A method for increasing heat tolerance and / or fruit set at high temperatures in tomato pollen

By overexpressing the STP2 gene in tomatoes, the glucose and fructose content in anthers is increased, the heat resistance and fruit setting rate of pollen are enhanced, the problem of pollen abortion under high temperature is solved, and a high-temperature resistant tomato germplasm resource is provided.

CN119391754BActive Publication Date: 2025-10-24ZHEJIANG UNIV +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411590430.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2025-10-24
Estimated Expiration
2044-11-08

AI Technical Summary

Technical Problem

Tomato pollen is prone to sterility under high temperature conditions, resulting in a decrease in fruit set rate. Existing exogenous regulators may have residue problems in the plant body, and there are few reports on the STP family's regulation of reproductive growth resistance under high temperature adversity.

Method used

Through gene overexpression technology, the expression level of the tomato STP2 gene is improved, the glucose and fructose content in the anthers is increased, and the heat resistance and fruit setting rate of the pollen are enhanced. The specific steps include constructing an STP2 gene overexpression vector, Agrobacterium transformation and plant tissue culture.

Benefits of technology

It significantly reduces the pollen deformity rate under high temperature, increases the pollen germination rate and fruit setting rate, provides high-temperature resistant tomato germplasm resources, and solves the problem of pollen abortion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391754B_ABST
    Figure CN119391754B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving heat tolerance and / or fruit setting rate of tomato pollen, and belongs to the technical field of biotechnology.The method is to improve heat tolerance and / or fruit setting rate of tomato pollen by overexpressing sugar transporter protein STP2 gene in the tomato, wherein the nucleotide sequence of the protein coding region of the STP2 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein coded by the STP2 gene is shown as SEQ ID NO.2.The application utilizes transgenic technology and tissue culture technology to screen and obtain homozygous lines OE:STP2-1 and OE:STP2-2 of the overexpressed STP2 gene.Compared with wild type WT, the overexpressed plant has significantly reduced pollen abnormality rate and significantly improved pollen germination rate under high temperature, and the fruit setting rate of the tomato under high temperature stress is also significantly improved, thereby providing important gene resources for cultivating tomato varieties resistant to high temperature.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to a method for improving heat tolerance of tomato pollen and / or fruit setting rate under high temperature. BACKGROUND

[0002] Tomato, Solanum lycopersicum, is one of the most widely cultivated vegetables and economic crops in the world. It is widely favored by consumers due to its delicious taste and high content of lycopene, which has antioxidant and health care functions, and has a good market prospect for cultivation and planting. Tomato prefers warm but is not heat-tolerant, and the optimal growth temperature is 20-25℃. Due to the intensification of the greenhouse effect and the uncontrollability of the cultivation environment, high temperature in summer has become a major factor affecting the growth of tomato. In particular, during the reproductive growth stage of tomato, the sensitivity to high temperature is more significant. The critical high temperature for flower organs is 3-5℃ lower than that for leaves, and high temperature of 33℃ can significantly cause pollen abortion, flower and fruit drop, quality decline and other problems, which seriously limits the agricultural production goal of high quality and high yield of tomato. In response to high temperature stress, the heat tolerance of pollen is a key factor affecting pollen fertility and fruit setting rate, and pollen abortion is the main reason for the frequent occurrence of various industrial problems under high temperature. Therefore, studying the response mechanism of pollen to high temperature has important scientific and production practice significance for improving the resistance of tomato to high temperature during the reproductive growth period, which is conducive to improving the yield and quality of tomato, ensuring the balanced supply throughout the year, and has become a hot research field in botany.

[0003] At present, a series of pathways regulating pollen development in higher plants have been found, such as carbohydrate accumulation metabolism, hormone regulation, etc. Pollen continuously accumulates starch and other photosynthetic products and other carbohydrates in the early stage of pollen development, and as the pollen grains gradually mature, starch is degraded into soluble sugar to provide energy for pollen growth and development. As a powerful photosynthetic library, the direct source of carbohydrates for pollen is the anther supply, so the sugar accumulation and sugar transport process in the anther is the key to affecting pollen development. Mutations in the sucrose transporter genes SWEET13 and SWEET14 in Arabidopsis thaliana prevent sucrose from being transported from the anther to the pollen, resulting in a significant decrease in the content of soluble sugars such as sucrose, glucose, and fructose in the pollen, thereby affecting pollen development (Wang et al., Sucrose rather than GA transported by AtSWEET13 and AtSWEET14 supports pollen fitness at late anther development stages, New Phytologist, 2022). Silencing of the tomato sucrose invertase gene CWIN1 by inhibiting the hydrolysis of sucrose into glucose and fructose leads to abnormal pollen grain morphology and reduced fruit set rate (Zanor et al., RNA interference of LIN5 in tomato confirms its role in controlling brix content, uncovers the influence of sugars on the levels of fruit hormones, and demonstrates the importance of sucrose cleavage for normal fruit development and fertility, Plant Physiology, 2009, 150, 1204-1218).

