibson, and then transferred into Escherichia coli for amplification, and finally the correct transformants were selected to extract the Cas9 plasmid. Gibson's reaction system is: vector addition amount (ng) = vector bp number × 0.02, fragment addition amount (ng) = fragment bp number × 0.02, add 2μL of buffer, 1μL of cloning enzyme, and make up the remaining system to 10μL with water. Place the reaction system at 37℃ for 30min. After the reaction is completed, store it at 4℃ and take 10μL for E. coli transformation.

[0011] (3) The constructed donor DNA and Cas9 plasmid were transferred into Saccharomyces cerevisiae by the lithium acetate transformation method, and then the defect type was used to determine whether the plasmid was successfully transferred into the cell and functioned. The specific steps of the lithium acetate transformation method are as follows: 3.1. Pick a ring of yeast strains from the glycerol tube and streak it onto the YPD solid plate, and culture it in a 30°C incubator for 3 days until a single colony grows. 3.2. Pick a single yeast colony in 5mL YPD liquid culture medium, and culture it in a 50mL shake flask at 30°C and 220rpm for 17h to obtain yeast seed liquid. 3.3. Pipette 1mL of seed liquid and place it on ice for 5min, centrifuge it at 3500rpm and 4°C for 5min, and remove the supernatant. Wash the bacteria twice with pre-cooled sterile water and centrifuge to remove the supernatant. 3.4. Wash the bacteria with 500μL of pre-cooled 0.1M LiAc and then resuspend it with 50μL of 0.1M LiAc for use. Add 240 μL of 50% PEG 3350 (m / V), 36 μL of 1M LiAc, 25 μL of ssDNA (concentration is 2 mg / mL) and 50 μL of DNA fragments (2 μg of Donor DNA, 1 μg of sgRNA, add in order, and consider adding PEG first to protect cells from the adverse effects of high concentrations of lithium acetate). The DNA sequence of X-2SgRNA is shown in SEQ ID NO.15. 3.5. Vigorously shake until completely mixed, incubate at 30°C for 30 minutes, water bath at 42°C for 25 minutes, centrifuge at 8000 rpm for 2 minutes to remove the supernatant (if the bacteria do not grow well, you can also add 1 mL of YPD and culture for 1 hour). Resuspend the bacteria with 500 μL of sterile water (gentle operation to obtain high conversion rate), and apply 30 μL to 60 μL on the YNB plate supplemented with the corresponding defect type for screening, and culture at 30°C for 3 to 5 days.

[0012] (4) Take 30 μL to 60 μL of the bacteria and spread them on a YNB plate lacking uracil, and culture at 30°C for 3 to 5 days until a single colony grows. The correct single colony is verified by colony PCR and cultured in YPD medium. After 24 hours of culture, the bacterial liquid is streaked on a YPD plate containing 5-fluorolactic acid, and the single colony that grows is the strain that has discarded the Cas9 plasmid. YPD medium includes 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose or 40 g / L sucrose. YNB medium includes 1.7 g / L YNB (without ammonium sulfate and amino acids), 5 g / L ammonium sulfate, 20 g / L glucose or 40 g / L sucrose. If necessary, add the corresponding amino acids for screening (tryptophan, histidine, leucine and uracil).

[0013] Example 2: Based on the construction of the energy synthesis system in Example 1, PK and PTA are introduced and integrated into the XI-3 site of the Saccharomyces cerevisiae genome. The PK gene is the phosphoketolase LmPK from Leuconostoc mesenteroides and the PTA gene is the phosphotransacetylase CkPTA gene from Clostridium kluyveri. The DNA sequence of LmPK is shown in SEQ ID NO.4. The DNA sequence of CkPTA is shown in SEQ ID NO.5. The pentose phosphate pathway is used to produce acetyl CoA to supply cell growth, thereby reducing the pressure of the energy synthesis system to supply cell growth, thereby reducing the accumulation of ethanol and glycerol, and optimizing the energy synthesis system. Specifically comprising the following steps:

