Application of a rice chalkiness negative regulatory gene CGR3
By knocking out the amino acid sequence of the negative regulatory gene of CGR3 of the rice chalice, constructing a gene knockout vector and transforming the receptor material, the problem of difficult-to-solve the formation mechanism of rice chalice was solved and a significant improvement in rice quality was achieved.
Patent Information
- Application Number
- CN202411305024.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2044-09-19
AI Technical Summary
The existing technology is difficult to effectively analyze the molecular mechanism of rice chalky formation, resulting in low efficiency in improving rice quality and unable to meet the needs of high-quality rice.
By knocking out, substituting or changing the amino acid sequence of the rice chalky negative regulatory gene CGR3, the CGR3 knockout vector was constructed and transformed into the receptor material to obtain a homozygous knockout mutant with high chalky particle rate.
It significantly improves the chalky rate of rice, improves the appearance and processing quality of rice, and meets the needs of high-quality rice.
Smart Images

Figure CN119391749B_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to the field of biotechnology, and in particular to an application of a rice chalkiness negative regulatory gene CGR3. Background Art
[0002] Rice, one of the world's three major staple crops, is the primary source of food for 4 billion people worldwide. Advances in dwarfing and hybrid rice breeding have significantly increased rice yields. However, these increases still cannot meet the needs of a rapidly growing population. Furthermore, economic development and rising living standards have shifted consumer preferences, leading to an increasing demand for high-quality rice. Therefore, while ensuring both increased and stable yields, improving rice quality has become a key focus in rice breeding.
[0003] Rice chalkiness is a white, opaque trait formed by loosely packed starch and protein bodies in the endosperm. As an undesirable trait, chalkiness negatively impacts rice appearance, processing, and flavor. Because chalkiness is complex and its mechanisms are not fully understood, improvements to this trait are inefficient and remain a key challenge in high-quality rice breeding.
[0004] Although some genes associated with chalkiness have been identified, only a very small number have been precisely mapped and cloned. This severely limits research on the mechanisms of chalkiness formation. Without understanding the molecular mechanisms of chalkiness formation, it is difficult to effectively improve rice quality. Therefore, discovering new genes associated with chalkiness and constructing mutants of these genes are of great significance for studying the mechanisms of chalkiness formation and improving rice quality.
[0005] Public content
[0006] To solve the problems of the prior art, the present disclosure provides an application of the rice chalkiness negative regulatory gene CGR3. The technical solution is as follows:
[0007] The present disclosure provides an application of a rice chalkiness negative regulatory gene CGR3, which includes: using the rice chalkiness negative regulatory gene CGR3 to promote the formation of rice chalkiness.
[0008] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the rice chalkiness negative regulatory gene CGR3 protein to increase the chalkiness rate of rice.
[0009] Specifically, the application includes: selecting CGR3-T as a target for gene knockout in the sequence of the rice chalkiness negative regulatory gene CGR3, wherein the sequence of CGR3-T is shown in SEQ ID NO: 1 in the sequence listing;
[0010] A CGR3 gene knockout vector was constructed based on the CGR3-T using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing;
[0011] The CGR3 gene knockout vector is transformed into a recipient material to obtain a homozygous knockout mutant with a high chalky grain rate.
[0012] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, using the first forward primer and the first reverse primer to amplify the promoter U6a by a first PCR to obtain a first amplification product containing the U6b promoter of the CGR3-T, and using the second forward primer and the second reverse primer to amplify the guide fragment sgRNA by a second PCR to obtain a second amplification product containing the guide sgRNA fragment of the CGR3-T;
[0013] Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and second amplification product;
[0014] connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product;
[0015] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the CGR3 gene knockout vector.
[0016] Furthermore, per 50 μL of the first PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.
[0017] Furthermore, per 50 μL of the second PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 31.75 μL of ddH2O.
[0018] Furthermore, each 15 μL of the ligation reaction system includes: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.
[0019] The beneficial effects brought about by the technical solution provided by the embodiment of the present disclosure are: the embodiment of the present invention provides an application of the rice chalkiness negative regulatory gene CGR3, and the rice chalkiness negative regulatory gene CGR3 is used to increase the formation of rice chalkiness, that is, to increase the chalkiness rate of rice, and the effect is significant. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.