[0004] In addition, there are studies on regulating pollen development in higher plants by applying exogenous regulators. Chinese patent document CN112352575A discloses a preparation with 5-hydroxytryptamine as the effective component, which can alleviate the pollen abortion phenomenon caused by high temperature in tomatoes, effectively maintain the normal development morphology of pollen, and thus effectively improve the tolerance of plants to high temperature stress and increase the fruit set rate. Chinese patent document CN108323516A discloses a preparation prepared with melatonin as the main effective component, which can safely and effectively alleviate high-temperature-induced pollen abortion in plants, thereby reducing the yield reduction and economic losses caused by reduced seed setting rate. However, exogenous regulators must be used strictly according to the recommended usage and dosage, and may have plant body residue problems.

[0005] STP (sugar transport protein) is a family of sugar transport proteins, and there are 18 members of the tomato STP family, which are distributed in the cell membrane, vacuole membrane, chloroplast and cytoplasm in plants (Reuscher et al., The sugar transporter inventory of tomato: genome-wide identification and expression analysis, Plant and Cell Physiology, 2014, 55 (6), 1123-1141). The currently identified STP is mainly responsible for transporting hexose, and the preferred substrate is glucose, and some STP can also transport fructose, galactose, mannose, etc. In tomato, mutation of tomato STP2 will lead to a decrease in the accumulation of hexose in the fruit and a decrease in the dry weight of the fruit (McCurdy, Functional Characterization and RNAi-Mediated Suppression Reveals Roles for Hexose Transporters in Sugar Accumulation by Tomato Fruit, Molecular Plant, 2010). The STP family plays an important regulatory role in plant growth, but there are few reports on its resistance regulation to reproductive growth under high temperature stress.

[0006] In recent years, biotechnology has developed rapidly, and the establishment of DNA recombination technology, especially the application of gene overexpression technology, can maximize the role of genes. The development of this technology not only provides an important way for the complex traits and functional research of horticultural crops, but also can effectively screen and cultivate germplasm resources with excellent resistance, and has a wide application prospect in plant breeding and variety improvement research. SUMMARY

[0007] In order to alleviate the problem of pollen abortion and reduced fruit set rate of tomato caused by high temperature stress, the application provides a method for improving the heat resistance of tomato pollen and the fruit set rate under high temperature by using STP2 gene, so as to provide a basis for breeding high-temperature-resistant tomato varieties.

[0008] The specific technical solutions adopted are as follows:

[0009] The application provides the application of the STP2 gene in improving the heat resistance of tomato pollen and / or the fruit set rate under high temperature, the nucleotide sequence of the protein coding region of the STP2 gene is shown as SEQ ID NO. 1, the length of the protein coding region is 1572 bp, and the full gene DNA sequence is shown as SEQ ID NO. 3.

[0010] Further, the expression level of the tomato STP2 gene is increased by gene overexpression technology.

[0011] The application also provides application of the protein encoded by the STP2 gene in improving heat tolerance of tomato pollen and / or fruit setting rate under high temperature, wherein the protein encoded by the STP2 gene is a protein mainly responsible for the transport of hexose on the cell membrane, which is composed of 523 amino acids, and the amino acid sequence of the protein encoded by the STP2 gene is shown as SEQ ID NO. 2.

[0012] High temperature can inhibit the transport of photosynthetic products from leaves to anthers, thereby reducing the soluble sugar content in anthers and pollen, and further causing pollen abortion, flower and fruit drop, quality reduction and other problems, and the STP2 gene and the protein encoded thereby can improve the heat tolerance of tomato pollen and the fruit setting rate under high temperature by increasing the glucose and fructose content in tomato anthers under high temperature stress, regulating the resistance of reproductive growth to high temperature, and improving the heat tolerance of tomato pollen and the fruit setting rate under high temperature.

[0013] The application also provides a method for improving the heat tolerance of tomato pollen and / or the fruit setting rate under high temperature, which comprises overexpressing the STP2 gene in tomato.