[0014] (1) Integrate LmPK and CkPTA into the XI-3 site of the Saccharomyces cerevisiae genome. 1.1. Using the Saccharomyces cerevisiae genome as a template, XI3A, TDH3p, ADH1t, TEF1p, PGK1t, and XI3B were amplified by PCR. Among them, XI3A and XI3B are the upstream and downstream sequences of the XI3 site, TDH1p and TEF1p are endogenous promoters of Saccharomyces cerevisiae, and ADH1t and PGK1t are endogenous terminators of Saccharomyces cerevisiae. The genes LmPK and CkPTA were synthesized by a sequence synthesis company. The primers for amplifying XI3A include: XI3A-F and XI3A-R; XI3A-F: ttttttgcttttcccgttatgagaaatgttttttttag; XI3A-R: gggctgatcattttccttacgtgg. Primers for amplifying TDH3p include: TDH3p-F and TDH3p-R; TDH3p-F: ccacgtaaggaaaatgatcagccctcattatcaatactgccatttcaaagaatacg; TDH3p-R: tttgtttgtttatgtgtgtttattcgaaactaag. Primers for amplifying ADH1t include: ADH1t-F and ADH1t-R; ADH1t-F: gcgaatttcttatgatttatgatttttattattaaataag; ADH1t-R: cattttgaagctatggtgtgtggccggtagaggtgtggtcaataag. Primers for amplifying TEF1p include: TEF1p-F and TEF1p-R; TEF1p-F: ccacacaccatagcttcaaaatg; TEF1p-R: tttgtaattaaaacttagattagattgctatgctttc. Primers for amplifying PGK1t include: PGK1t-F and PGK1t-R; PGK1t-F: caagctcaagctcaaggttaaattgaattgaattgaaatcgatagatcaattttttc; PGK1t-R: cggtaacaaaacctcttctaagaaaagaaaacgcagaattttcgagttattaaac. Primers for amplifying XI3B include: XI3B-F and XI3B-R; XI3B-F: ttcttttcttagaagaggttttgttaccg; XI3B-R: atttctgttattactgttattagtttggcgttttgc.1.2. Through fusion PCR, the obtained small fragments were connected in the order of XI3A-TDH3p-LmPK-ADH1t-TEF1p-CkPTA-PGK1t-XI3B to obtain donor DNA.

[0015] (2) Construction of Cas9-sgRNA plasmid for XI-3 locus. The CRISPR / Cas9 system requires the simultaneous work of donor DNA and Cas9 protein for gene editing of Saccharomyces cerevisiae. The specific steps are as follows: 2.1. Using plasmid pRS426-Cas9 as a template, fragments SCAS1, SCAS2, SCAS3 (XI-3), and SCAS4 (XI-3) were obtained by PCR amplification. Among them, the primers for amplifying SCAS1 include SCAS1-F and SCAS1-R; SCAS1-F: ggtgagtactcaaccaagtcattctgag; SCAS1-R: gagtagaaacattttgaagctatgcctgatg. The primers for amplifying SCAS2 include SCAS2-F and SCAS2-R; SCAS2-F: caggcatagcttcaaaatgtttctactcc; SCAS2-R: caatcatctccctatcttcaaacaacgtaagg. Primers for amplifying SCAS3 include SCAS3-F and SCAS3(XI-3)-R; SCAS3-F: attgtcctcacccttacgttgtttgaag; SCAS3(XI-3)-R: cgatttcttttctgttccacgatcatttatctttcactgcggagaag. Primers for amplifying SCAS4 include SCAS4(XI-3)-F and SCAS4-R; SCAS4(XI-3)-F: gtggaacagaaaagaaatcggttttagagctagaaatagcaagttaaaataaggc; SCAS4-R: cactattctcagaatgacttggttgagtac. 2.2. The amplified fragments were connected into a circle by Gibson, and then transferred into Escherichia coli for amplification, and finally the correct transformants were selected to extract the Cas9 plasmid. The DNA sequence of XI-3SgRNA is shown in SEQ ID NO.16.

