A method for inducing transgenic avocado composite plants without tissue culture

Abstract

The present invention discloses an induction method for obtaining a transgenic avocado composite plant without tissue culture, and belongs to the field of avocado biological technology. The induction method provided by the present invention comprises the following steps: germinating avocado seeds with quartz sand to obtain avocado seedlings, infecting rootless seedlings from the avocado seedlings with a vacuum infiltration method, inserting the rootless seedlings after the infection into a sterilized coconut husk matrix for cultivation, and obtaining the avocado composite plant. The present invention establishes an efficient genetic transformation system for avocado mediated by Agrobacterium rhizogenes, which does not require tissue culture and uses rootless seedlings as materials, thereby improving the transformation efficiency and reducing the consumption of experimental equipment, consumables and manpower, solving the problem that the avocado genetic transformation system has not yet been established, achieving the technical effect of obtaining transgenic materials quickly, efficiently, simply and with low consumption, and providing a more convenient and efficient approach for avocado genetic transformation.

Description

Technical Field

[0001] The present invention relates to the technical field of avocado biology, and in particular to an induction method for obtaining transgenic avocado composite plants without tissue culture. Background Art

[0002] Avocado (Persea americana L.) is a highly nutritious and economically valuable fruit tree. Due to high market demand and high returns from cultivation, the avocado industry has rapidly developed in Yunnan, Guangdong, Guangxi, and other regions, with the cultivated area rapidly increasing from 270,000 mu (approximately 1,000 hectares) in 2015 to 345,000 mu (approximately 1,000 hectares). Avocados have high fertilizer and water requirements and are severely affected by root diseases such as root rot and brown root disease. Therefore, there is an urgent need to develop avocado germplasm with strong resistance and high nutrient absorption and utilization rates. Currently, the mainstream approach to establishing a genetic transformation system for avocados is to obtain transgenic plants through co-cultivation with Agrobacterium under tissue culture conditions. However, there have been no reports of successful tissue culture of avocado seedlings. A tissue culture-free genetic transformation system for avocados is not only a key tool for studying the functions of resistance-related genes but also a crucial prerequisite for the precise molecular breeding of resistant rootstocks, thus holding great significance for the development of highly resistant avocado germplasm. Agrobacterium rhizogenes can integrate foreign genes into the plant genome via the Ri plasmid, inducing the production of genetically stable hairy roots, thereby achieving genetic transformation of the target gene. With its advantages of rapid development, ease of use, and wide application, A. rhizogenes-mediated genetic transformation has become a powerful tool for verifying plant gene function and studying root biology.

[0003] A system for genetic transformation of avocados mediated by Agrobacterium rhizogenes has not yet been reported. This is because obtaining transgenic plants through co-cultivation with Agrobacterium under tissue culture conditions requires strict control of various growth environment parameters during the transformation process. Furthermore, to ensure the success of tissue culture experiments, highly sophisticated laboratory equipment and precise experimental personnel are required. This transformation system has the following major bottlenecks and drawbacks, making obtaining transgenic materials extremely difficult:

[0004] (1) Long cycle and low conversion rate: Due to the high content of phenolic compounds and oxidases in avocado tissue, they have an inhibitory effect on Agrobacterium, resulting in a prolonged transformation cycle, an increased risk of infection and necrosis, and a low conversion rate;

[0005] (2) The operation is complex and the experimental requirements are strict, which takes up a lot of human resources: Under tissue culture conditions, the process of obtaining transgenic plants through Agrobacterium co-cultivation is very complex and requires strict control of various parameters of the growth environment during the transformation process, including oxygen content, hormone concentration, mineral nutrient concentration, pH value, etc. These operations require full-time technicians to perform regularly and require operators to be skilled and operate in a standardized manner. This process takes up a lot of human resources;

[0006] (3) Long-term occupation of experimental equipment and consumables: In the process of culturing cells, some important instruments and equipment need to be occupied for a long time, such as incubators and clean benches. At the same time, a large number of consumables are also needed to support the experiment, such as culture dishes, culture media, centrifuge tubes and pipette tips.

[0007] Therefore, it is of great significance to find a technical solution to improve the above-mentioned defects of the existing avocado genetic transformation technology and successfully achieve the acquisition of transgenic composite plants without relying on tissue culture. Summary of the Invention

[0008] The present invention aims to provide a tissue culture-free method for obtaining transgenic avocado composite plants, addressing the aforementioned problems of the prior art. The present invention establishes a highly efficient genetic transformation system for avocados induced by Agrobacterium rhizogenes, enabling functional verification in avocados.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] Technical Solution 1: A method for inducing avocado composite plants with transgenic hairy roots without tissue culture, comprising the following steps: germinating avocado seeds with quartz sand to obtain avocado seedlings, infecting rootless seedlings from the avocado seedlings with a vacuum infiltration method, and inserting the infected rootless seedlings into a sterilized coconut husk matrix for cultivation to obtain the avocado composite plants.