[0014] Specifically, the method for improving the heat tolerance of tomato pollen and / or the fruit setting rate under high temperature comprises the following steps:

[0015] (1) constructing a vector for overexpressing the STP2 gene;

[0016] (2) constructing an agrobacterium genetic engineering bacterium containing the vector for overexpressing the STP2 gene in step (1);

[0017] (3) transforming the agrobacterium genetic engineering bacterium constructed in step (2) into tomato cotyledons, and screening transgenic plants by plant tissue cell culture method.

[0018] Specifically, in step (1), RNA of tomato anthers is extracted, cDNA is obtained by reverse transcription, the tomato STP2 gene is amplified using the cDNA as a template and primers, and the amplification product is constructed into a vector.

[0019] Further, the primers comprise an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is AGGCGCGCCATGGCCGGTGGAGGATTTAC (SEQ ID NO. 4), and the nucleotide sequence of the downstream primer is ACGCGTCGACCAACCGAGAAGTGGGATCAT (SEQ ID NO. 5).

[0020] Further, the vector used in step (1) is a pFGC1008-3HA vector.

[0021] Preferably, in step (2), the Agrobacterium genetic engineering bacteria are Agrobacterium tumefaciens GV3101 strains.

[0022] The application also provides application of the method for improving heat tolerance of tomato pollen and / or fruit setting rate under high temperature in cultivating high-temperature-resistant tomatoes.

[0023] Compared with the prior art, the application has the beneficial effects that:

[0024] (1) The application provides a method for improving heat tolerance of tomato pollen and / or fruit setting rate under high temperature by using transgenic technology, and high-temperature-resistant transgenic homozygous lines OE:STP2-1 and OE:STP2-2 are obtained, which have wide application prospects in cultivating high-temperature-resistant tomato germplasm, and provide important gene resources for cultivating high-temperature-resistant tomato varieties.

[0025] (2) Compared with wild type WT, the transgenic tomatoes OE:STP2-1 and OE:STP2-2 cultivated by the application have significantly reduced pollen malformation rate and significantly improved pollen germination rate under high temperature, which indicates that overexpression of the STP2 gene can improve the heat tolerance of pollen, and the fruit setting rate after high temperature treatment proves that overexpression of STP2 can improve the fruit setting rate of tomatoes under high temperature stress. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 For the qRT-PCR verification of the expression level of the STP2 gene in the wild type WT tomato and the STP2 overexpression plant in Example 1 after the construction of the STP2 overexpression plant is successful, the statistical graph is shown in the figure; the lowercase letters a and b represent significant differences at the 5% level.

[0027] Figure 2 For the pollen grain morphology and pollen malformation rate of the wild type WT and the STP2 gene overexpression plant OE:STP2-1 under normal temperature and high temperature in Example 2, wherein A is a scanning electron microscope graph of the pollen grain morphology, and B is a pollen malformation rate statistical graph; the lowercase letters a, b and c represent significant differences at the 5% level.

[0028] Figure 3 For the pollen germination of the wild type WT and the STP2 gene overexpression plant OE:STP2-1 under normal temperature and high temperature in Example 2, wherein A is an aniline blue staining graph of pollen in vitro germination, and B is a pollen in vitro germination rate statistical graph; the lowercase letters a, b and c represent significant differences at the 5% level.

[0029] Figure 4 For the fruit setting rate of the wild type WT and the STP2 gene overexpression plant OE:STP2-1 under high temperature in Example 3, wherein A is a fruit setting phenotype graph, and B is a fruit setting rate statistical graph; the lowercase letters a and b represent significant differences at the 5% level.

[0030] Figure 5 The soluble sugar content in anthers of the wild type WT and STP2 gene overexpression plant OE:STP2-1 in Example 4 under high temperature is shown in the histogram, wherein A is the glucose content histogram, B is the fructose content histogram, and C is the sucrose content histogram; lowercase letters a and b represent significant differences at the 5% level. DETAILED DESCRIPTION

[0031] The application will be further illustrated by the following examples and figures. It should be understood that these examples are only used to illustrate the application, and are not used to limit the scope of the application. The operation methods not specified in the following examples are generally carried out under conventional conditions or under the conditions recommended by the manufacturer. The contents not described in detail in the specification belong to the prior art known to those skilled in the art. The experimental materials used in the following examples, unless otherwise specified, can be purchased from conventional biochemical reagent companies.