[0016] (3) The Donor DNA and Cas9-sgRNA plasmids were simultaneously transferred into Saccharomyces cerevisiae, and the fragment XI3A-TDH3p-LmPK-ADH1t-TEF1p-CkPTA-PGK1t-XI3B was integrated into the genome.

[0017] Example 3: Based on Example 2, the ethanol and glycerol synthesis pathways were knocked out. The ethanol and glycerol pathways will divert the consumption of NADH. In order to cut off this phenomenon, the genes ADH1, ADH3, GPP1 and GPP2 in Saccharomyces cerevisiae were knocked out by the CRISPR / Cas9 system. The DNA sequence of ADH1 is shown in SEQ ID NO.6. The DNA sequence of ADH3 is shown in SEQ ID NO.7. The DNA sequence of GPP1 is shown in SEQ ID NO.8. The DNA sequence of GPP2 is shown in SEQ ID NO.9.

[0018] Specifically, the method includes the following steps: (1) using the Saccharomyces cerevisiae genome as a template, using ADH1A-F / ADH1A-R as primers, PCR amplification to obtain the ADH1A fragment, and using ADH1B-F and ADH1B-R as primers, PCR amplification to obtain the ADH1B fragment. ADH1A-F: actgtagccctagacttgatagcc; ADH1A-R: tgtatatgagatagttgattgtatgcttggtatag. ADH1B-F: ccaagcatacaatcaactatctcatatacagcgaatttcttatgatttatgatttttat; ADH1B-R: cgtaaaaaaagcatgcacgtatacacttg. (2) amplifying 500 bp of the upstream and downstream sequences of the gene to be knocked out on the genome by PCR, and then connecting the two sequences in the order of ADH1A-ADH1B by fusion PCR. The connected fragment is the donor DNA. (3) Construct Cas9-sgRNA plasmid, wherein the primers used are: SCAS3(ADH1)-R: ccgttttggtcggtatgccagatcatttatctttcactgcggagaag; SCAS4(ADH1)-F: tggcataccgaccaaaacgggttttagagctagaaatagcaagttaaaataaggc. (The plasmid construction process is the same as 2.1 in Example 2). (4) The Donor DNA and Cas9-sgRNA plasmid are simultaneously transferred into Saccharomyces cerevisiae, and the fragment ADH1A-ADH1B is integrated into the genome. (5) On the basis of knocking out ADH1, steps (1)-(4) are repeated again to gradually knock out ADH3, GPP1 and GPP2. (6) The primers used for knocking out ADH3 were: ADH3A-F: tcttatcattccacgcacattattttcctac; ADH3A-R: gatggtgttaacttatgactatactattcctagttttaac. ADH3B-F: ctaggaatagtatagtcataagttaacaccatctagcgtgttacgcacccaaac; ADH3B-R: atgaggaagaaatccaaatcctaatgacc.SCAS3(ADH3)-R: acgttaaatcagaggtattcgatcatttatctttcactgcggagaag; SCAS4(ADH3)-F: gaatacctctgatttaacgtgttttagagctagaaatagcaagttaaaataaggc.

[0019] The primers used to knock out GPP1 are: GPP1A-F: ggaaatccgtatcattttctcgcatac; GPP1A-R: tgcgatggtttgtatatttgcttttgttgttc. GPP1B-F: caaaagcaaatatacaaaccatcgcattttcttttatttttttgataaaactactacgc; GPP1B-R: ttacggtggttccagatgtgc. SCAS3(GPP1)-R: ctctattcgatgttgacggtgatcatttatctttcactgcggagaag; SCAS4(GPP1)-F: accgtcaacatcgaatagaggttttagagctagaaatagcaagttaaaataaggc.

[0020] The primers used to knock out GPP2 are: GPP2A-F: tctcaagtattttggcacctcgcc; GPP2A-R: tccgaatattgtttttattgttttatgtttttccac. GPP2B-F: taaaacaataaaaacaatattcggatcctctaaaatcgaacatatttgagtaataattc; GPP2B-R: ttctctggaatcttccccactgttatc. SCAS3(GPP2)-R: aggtgcagttaagctgtgcagatcatttatctttcactgcggagaag; SCAS4(GPP2)-F: tgcacagcttaactgcacctgttttagagctagaaatagcaagttaaaataaggc.