[0021] Figure 1a This is a photograph of the seeds of the control group Nip provided in the embodiments of the present disclosure after being ground into polished rice;
[0022] Figure 1b This is a photograph of the seeds of the CGR3-KO-5 group after being ground into polished rice provided in the embodiments of the present disclosure;
[0023] Figure 1c This is a photograph of the seeds of the CGR3-KO-6 group after being ground into polished rice provided in the embodiments of the present disclosure;
[0024] Figure 2 This is a statistical graph showing the proportion of chalky seeds to the total number of seeds in the control group Nip, the CGR3-KO-5 group, and the CGR3-KO-6 group provided in the examples of the present disclosure;
[0025] Figure 3aThis is the internal structure of the seeds of the control group Nip provided in the embodiments of the present disclosure;
[0026] Figure 3b This is the internal structure of the seeds of the CGR3-KO-5 group provided in the embodiments of the present disclosure;
[0027] Figure 3c The internal structure of the seeds of the CGR3-KO-6 group provided in the embodiments of the present disclosure;
[0028] Figure 4a This is a diagram of the structure of seed endosperm starch granules of the control group Nip provided in the embodiments of the present disclosure;
[0029] Figure 4b This is a diagram of the structure of starch granules in the seed endosperm of the CGR3-KO-5 group provided in the examples of the present disclosure;
[0030] Figure 4c This is a diagram of the starch granule structure of the seed endosperm of the CGR3-KO-6 group provided in the examples of the present disclosure. DETAILED DESCRIPTION
[0031] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.
[0032] Example
[0033] The present disclosure provides an application of a rice chalkiness negative regulatory gene CGR3, which includes: using the rice chalkiness negative regulatory gene CGR3 to promote the formation of rice chalkiness.
[0034] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the rice chalkiness negative regulatory gene CGR3 (LOC_Os11g31620) protein to increase the chalkiness rate of rice.
[0035] In this example, the sequence of the rice chalkiness negative regulatory gene CGR3 can be obtained from the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.
[0036] Specifically, the application includes: selecting CGR3-T as a gene knockout target in the sequence of the rice chalkiness negative regulatory gene CGR3, the sequence of CGR3-T is shown in SEQ ID NO: 1 in the sequence listing, specifically: TGACAACCATCCGCTTCAGCCGG; in this embodiment, based on the CGR3 coding sequence obtained on the gene knockout target selection website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the CGR3 gene knockout target was designed using the CRISPR-P2.0 tool to obtain CGR3-T.
[0037] The CGR3 gene knockout vector was constructed based on CGR3-T;
[0038] The CGR3 gene knockout vector was transformed into the recipient material to obtain a homozygous knockout mutant with a high chalky grain rate.
[0039] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid (donated by the team of Academician Liu Yaoguang, prepared using existing technology) as a template, using a first forward primer and a first reverse primer to amplify the promoter U6a by a first PCR to obtain a first amplification product of the U6b promoter containing CGR3-T, using a second forward primer and a second reverse primer to amplify the U6b promoter fragment containing the CGR3-T sequence and the guide sgRNA fragment containing the CGR3-T sequence by a second PCR to obtain a second amplification product of the guide sgRNA fragment containing CGR3-T, the sequence of the first forward primer (UF) is as shown in SEQ ID NO: 2 in the sequence listing, specifically: CTCCGTTTTACCTGTGGAATCG, the first reverse primer (CGR 3-U6aT) is as shown in SEQ ID NO: 3 in the sequence listing, specifically: GCTGAAGCGGATGGTT GTCACGGCAGCCAAGCCAGCA, and the sequence of the second forward primer (CGR3-gT) is as shown in SEQ ID NO: 4 in the sequence listing. NO: 4, specifically: TGACAACCATCCGCTTCAGCGTTTTAGAGCTAGAAAT, the second reverse primer (gR-R) is shown in SEQ ID NO: 5 in the sequence listing, specifically: CGGAGGAAAATTCCATCCAC.
[0040] Purifying and recovering the first amplification product and the second amplification product to obtain a purified first amplification product and a purified second amplification product;
[0041] The U6b promoter fragment containing the CGR3-T sequence and the guide sgRNA fragment containing the CGR3-T sequence were connected by overlapping PCR to obtain a connection product;
[0042] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the CGR3 gene knockout vector.