[0032] The tomato variety used in the following examples is the conventional tomato variety CR (Condine Red), and the wild type tomato plant WT without transgene is used as a control.

[0033] Example 1 Construction of STP2 gene overexpression vector and transgenic tomato

[0034] The sequence of the STP2 gene (Solyc09g075820) is obtained from the tomato genome database (https: / / solgenomics.net / ). The full-length DNA sequence is shown in SEQ ID NO. 3, the nucleotide sequence of the protein coding region is shown in SEQ ID NO. 1, and the amino acid sequence of the protein encoded by the STP2 gene is shown in SEQ ID NO. 2. The STP2 overexpression pFGC1008-3HA vector is constructed according to the Gateway manual. The upstream primer and the downstream primer are designed by using Primer5 software, and the specific sequences are as follows:

[0035] Upstream primer (SEQ ID NO. 4):

[0036] AGGCGCGCCATGGCCGGTGGAGGATTTAC;

[0037] Downstream primer (SEQ ID NO. 5):

[0038] ACGCGTCGACCAACCGAGAAGTGGGATCAT.

[0039] The RNA of the tomato anther is extracted, and the cDNA is obtained by reverse transcription. The full-length coding region of the tomato STP2 gene is amplified by using the above-mentioned upstream primer and downstream primer as a template, and purified by using a common DNA purification kit. The amplification product is connected to the overexpression vector pFGC1008-3HA with a 35S promoter, and is transformed by 42°C heat shock and plated. The resistance is chloramphenicol. After the successful construction of the recombinant plasmid, the plasmid is transformed into GV3101 Agrobacterium tumefaciens by electroporation, and the Agrobacterium strain used for constructing the STP2 overexpression material is obtained.

[0040] The disinfected tomato seeds are sown in the sowing medium, and the cotyledons are cut after 7 days. The Agrobacterium tumefaciens obtained by the above-mentioned steps is used to infect the tomato cotyledons, and the recombinant plasmid is transformed into the cotyledons. The totipotency of plant cells is used for tissue culture, and the T0 generation of transgenic tomatoes is obtained.

[0041] The T0 generation of transgenic tomato seedlings is detected by qRT-PCR. The RNA of the tomato anther is extracted, and the cDNA is obtained by reverse transcription. The STP2 gene is designed as follows:

[0042] qRT-PCR front primer (SEQ ID NO. 6):

[0043] ACCGGAGCAGTCAACGTTCT;

[0044] qRT-PCR rear primer (SEQ ID NO. 7):

[0045] ACCATGGCTAAGGTTGTCTGAATGA.

[0046] The wild-type plant WT is used as a control to compare the STP2 gene expression in the T0 generation of plants. The strain with the STP2 gene expression up-regulated by more than 20 times compared with the wild-type WT plant is selected, and is continuously self-crossed and bred to obtain two homozygous T2 generation strains, OE:STP2-1 and OE:STP2-2 (as shown in Figure 1

[0047] The following examples are all used for experiments by using the OE:STP2-1 homozygous strain T2 generation plant as a material. Example 2 Research on heat resistance of pollen of STP2 gene overexpression homozygous plant

[0048] ​The entire process of pollen microspore development from the tetrad stage to the binucleate stage is sensitive to high temperatures, especially for pollen in the mononucleate stage, which is about to divide and enter the binucleate stage. About 45 days after sowing tomato seeds, the plants enter the flowering stage. Tomato plants, just after the first flower opens, are placed in a high-temperature chamber at 33 / 28°C (day / night) to subject the mononucleate pollen to high temperatures for three days. After three days, pollen grain morphology is observed and the in vitro germination rate is measured from the flowers that have just opened that day. Plants in the normal temperature control group are cultured in a climate chamber at 25 / 20°C (day / night).

[0049] Pollen grain morphology observation method: Fully open tomato flowers were taken that morning. Pollen from the anthers was evenly shaken onto the conductive adhesive surface of a metal stage. The flowers were then gold-sprayed for 5 minutes using an Eiko Model IB5 ion plating machine (Japan). Pollen grain morphology was then observed and photographed using a Hitachi Model TM-1000 scanning electron microscope (Japan).

[0050] Method for detecting the in vitro germination rate of pollen: Take a fully opened tomato flower that morning, and evenly shake the pollen in the anther onto a glass slide with 40 μL of pollen in vitro germination solution. After incubating at 28°C in the dark for 1 hour, add 20 μL of 0.1% aniline blue staining solution. After staining in the dark for 5 minutes, observe the pollen germination under a fluorescence microscope and take photos for statistics.