[0021] Experiment 1: Verify cell growth to determine whether the energy synthesis system has an impact on cell metabolism.

[0022] ZQS40: A strain without the introduction of the energy synthesis system. ZQS49: A strain into which the three genes NDE1, NDE2 and TH were introduced in Example 1. ZQS50: A strain into which PK and PTA were introduced in Example 2 on the basis of Example 1. ZQS51: A strain into which the ADH1 gene was removed based on the strain in Example 2. ZQS52: A strain into which the GPP1 gene was removed based on the strain in Example 2. ZQS53: A strain into which the ADH1 and ADH3 genes were removed based on the strain in Example 2. ZQS54: A strain into which the ADH1 and GPP1 genes were removed based on the strain in Example 2. ZQS55: A strain into which the ADH1, ADH3 and GPP1 genes were removed based on the strain in Example 2. ZQS56: A strain into which the ADH1, ADH3, GPP1 and GPP2 genes were removed based on the strain in Example 2. The growth curves of the above strains were plotted, and the NADH / NAD in the cytoplasm was determined by detecting the ethanol and glycerol. + balance. Figure 2 The results of the energy synthesis system and its optimization on cell growth. Figure a shows the effect of the energy synthesis system and the introduction of PK and PTA on cell growth. Figure b shows the effect of the gene knockout process of the ethanol and glycerol pathways on cell growth. From figure a, it can be seen that the introduction of the energy synthesis system and PK and PTA has no negative impact on the growth of the strain, proving that this system does not destroy the growth metabolism inside the cell; from figure b, it can be seen that with the gradual knockout of genes in the ethanol or glycerol synthesis pathway, the growth of the strain has not been negatively affected, indicating that the energy synthesis system can replace the ethanol / glycerol pathway to regulate NADH / NAD in the cytoplasm. + balance.

[0023] Experiment 2: Detect the accumulation of ethanol and glycerol by the strain.

[0024] ZQS50: In Example 2, PK and PTA were introduced into the strain on the basis of Example 1. ZQS51: Based on the strain of Example 2, the ADH1 gene was excised from the strain. ZQS52: Based on the strain of Example 2, the GPP1 gene was excised from the strain. ZQS53: Based on the strain of Example 2, the ADH1 and ADH3 genes were excised from the strain. ZQS54: Based on the strain of Example 2, the ADH1 and GPP1 genes were excised from the strain. ZQS55: Based on the strain of Example 2, the ADH1, ADH3 and GPP1 genes were excised from the strain. ZQS56: Based on the strain of Example 2, the ADH1, ADH3, GPP1 and GPP2 genes were excised from the strain. The strain was transferred to a 250ml conical flask containing 25ml and fermented at 30°C and 220rpm for 3 days. Intermediate sampling was performed to detect the ethanol and glycerol content in the fermentation broth by HPLC. The concentrations of ethanol and glycerol were detected by high performance liquid chromatography HPLC (Shimadzu LC-20A) using a HPX-87H (Bio-Rad) column and a RID-10A differential detector. 1 mL of the fermentation broth was filtered into a liquid phase vial using a 0.22 μm pore size water filter membrane as the test sample. The mobile phase was 5 mM H2SO4, the flow rate was 0.6 mL / min, and the column temperature was set at 45°C. Figure 3 Figure 1 is the accumulation of ethanol and glycerol during the optimization of the energy synthesis system. Figure a is the accumulation result of ethanol during the optimization of the energy synthesis system. Figure b is the accumulation result of glycerol during the optimization of the energy synthesis system. It can be seen from the figure that the content of ethanol and glycerol can reflect the balance state of the cell from the side. When the cell cannot use the energy metabolism system to oxidize excessive NADH in the cytoplasm, the cell will use the ethanol / glycerol synthesis pathway to regulate the content of NADH. With the gradual knockout of the ethanol and glycerol pathway genes, the strain will self-regulate the accumulation of ethanol and glycerol. For example, the knockout of the ethanol pathway genes ADH1 and ADH3 will aggravate the accumulation of glycerol, while the knockout of the glycerol synthesis pathway GPP1 will aggravate the accumulation of ethanol. When the ethanol and glycerol pathways are completely removed, the strain containing the energy synthesis system can keep ethanol and glycerol at extremely low levels, proving that most of the NADH has entered the energy synthesis system.