[0011] Furthermore, the quartz sand is sterilized.

[0012] Furthermore, the rootless seedlings are cut from avocado seedlings between 5 cm from the roots and 20 cm from the ground.

[0013] Furthermore, the impregnation solution used for the infection is obtained by activation culture of Agrobacterium rhizogenes MSU440.

[0014] Preferably, the activation of Agrobacterium rhizogenes MSU440 is performed by culturing the Agrobacterium rhizogenes MSU440 strain carrying the GFP reporter gene on the surface of a solid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin) at 28° C. for 48 h.

[0015] Furthermore, the preparation method of the impregnation solution includes: picking a single clone from the activated Agrobacterium rhizogenes MSU440 and transferring it to liquid LB culture medium for cultivation, removing the supernatant and resuspending it with MgCl2 solution to a bacterial solution OD of 600 The value is 1.0, 10 mmol / L of 2-morpholineethanesulfonic acid and 200 μmol / L of acetosyringone are added, and the mixture is allowed to stand in the dark for 3 hours to obtain the infection solution.

[0016] Preferably, it is allowed to stand at room temperature; preferably, the MgCl2 solution is 10 mmol / L.

[0017] Furthermore, the liquid LB culture medium contains 100 mg / L of kanamycin and 50 mg / L of streptomycin.

[0018] Furthermore, the vacuum infiltration method is to soak the rootless seedlings in the infection solution and vacuum for 20 minutes.

[0019] Preferably, soaking the rootless seedlings in the infection liquid is done by soaking the rootless seedlings with the cut end facing downwards in the infection liquid, and transferring the rootless seedlings and the infection liquid to a vacuum pump for evacuation for 20 minutes.

[0020] Furthermore, the culture is first cultured in the dark for 2 days and then transferred to normal culture under light.

[0021] Preferably, the substrate is kept moist by spraying water several times a day, and after culturing in the dark for 2 days, it is switched to light culture to induce the generation of hairy roots and obtain transgenic composite plants; the coconut husk is sterilized at high temperature.

[0022] The present invention discloses the following technical effects:

[0023] This method uses 20-cm-tall avocado seedlings as experimental material, using high-temperature sterilized coconut husk as the culture medium. The roots of the seedlings are directly excised using a sterile blade. After 20 minutes of vacuum infiltration infection, the wounds are infected with the MSU440 strain carrying the GFP reporter gene to induce hairy root formation. This method, which induces hairy root formation in a relatively open environment, eliminates the complex tissue culture steps and stringent experimental conditions required by the Agrobacterium tumefaciens transformation system, while achieving the goal of obtaining transgenic avocado material. The method uses rootless seedlings to avoid interference from the original root system, increasing the incidence and positive rate of hairy roots. Vacuum infection also increases the incidence and positive rate of hairy roots. Furthermore, the use of a GFP marker gene combined with PCR analysis enables non-destructive, rapid, and high-throughput detection of positive hairy roots. Within 30-40 days, the method can produce composite avocado plants containing hairy roots, with a 100% positive rate of hairy roots.

[0024] In summary, the present invention establishes a highly efficient genetic transformation system for avocados mediated by Agrobacterium rhizogenes. This system, which eliminates the need for tissue culture and utilizes rootless seedlings, improves transformation efficiency while also reducing the need for experimental equipment, consumables, and manpower. This addresses the lack of a genetic transformation system for avocados, achieving the technical benefits of rapid, efficient, simple, and low-cost acquisition of transgenic material, and providing a more convenient and efficient approach for genetic transformation of avocados. Furthermore, the highly efficient genetic transformation system for avocados induced by Agrobacterium rhizogenes established in the present invention enables functional verification in avocados. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 The specific process of inducing avocado composite plants;

[0027] Figure 2 This is the plasmid map of vector pCAMBIA1300;

[0028] Figure 3 This is the result of GFP fluorescence detection of positive hairy roots;

[0029] Figure 4 The results of positive hairy root PCR tests are shown in Figure 2, where lane M is Mark, lane 11 is the DNA template of the wild-type GFP root system, and lanes 1-10 are positive plants. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0036] A simple and efficient method for inducing avocado composite plants with transgenic hairy roots without tissue culture, comprising the following steps:

[0037] Step S1, avocado germination: transferring avocado seeds to sterilized quartz sand for germination;