[0043] Furthermore, the reaction system for each 50 μL of the first PCR amplification includes: 10× Pfu Buffer (with Mg 2+ ) 5 μL; dNTPs (2.5 mM each) 4 μL; the first forward primer at a concentration of 10 μM 4 μL; the first reverse primer at a concentration of 10 μM 4 μL; template DNA 1 μL; Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL 0.25 μL; ddH2O 31.75 μL, a total volume of 50 μL.
[0044] Furthermore, the first PCR amplification procedure is:
[0045]
[0046] Furthermore, the reaction system for the second PCR amplification of each 50 μL includes: 10× Pfu Buffer (with Mg 2+ )5 μL; dNTPs (2.5 mM each) 4 μL; a second forward primer at a concentration of 10 μM 4 μL; a second reverse primer at a concentration of 10 μM 4 μL; template DNA 1 μL; Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL 0.25 μL; ddH2O 31.75 μL, a total volume of 50 μL.
[0047] Furthermore, the second PCR amplification procedure is:
[0048]
[0049] Furthermore, the reaction system of each 50 μL overlapping PCR includes: 10× Pfu Buffer (with Mg 2+ ) 5 μL; dNTP (2.5 mM each) 4 μL; the first forward primer (UF) with a concentration of 10 μM 4 μL; the second reverse primer (gR-R) with a concentration of 10 μM 4 μL, promoter U6a 50 ng, guide fragment sgRNA 50 ng; Pfu DNA high-fidelity polymerase 0.25 μL with a concentration of 5 U / μL; supplement ddH2O to a total volume of 50 μL.
[0050] Furthermore, the overlapping PCR amplification procedure is:
[0051]
[0052] After the overlapping PCR amplification reaction, the amplified product was recovered using a 1% agarose gel. The target amplified product was approximately 700 bp in length and was the sgRNA expression cassette. The sgRNA expression cassette was then ligated into the pYLCRISPR / Cas9Pubi-H vector using the Golden Gate ligation method.
[0053] The ligation reaction system includes: 1.5μL 10× CutSmart Buffer; 1.5uL 10mM ATP mixture; 0.5μL 100ng / μL pYLCRISPR / Cas9Pubi-H vector; 1μL 100ng / μL sgRNA expression cassette fragment; 0.5μL 20U / μL BsaI-HF endonuclease; 0.2μL 400U / μL T4 DNA ligase; 9.8μL ddH2O.
[0054] The reaction procedure for the connection is:
[0055]
[0056] After the ligation reaction is completed, a ligation product is obtained. After the sequence of the ligation product is verified to be correct, the construction of the CGR3 gene knockout vector is completed.
[0057] The CGR3 gene knockout vector was transformed into Agrobacterium EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. The CGR3 gene knockout vector was then transformed into the recipient material Nipponbare (commercially available) by Agrobacterium infection. The specific steps are as follows:
[0058] 1. Induction of callus tissue:
[0059] The hulls of mature Nipponbare seeds were removed using a small rice huller, and then the shelled and broken seeds were removed manually, retaining the plump seeds. 16 g of shelled seeds were weighed and placed in a 50 mL centrifuge tube.
[0060] First, rinse the container upside down five times with tap water, then four times with distilled water. Then, treat with 70% ethanol on a shaker for 5 minutes, then rinse three times with sterile water. Finally, add a 1% sodium hypochlorite (NaClO) solution and sterilize on a shaker at 100 rpm for 15-20 minutes. During disinfection, prepare sterilized filter paper, a spoon, tweezers, and an alcohol lamp on a clean bench. Preheat the spoon and tweezers to the alcohol lamp for several minutes, then aseptically cool to room temperature before use.
[0061] After the seeds are disinfected, open the centrifuge tube on the clean bench, pour out the sodium hypochlorite solution, and wash the seeds 4 to 5 times with sterile water on the clean bench to remove the residual sodium hypochlorite solution. Then use a spoon to spread the seeds evenly on the sterilized filter paper and place them on the clean bench for 1 to 2 hours until the seeds are dry.
[0062] Use tweezers to transfer the dried seeds to N6 solid induction medium, seal the culture dish with sealing film, and culture at a constant temperature of 28°C in the dark for about 30 days to obtain freshly induced callus tissue.
[0063] 2. Subgeneration:
[0064] Callus tissue in good condition is generally light yellow and dense. Observe the induced callus tissue and transfer the callus tissue in relatively good condition to a new N6 solid culture medium. Culture it at a constant temperature of 28°C in the dark for about two weeks to complete the subculture of the callus tissue.