[0025] Example 4: The synthetic strain of Example 3 is used for lactic acid synthesis. It is necessary to introduce a lactic acid synthesis pathway into Saccharomyces cerevisiae. Lactate dehydrogenase LlLDH from Lactococcus lactis can convert pyruvate into lactic acid. The fragment XIII1A-TEF1p-LlLDH-CYC1t-XIII1B is integrated into the XII-1 site of the genome through CRISPR / Cas9 to obtain a lactic acid synthesis strain. Among them, the DNA sequence of LlLDH is shown in SEQ ID NO.10. Specifically comprising the following steps:

[0026] (1) XII1A, TEF1p, LlLDH, CYC1t, and XII1B were integrated into the XII-1 site of the genome through CRISPR / Cas9, specifically including the following steps: 1.1. Using the Saccharomyces cerevisiae genome as a template, fragments XII1A, TEF1p, CYC1t, and XII1B were obtained by PCR amplification. The primers for amplifying XII1A included XII1A-F and XII1A-R; XII1A-F: gttgagctctgtccttcatggac; XII1A-R: gaaagaaccgaaccgatgccaaaatc. Primers for amplifying TEF1p include TEF1p-F and TEF1p-R; TEF1p-F: gattttggcatcggttcggttctttcccacacaccatagcttcaaaatgtttctac; TEF1p-R: tttgtaattaaaacttagattagattgctatgctttctttctaatg. Primers for amplifying CYC1t include CYC1t-F and CYC1t-R; CYC1t-F: acaggccccttttcctttgtc; CYC1t-R: gcaaattaaagccttcgagcg. The primers for amplifying XII1B include XII1B-F and XII1B-R; XII1B-F: cgctcgaaggctttaatttgcgttcagtttagtgctctgtctgagtg; XII1B-R: tgatgactgtttctcaatctttatgttatcttc. The primers for amplifying LlLDH include LlLDH-F and LlLDH-R; LlLDH-F: gcatagcaatctaatctaagttttaattacaaaatggctgataaacaaagaaagaagg; LlLDH-R: gacaaaggaaaaggggcctgtttaatttttaacagcagaagcaaattcttctttagc. 1.2. The above fragments were connected into Donor fragments in the order of XII1A-TEF1p-LlLDH-CYC1t-XII1B by fusion PCR.

[0027] (2) Constructing the Cas9-sgRNA plasmid of the XII-1 site, specifically comprising the following steps:

[0028] Using plasmid pRS426-Cas9 as template, SCAS1-F and SCAS1-R as primers, PCR amplification was used to obtain fragment SCAS1; SCAS2-F / SCAS2-R as primers, PCR amplification was used to obtain fragment SCAS2; SCAS3-F and SCAS3(XII-1)-R as primers, PCR amplification was used to obtain fragment SCAS3(XII-1), and SCAS4(XII-1)-F and SCAS4-R as primers, PCR amplification was used to obtain fragment SCAS4(XII-1). The primer sequences used for amplification are: SCAS1-F: ggtgagtactcaaccaagtcattctgag; SCAS1-R: gagtagaaacattttgaagctatgcctgatg. SCAS2-F: caggcatagcttcaaaatgtttctactcc; SCAS2-R: caatcatctccctatcttcaaacaacgtaagg. SCAS3-F: attgtcctcacccttacgttgtttgaag; SCAS3(XII-1)-R: gtgaatcaactgcacataccgatcatttatctttcactgcggagaag. SCAS4(XII-1)-F: ggtatgtgcagttgattcacgttttagagctagaaatagcaagttaaaataaggc; SCAS4-R: cactattctcagaatgacttggttgagtac.