[0038] Step S2, activation of Agrobacterium rhizogenes: Agrobacterium rhizogenes MSU440 strain carrying the GFP reporter gene was cultured on the surface of solid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin) at 28° C. for 48 h;

[0039] Step S3, preparation of infection solution: a single colony of the activated Agrobacterium rhizogenes MSU440 strain was selected and transferred to liquid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin), and cultured at 28°C and 220 rpm for 48 h; the cultured bacterial solution was centrifuged to remove the supernatant, and the culture was resuspended in sterile 10 mmol / L MgCl2 solution to an OD value of 0. 600 The value is 1.0; add 10mmol / L of 2-morpholineethanesulfonic acid and 200μmol / L of acetosyringone to the bacterial solution and let it stand in the dark at room temperature for 3 hours to obtain the infection solution.

[0040] Step S4, infection with Agrobacterium rhizogenes: select avocado seedlings with an above-ground height of 20 cm, cut them 5 cm away from the roots with a sterile blade, soak the cut rootless seedlings in the infection solution, and vacuum for 20 minutes;

[0041] Step S5, induction of composite plants containing transgenic hairy roots: insert the infected rootless avocado seedlings into a sterilized coconut husk culture medium, spray water several times a day to keep the medium moist, culture in the dark for 2 days, then transfer to light culture for 30-40 days to induce the formation of hairy roots and obtain transgenic composite plants.

[0042] Example 1 Induction of transgenic hairy roots in avocado

[0043] (1) Agrobacterium rhizogenes transformation

[0044] The Agrobacterium rhizogenes used in the present invention is the MSU440 strain (purchased from Shanghai Weidi Biotechnology Co., Ltd.), and the GFP reporter gene vector is pCAMBIA1300 (plasmid map as shown in FIG. Figure 2 The pCAMBIA1300 vector was transformed into competent MSU440 cells using the freeze-thaw method. The MSU440 strain carrying the pCAMBIA1300 vector was streaked onto solid culture medium containing LB + 100 mg / L kanamycin + 50 mg / L streptomycin. After the culture solution dried, the plate was sealed and inverted in a 28°C incubator for 48 hours.

[0045] (2) Preparation of Agrobacterium rhizogenes infection solution

[0046] Preparation of infection solution: After activation, a single colony of Agrobacterium rhizogenes MSU440 strain was selected and transferred to liquid LB medium (containing 100 mg / L kanamycin and 50 mg / L streptomycin) and cultured at 28°C and 220 rpm for 48 h. The cultured bacterial solution was centrifuged at 6000 rpm for 5 min, and the supernatant was removed. The cultured bacterial solution was resuspended in sterile 10 mmol / L MgCl2 solution and the OD value of the bacterial solution was adjusted. 600 The value is 1.0; add 10mmol / L of 2-morpholineethanesulfonic acid and 200μmol / L of acetosyringone to the bacterial solution and let it stand in the dark at room temperature for 3 hours to obtain the infection solution.

[0047] (3) Preparation of avocado explants

[0048] Avocado seeds were transferred to sterilized quartz sand for germination. After germination, healthy avocado seedlings with an aboveground height of 20 cm were selected and the aboveground part of the avocado was cut off 5 cm from the substrate using a sterile blade to obtain rootless avocado seedlings.

[0049] (4) Agrobacterium rhizogenes infection

[0050] Soak the rootless avocado seedlings, cut side down, in the infection solution. Transfer the seedlings and the infection solution to a vacuum pump and evacuate for 20 minutes. After infection, quickly insert the seedlings into a sterilized, moistened coconut coir substrate. Incubate in the dark for two days before transferring to a light-exposed environment, covered with a shade net. Water the substrate several times daily to keep it moist. After 30-40 days of incubation, examine the induction of hairy roots. Plants that develop hairy roots are transgenic composite avocado plants.

[0051] Example 2 Identification of transgenic hairy roots

[0052] (1) GFP fluorescence identification

[0053] The transgenic composite avocado plants were carefully removed from the substrate, the hairy roots were rinsed with sterile water, and then moved to a dark room. The GFP fluorescence signal was observed and photographed using a handheld GFP fluorescence detector or a fluorescence stereo microscope.