[0065] 3. Cultivation and suspension of Agrobacterium:
[0066] The electroporated Agrobacterium EHa105 containing the CGR3 gene knockout vector was spread onto YEB solid culture medium containing rifampicin and kanamycin, and cultured in a 28°C incubator in the dark overnight.
[0067] Add 10 mL of 1 / 2N6 liquid medium (containing 150 μM AS) to a 50 mL centrifuge tube. Transfer the Agrobacterium containing the CGR3 gene knockout vector grown on YEB solid medium to the 1 / 2N6 liquid medium and mix thoroughly to obtain an Agrobacterium suspension. Adjust the bacterial suspension concentration to approximately OD600 = 0.8 using the same 1 / 2N6 liquid medium.
[0068] 4. Infection
[0069] Transfer fresh subcultured callus to the Agrobacterium suspension and co-cultivate on a low-speed shaker for 15-20 minutes. Carefully pour off the Agrobacterium suspension and transfer the callus to sterile filter paper and dry on a clean bench for 1-2 hours. Finally, transfer the dried callus to 1 / 2N6 solid medium (containing 150 μM AS) and incubate in a 20°C incubator in the dark for 1-2 days to obtain Agrobacterium-infected callus.
[0070] 5. Removal of Agrobacterium
[0071] Transfer the infected callus to a sterile 250 mL conical flask, add 150 mL of sterile water, shake gently to wash the callus, pour out the sterile water, and repeat the washing several times until the liquid is clear.
[0072] The cleaned callus tissue was transferred to N6 liquid culture medium containing 500 mg / L cephalosporin, sterilized on a low-speed shaker for 15 to 20 minutes, and then the culture medium was carefully poured out on a clean bench. This step was repeated three times.
[0073] After sterilization, the callus tissue was transferred to sterile filter paper and placed on a clean bench until completely dry.
[0074] 6. Screening of callus tissue
[0075] The sterilized and dried callus tissue was transferred to N6 solid medium (added with a final concentration of 250 mg / L cephalosporin and 50 mg / L hygromycin), cultured in a 28°C incubator in the dark for 30 days, and the callus tissue was screened.
[0076] 7. Differentiation
[0077] Observe the callus tissue growing on N6 solid medium, select calli with good growth, transfer them to MS solid medium, and culture them in a constant temperature and dark environment in an incubator at 28℃ for 10 days. Then transfer them to light culture for about 20 days.
[0078] 8. Rooting
[0079] When the callus tissue grows green shoots about 1-2 cm in length, it is transferred to 1 / 2MS rooting medium and cultured in a 28°C incubator under constant light for about 15 days until the seedlings grow roots.
[0080] 9. Hardening and transplanting
[0081] Remove the rooted seedlings from the 1 / 2 MS medium and gently wash the medium off the roots with tap water. Place the seedlings in a test tube filled with sterile water, changing the water daily. After approximately 7 days, remove any dead roots, retaining the taproot and healthy lateral roots, and transplant them into soil. These seedlings are now T0 generation plants. After two generations of self-pollination, T2 generation strains can be obtained for subsequent experiments.
[0082] The phenotype of the CGR3 homozygous knockout mutants was observed. Specifically, in this example, two CGR3 homozygous knockout mutants were selected, namely the CGR3-KO-5 group and the CGR3-KO-6 group. At the same time, the receptor material Nipponbare was used as the control group Nip.
[0083] The seeds of the control group, CGR3-KO-5 group and CGR3-KO-6 group were soaked, germinated, sown and raised as normal. When the seedlings were 27 days old, they were transplanted to the field and planted with a plant spacing of 16.7 cm and a row spacing of 26.7 cm. Each group had 30 plants planted and carried out normal field management.
[0084] When the seeds are mature, use a small rice huller to remove the husks, grind them into fine rice, and take pictures. Figure 1a 、 Figure 1b and Figure 1c As shown. Figure 1a 、 Figure 1b and Figure 1c It can be seen that the number of chalky seeds in the CGR3-KO-5 and CGR3-KO-6 groups was significantly higher than that in the control group Nip. The proportion of chalky seeds in the total number of seeds in the control group Nip and the CGR3-KO-5 and CGR3-KO-6 groups, i.e., the chalky seed rate, was also counted. 50 seeds were counted in each group, and 5 biological replicates were performed. The results are shown in the figure below. Figure 2 As shown. Figure 2 It can be seen that the chalky particle rate of the control group Nip was significantly lower than that of the CGR3-KO-5 group and the CGR3-KO-6 group.