[0029] (3) The Donor DNA and Cas9-sgRNA plasmids were simultaneously transferred into Saccharomyces cerevisiae, and the fragment XII1A-TEF1p-LlLDH-CYC1t-XII1B was integrated into the genome. The DNA sequence of XII1 SgRNA is shown in SEQ ID NO.

[0030] Example 5: Based on Example 3, a 3-hydroxypropionic acid synthesis pathway is introduced. The malonyl-CoA reductase CaMCR from Chloroflexus aurantiacus can convert malonyl-CoA into 3-hydroxypropionic acid. The present invention divides CaMCR into two structural segments: MCR-C N941V K1107W S1115R and MCR-N, of which MCR-C N941V K1107W S1115R Catalyzes the conversion of malonyl CoA to Maloney semialdehyde (MSA), which MCR-N further catalyzes to 3-hydroxypropionic acid.N941V K1107W S1115R -CYC1t-XII1B was integrated into the XII-1 site of the genome through CRISPR / Cas9 to obtain a 3-hydroxypropionic acid-producing strain. N941V K1107W S1115R The DNA sequence of MCR-N is shown in SEQ ID NO.11. The DNA sequence of MCR-N is shown in SEQ ID NO.12. The synthesis method is consistent with Example 4, wherein the primers for amplifying MCR-N include MCRN-F and MCRN-R: MCRN-F: gtaattatctactttttacaacaaatataaaacaatgagtggtactggtagattggc; MCRN-R: ttatatattagctggtatatttaaagtaatttcgtttatatgc. N941V K1107W S1115R The primers include MCRC-F and MCRC-R: MCRC-F: atgagtgccactacaggtgc; MCRC-R: ttaaactgtaatagctctacctctatggattctac.

[0031] Example 6: The synthetic strain of Example 3 was used for the synthesis of p-coumaric acid, and the tyrosine ammonia lyase FjTAL from Flavobacterium johnsoniae was able to convert tyrosine into p-coumaric acid. The fragment XII1A-GAL7p-FjTAL-DIT1t-XII1B was integrated into the XII-1 site of the genome by CRISPR / Cas9 to obtain a synthetic strain of p-coumaric acid. The DNA sequence of FjTAL is shown in SEQ ID NO.13. Its synthesis method is consistent with that of Example 4, wherein the primers for amplifying FjTAL include TAL-F and TAL-R: TAL-F: aaaaaaacagttgaatattccctcaaaaatgaacaccattaatgaatacttgagtttag; TAL-R: gaccaatgtagcgctcttactttatttaattgttaatcaaatgatccttaaccttttg.

[0032] Example 7: The synthetic strain of Example 3 is used for the synthesis of farnesene. The farnesene synthase MdAFS from Malus domestica can convert the endogenous MVA pathway of yeast into farnesene. The fragment XIII1A-TEF1p-MdAFS-CYC1t-XII1B is integrated into the XII-1 site of the genome by CRISPR / Cas9 to obtain a farnesene synthetic strain. The DNA sequence of MdAFS is shown in SEQ ID NO.14. Its synthesis method is consistent with that of Example 4, wherein the primers for amplifying MdAFS include AFS-F and AFS-R: AFS-F: gcatagcaatctaatctaagttttaattacaaaatggaatttagagttcacttgcaagc; AFS-R: gacaaaggaaaaggggcctgtttaattaaccaatggttgaaacaacaaagac. The optimized strains were applied to the synthesis of lactic acid, 3-hydroxypropionic acid, p-coumaric acid and farnesene, respectively. The starting strain for the synthesis of each product was the strain with optimized energy synthesis system, and the glucose metabolism strain was used as the control strain.

[0033] Experiment 3: Investigate the synthesis effect of lactic acid.