[0051] The results are as follows Figure 2 A and B in Figure 3 As shown in Figures A and B, high temperature significantly increased the pollen deformity rate and reduced the in vitro germination rate of wild-type WT plants. However, after high temperature treatment, the pollen grain deformity of STP2 gene-overexpressing plants was less than that of wild-type pollen, and the pollen germination rate was significantly increased.

[0052] Example 3 Study on the fruit setting rate of homozygous plants overexpressing the STP2 gene under high temperature

[0053] About 45 days after sowing tomato seeds, the plants enter the flowering stage. After the first flower has just opened, the tomato plants are treated under high temperature stress of 33 / 28℃ (day / night) for 3 days, and then placed back under normal culture conditions for growth. After 15 days, the fruit setting is observed and photographed. Figure 4 As shown in A and B in Figure 3, the fruit setting rate of STP2-overexpressing plants after high temperature treatment was significantly higher than that of wild-type WT plants, which has application value in actual production.

[0054] Example 4 Study on the sugar content in anthers of homozygous plants overexpressing the STP2 gene

[0055] Tomato plants, just after their first flower opened, were placed in a 33°C / 28°C (day / night) incubator to expose the pollen, then in its uninucleate stage, to high temperatures for three days. After three days, anthers from flowers that had just fully opened that day were sampled and their glucose, fructose, and sucrose contents were determined.

[0056] Sugar content determination method: Grind 0.05 g of anther sample in liquid nitrogen. Add 1 mL of ddH2O and extract in an 80°C waterbath for 30 minutes, shaking the sample every 5 minutes. Centrifuge at 12,000 g for 10 minutes at 4°C, and collect the supernatant. Dilute the supernatant 25-fold with 80% acetonitrile, filter through a 0.22 μm nylon membrane, and analyze by high-performance liquid chromatography (HPLC).

[0057] The results are as follows Figure 5 As shown in Figures AC, the glucose and fructose contents in the anthers of STP2-overexpressing plants under high temperature were higher than those of the wild type, indicating that STP2 promoted the accumulation of hexose in anthers under high temperature.

[0058] The embodiments described above provide a detailed description of the technical solutions of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. STP2 Use of a gene or of a protein encoded by the gene for increasing the heat tolerance of tomato pollen and / or the fruit set at high temperatures, characterized in that, STP2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The method according to claim 1, STP2 Use of the gene or the encoded protein in increasing the heat tolerance of tomato pollen and / or the fruit set rate under high temperature, characterized in that, STP2 The nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.

1.

3. A method for increasing heat tolerance and / or fruit set at high temperature of tomato pollen, characterized in that, The tomatoes STP2 Gene overexpression, STP2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

4. The method for increasing heat tolerance and / or fruit set at high temperature of tomato pollen according to claim 3, characterized in that, Specifically comprising the following steps: (1) Constructing a vector overexpressing a gene STP2 gene; (2) Construct the overexpression protein in step (1) STP2 Gene vectors containing genetically engineered Agrobacterium; (3) Transforming the Agrobacterium genetic engineering bacteria constructed in step (2) into tomato cotyledon, and obtaining transgenic plants by plant tissue cell culture method.

5. The method for increasing heat tolerance and / or fruit set at high temperature of tomato pollen according to claim 4, characterized in that, In step (1), RNA of tomato flower is extracted, cDNA is obtained by reverse transcription, and the cDNA is used as a template to amplify tomato STP2 genes by using primers, and the amplified products are constructed into vectors.

6. The method for increasing heat tolerance and / or fruit set at high temperature of tomato pollen according to claim 5, characterized in that, The primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 4; and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

5.

7. The method for increasing heat tolerance and / or fruit set at high temperature of tomato pollen according to claim 4, characterized in that, In step (2), the Agrobacterium genetic engineering bacteria is Agrobacterium tumefaciens GV3101 strain.

8. Application of the method for improving heat tolerance and / or fruit setting rate of tomato pollen under high temperature according to any one of claims 3-7 in cultivating high-temperature-resistant tomatoes.

Citation Information

Patent Citations

  • Application of melatonin to alleviation of tomato pollen abortion due to high temperature induction

    CN108323516A

  • Method for increasing tomato fruit setting rate at high temperature by using 5-hydroxytryptamine preparation

    CN112352575A

  • Rust resistance gene

    CN105612255A