[0085] The seeds of the control group Nip and the CGR3-KO-5 and CGR3-KO-6 groups were sliced into 2 mm thick sections and the internal structure of the seeds was observed under a stereomicroscope. Figure 3a 、 Figure 3b and Figure 3c As shown. Figure 3a 、 Figure 3b and Figure 3c It can be seen that there are large white opaque areas inside the seeds of the CGR3-KO-5 and CGR3-KO-6 groups, while there are no opaque areas inside the seeds of the control group Nip.
[0086] At the same time, 2 mm thick sections made from seeds of the control group Nip and the CGR3-KO-5 and CGR3-KO-6 groups were glued to the sample stage with conductive glue and gold-sprayed in an ion sputtering coater (Quorum SC7620). The structure of seed endosperm starch granules was observed under a scanning electron microscope (ZEISS GeminiSEM 300). Figure 4a 、 Figure 4b and Figure 4c As shown. Figure 4a 、 Figure 4b and Figure 4c It can be seen that the starch granules in the endosperm of the control group Nip are regular and tightly arranged, with no gaps between the starch granules, while the starch granules in the seed endosperm of the CGR3-KO-5 and CGR3-KO-6 groups are irregular and loosely arranged, with large gaps between the starch granules.
[0087] In summary, the chalky particle rates in the CGR3-KO-5 and CGR3-KO-6 groups were significantly higher than that in the control group Nip.
[0088] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.
Claims
1. An application of a rice chalkiness negative regulatory gene CGR3, characterized in that: The application includes: knocking out the rice chalkiness negative regulatory gene CGR3 to promote the formation of rice chalkiness, and the coding sequence of the rice chalkiness negative regulatory gene CGR3 is shown in SEQ ID NO: 6 in the sequence table.
2. The use according to claim 1, characterized in that The applications include: CGR3-T is selected as a target for gene knockout in the sequence of the rice chalkiness negative regulatory gene CGR3, and the sequence of CGR3-T is shown in SEQ ID NO: 1 in the sequence listing; A CGR3 gene knockout vector was constructed based on the CGR3-T using a first forward primer, a first reverse primer, a second forward primer, and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence listing, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence listing, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence listing; The CGR3 gene knockout vector is transformed into a recipient material to obtain a homozygous knockout mutant with a high chalky grain rate.
3. The use according to claim 2, characterized in that The application includes: using the pYLsgRNA-OsU6a plasmid as a template, using the first forward primer and the first reverse primer to amplify the promoter U6a by a first PCR to obtain a first amplification product containing the U6b promoter of the CGR3-T, and using the second forward primer and the second reverse primer to amplify the guide fragment sgRNA by a second PCR to obtain a second amplification product containing the guide sgRNA fragment of the CGR3-T; Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product; connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product; The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the CGR3 gene knockout vector.
4. The use according to claim 3, characterized in that The reaction system for the first PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer at a concentration of 10 μM; 4 μL of the first reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 1.75 μL of ddH2O3.
5. The use according to claim 3, characterized in that The reaction system for the second PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer at a concentration of 10 μM; 4 μL of the second reverse primer at a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase at a concentration of 5 U / μL; and 1.75 μL of ddH2O3.
6. The use according to claim 3, characterized in that The overlapping PCR reaction system per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM, 50 ng of the promoter U6a, and 50 ng of the guide fragment sgRNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.
7. The use according to claim 3, characterized in that Each 15 μL of the ligation reaction system includes: 1.5 μL of 10× CutSmart Buffer; 1.5 μL of 10 mM ATP mixture; 0.5 μL of 100 ng / μL pYLCRISPR / Cas9Pubi-H vector; 1 μL of 100 ng / μL sgRNA expression cassette fragment; 0.5 μL of 20 U / μL BsaI-HF endonuclease; 0.2 μL of 400 U / μL T4 DNA ligase; and 9.8 μL of ddH2O.
Citation Information
Patent Citations
Application and preparation method of rice plant height gene
CN117965557A
Temperature-responsive rice chalkiness gene PGWC3 as well as encoding protein and application thereof
CN118546947A