[0034] ZQS57: No treatment was done on the Saccharomyces cerevisiae genome; ZQS58: A strain in which the three genes NDE1, NDE2 and TH were integrated into the Saccharomyces cerevisiae genome; ZQS59: Five genes NDE1, NDE2, TH, PK and PTA were introduced into the Saccharomyces cerevisiae genome, and four genes ADH1, ADH3, GPP1 and GPP2 were knocked out. The detection method for lactic acid was high performance liquid chromatography, using an HPX-87H (Bio-Rad) column and a UV detector at 210 nm. Take 1 mL of fermentation broth and filter it into a liquid phase vial with a 0.22 μm pore size water filter membrane as the test sample. The mobile phase was 5 mM H2SO4, the flow rate was 0.6 mL / min, and the column temperature was set to 50°C. For test results, see Figure 4 :The strains ZQS58 and ZQS59 containing the energy synthesis system have higher lactate production than the control strain, proving that the energy synthesis system can provide sufficient precursors for lactate synthesis, such as pyruvate, NADH, etc. However, the lactate synthesis capacity of the strain ZQS59 with optimized energy synthesis system is lower than that of the unoptimized strain ZQS58, indicating that the optimized strain causes more flux to downstream respiration.

[0035] Experiment 4: Investigate the synthesis effect of 3-hydroxypropionic acid.

[0036] ZQS60: No treatment was done on the Saccharomyces cerevisiae genome; ZQS61: A strain in which the three genes NDE1, NDE2 and TH were integrated into the Saccharomyces cerevisiae genome; ZQS62: Five genes NDE1, NDE2, TH, PK and PTA were introduced into the Saccharomyces cerevisiae genome, and four genes ADH1, ADH3, GPP1 and GPP2 were knocked out. The detection method for 3-hydroxypropionic acid was high performance liquid chromatography, using an HPX-87H (Bio-Rad) column and a UV detector at 210 nm. Take 1 mL of fermentation broth and filter it into a liquid phase vial with a 0.22 μm pore size water filter membrane as the test sample. The mobile phase was 0.5 mM H2SO4, the flow rate was 0.4 mL / min, and the column temperature was set to 65°C. For test results, see Figure 5 :The strains ZQS61 and ZQS62 containing the energy synthesis system have higher 3-hydroxypropionic acid production than the control strain, proving that the energy synthesis system has a higher ability to synthesize acetyl CoA, providing precursors for the synthesis of 3-hydroxypropionic acid. The optimized strain ZQS62 can further increase the supply of acetyl CoA, which also confirms the results we observed in lactate synthesis. The optimized strain has more efficient respiratory flux and energy supply flux.

[0037] Experiment 5: Investigate the synthesis effect of p-coumaric acid.

[0038] ZQS63: No treatment was done on the Saccharomyces cerevisiae genome; ZQS64: A strain in which the three genes NDE1, NDE2 and TH were integrated into the Saccharomyces cerevisiae genome; ZQS65: Five genes NDE1, NDE2, TH, PK and PTA were introduced into the Saccharomyces cerevisiae genome, and four genes ADH1, ADH3, GPP1 and GPP2 were knocked out. The detection method for p-coumaric acid is high performance liquid chromatography, using a C18250mm×4.6mm column and a UV detector at 308nm. Take 500μL of fermentation broth, add 500μL of methanol for shaking extraction, and filter it into a liquid phase vial with a 0.22μm pore size organic filter membrane as the test sample. The mobile phase is water and acetonitrile, the flow rate is 1mL / min, and the column temperature is set to 30℃. For test results, see Figure 6 : Compared with the control strain, the strains ZQS64 and ZQS65 containing the energy synthesis system had higher p-coumaric acid production, which proved that the optimized energy synthesis system had an efficient flux of the shikimic acid pathway and the strain had the potential to synthesize a variety of aromatic amino acids and p-coumaric acid derivatives.

[0039] Experiment 6: Investigate the synthesis effect of farnesene.