[0054] (2) PCR detection of GFP gene

[0055] The CTAB method was used to extract DNA from hairy roots, as follows: half of a single hairy root was cut with a sterile blade and placed in a mortar. After thorough grinding with liquid nitrogen, 1 mL of CTAB extraction solution (12.114 g L-1 Tris, 7.44 g L-1 EDTA-Na2, 81.9 g L-1 NaCl, 20 g L-1 CTAB, 10 g L-1 PVP-40) was added and transferred to a centrifuge tube. The tube was heated in a water bath at 65°C for 1 h (mixed up and down every 15 min). Centrifuge at 11200 rpm for 10 min, transfer the supernatant to a new centrifuge tube, add an equal volume of chloroform: isoamyl alcohol mixture (24:1), mix thoroughly and let stand for 5 min, centrifuge at 11200 rpm for 10 min, aspirate the supernatant into a new 1.5 mL centrifuge tube, add 2 / 3 volume ratio of pre-cooled isopropanol, mix and let stand at 4 ° C for 30 min, centrifuge at 12000 rpm for 5 min, discard the supernatant, wash DNA twice with 70% ethanol, air-dry on a clean bench, add 10 μL ddH2O to dissolve DNA and measure the concentration.

[0056] PCR identification was performed using GFP-specific primers F and R. Primer F: CGGGGTGGTGCCCATCCTGGTCGA (SEQ ID NO. 1); Primer R: TGGTCGGCGAGCTGCACGCTGCCG (SEQ ID NO. 2). The PCR program was set as: 95°C for 3 minutes, 35 cycles (specifically, 95°C for 15 seconds, 56°C for 15 seconds, 72°C for 1 minute), and 72°C for 10 minutes. Hairy roots that amplified a GFP gene band of approximately 500 base pairs were considered positive.

[0057] The experimental results show that after the avocado seedlings infected by the present invention were transferred to the greenhouse and cultured for 20 days, they began to form hairy roots ( Figure 1 The Agrobacterium rhizogenes MSU440 strain used in the present invention has been transformed into the pCAMBIA1300 vector containing the GFP reporter gene ( Figure 2 ), the induced hairy roots can be quickly and non-destructively identified by GFP fluorescence identification and GFP gene PCR detection. By observing with a handheld GFP fluorescence detector or a fluorescent stereo microscope, it can be clearly observed that the GFP tag protein is stably expressed in all hairy roots ( Figure 3). The DNA of wild-type avocado root and fluorescent avocado hairy root material obtained by the genetic transformation system of the present invention was extracted by conventional methods, and PCR amplification was performed using the GFP gene primers of the present invention. Figure 4 It can be found that: the wild-type GFP root DNA as a template cannot expand a specific band, and the fluorescent avocado hairy root obtained by the genetic transformation system of the present invention can amplify a specific band of about 500bp, with a positive rate of 100% ( Figure 4 ).

[0058] The present invention utilizes Agrobacterium MSU440 to transform rootless avocado seedlings under tissue culture-free conditions to obtain transgenic composite plants. This technique is feasible, simple, and efficient. Statistics show that the genetic transformation system established by the present invention yields a 100% positive rate for hairy roots. The present invention has established a genetic transformation system that does not require tissue culture. Using rootless avocado seedlings germinated in sand culture as the material, the system uses vacuum infiltration infection with the MSU440 rhizogenes Agrobacterium carrying the GFP reporter gene to induce wound formation of hairy roots, thereby obtaining transgenic composite avocado plants. Positive hairy roots are then rapidly and non-destructively identified through GFP fluorescence detection and PCR testing. This successfully establishes a rapid, efficient, simple, and non-destructive genetic transformation system for obtaining transgenic avocado material.

[0059] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for inducing avocado composite plants with transgenic hairy roots without tissue culture, characterized in that: The following steps are involved: Germinating avocado seeds with quartz sand to obtain avocado seedlings, infecting rootless seedlings of the avocado seedlings with a vacuum infiltration method, and inserting the infected rootless seedlings into a sterilized coconut husk substrate for cultivation to obtain the avocado composite plant; The quartz sand is sterilized; The rootless seedlings are cut from avocado seedlings between 5 cm from the root and 20 cm from the ground; The infection solution is obtained by activating and culturing Agrobacterium rhizogenes MSU440; The activation of Agrobacterium rhizogenes MSU440 is to culture the Agrobacterium rhizogenes MSU440 strain carrying the GFP reporter gene on the surface of a solid LB culture medium containing 100 mg / L kanamycin and 50 mg / L streptomycin at 28° C. for 48 hours; The preparation method of the impregnation solution comprises: picking a single clone from the activated Agrobacterium rhizogenes MSU440 and transferring it to liquid LB medium for cultivation; removing the supernatant and resuspending it in MgCl2 solution to a bacterial solution OD 600 The value is 1.0, 10 mmol / L of 2-morpholineethanesulfonic acid and 200 μmol / L of acetosyringone are added, and the mixture is kept in the dark for 3 hours to obtain the infection solution; The vacuum infiltration method is to immerse the rootless seedlings in the infection solution and evacuate the solution for 20 minutes; The culture is first cultured in the dark for 2 days and then transferred to normal culture under light.

Images