[0040] ZQS66: No treatment was done on the Saccharomyces cerevisiae genome; ZQS67: A strain in which the three genes NDE1, NDE2 and TH were integrated into the Saccharomyces cerevisiae genome; ZQS68: Five genes NDE1, NDE2, TH, PK and PTA were introduced into the Saccharomyces cerevisiae genome, and four genes ADH1, ADH3, GPP1 and GPP2 were knocked out. The detection method of farnesene is high performance liquid chromatography, using a C18250mm×4.6mm column and a UV detector at 232nm. At the 12th hour of farnesene fermentation, 10% dodecane was added to the fermentation broth for farnesene extraction. At the end of fermentation, 50μL of the upper layer of dodecane was taken and diluted 20 times, and filtered into a liquid phase vial with a 0.22μm pore size organic filter membrane as the test sample. The mobile phase was methanol and acetonitrile, the flow rate was 0.8mL / min, and the column temperature was set to 40°C. For test results, see Figure 7 The strains ZQS67 and ZQS68 containing the energy synthesis system had higher farnesene production than the control strains, which proved that the optimized energy synthesis system had an efficient flux of the MVA pathway and the strain had the potential to synthesize a variety of terpene compounds.

Claims

1. A method for enhancing energy metabolism of Saccharomyces cerevisiae, characterized in that: The method comprises: using Crabtree-negative saccharomyces cerevisiae capable of phosphorylating sucrose as a host bacterium, inserting endogenous genes NDE1 and NDE2 of the saccharomyces cerevisiae and an exogenous gene TH by means of CRISPR / Cas9, and obtaining a recombinant yeast 1, wherein the DNA sequence of the NDE1 is shown in SEQ ID NO.1, the DNA sequence of the NDE2 is shown in SEQ ID NO.2, and the DNA sequence of the TH is shown in SEQ ID NO.

3.

2. The method according to claim 1, characterized in that: Using recombinant yeast 1 as a host strain, LmPK gene and CkPTA gene were inserted by CRISPR / Cas9 to obtain recombinant yeast 2, the DNA sequence of the LmPK gene is shown in SEQ ID NO.4, and the DNA sequence of CkPTA is shown in SEQ ID NO.

5.

3. The method according to claim 2, characterized in that The recombinant yeast 2 was used as a host bacterium, and the genes ADH1, ADH3, GPP1 and GPP2 in Saccharomyces cerevisiae were knocked out by the CRISPR / Cas9 system to obtain recombinant bacteria 3, wherein the DNA sequence of ADH1 is shown in SEQ ID NO.6; the DNA sequence of ADH3 is shown in SEQ ID NO.7; the DNA sequence of GPP1 is shown in SEQ ID NO.8; and the DNA sequence of GPP2 is shown in SEQ ID NO.

9.

4. Use of the recombinant yeast synthesized by the method according to any one of claims 1 to 3 in synthesizing compounds.

5. The use according to claim 4, characterized in that: The compound is lactic acid, and the method for synthesizing lactic acid comprises the following steps: integrating the lactate dehydrogenase gene LlLDH into the XII-1 site of the recombinant yeast genome through CRISPR / Cas9, and the DNA sequence of the LlLDH is shown in SEQ ID NO.

10.

6. The use according to claim 4, characterized in that: The compound is 3-hydroxypropionic acid. The method for synthesizing 3-hydroxypropionic acid comprises the following steps: dividing the malonyl CoA reductase gene CaMCR into two structural segments MCR-C N941VK1107WS1115R and MCR-N, the MCR-C N941VK1107WS1115R and MCR-N were integrated into the XII-1 site of the recombinant yeast genome via CRISPR / Cas9. N941VK1107WS1115R The DNA sequence of is shown as SEQ ID NO.11; the DNA sequence of MCR-N is shown as SEQ ID NO.

12.

7. The use according to claim 4, characterized in that: The compound is p-coumaric acid, and the method for synthesizing p-coumaric acid comprises the following steps: integrating the tyrosine ammonia lyase gene FjTAL into the XII-1 site of the recombinant yeast genome through CRISPR / Cas9, and the DNA sequence of the tyrosine ammonia lyase gene FjTAL is shown in SEQ ID NO.

13.

8. The use according to claim 4, characterized in that: The compound is farnesene, and the method for synthesizing farnesene comprises the following steps: integrating the farnesene synthase gene MdAFS into the XII-1 site of the recombinant yeast genome through CRISPR / Cas9, and the DNA sequence of the farnesene synthase gene MdAFS is shown in SEQ ID NO.14.

Images