Gene modification method for enhancing TCR-T cell activity and application thereof

Abstract

The invention discloses a gene modification method for enhancing TCR-T cell activity and application thereof, and belongs to the technical field of cell engineering. The technical problem to be solved in the invention is how to improve the activity of T cells. In order to solve the technical problem, the invention provides a method for transforming the T cell, the method comprises the step of knocking out or silencing a CBLB protein coding gene in a target T cell to obtain a transformed T cell, and the target T cell is an in-vitro T cell containing the CBLB protein coding gene. The innovation of the application lies in that a gene modification method aiming at the TCR-T cells is adopted, and particularly, the activity and the function of the TCR-T cells are enhanced by intervening a CBLB pathway, so that the curative effect and the safety of the TCR-T cells in tumor immunotherapy are improved. The gene modification method disclosed by the invention can be widely applied to the field of tumor immunotherapy, and provides a new thought and technical support for developing a more effective TCR-T cell treatment scheme.

Description

Technical Field

[0001] The present application belongs to the field of cell engineering technology, and specifically relates to a gene modification method for enhancing TCR-T cell activity and its application. Background Art

[0002] As a revolutionary cancer treatment, TCR-T cell therapy has made significant progress in the field of cancer treatment in recent years. By using the patient's own immune system to attack tumor cells, TCR-T cell therapy has brought new hope and treatment options to many patients with advanced cancer. However, despite some successes, existing TCR-T cell therapy still has some limitations, including but not limited to unstable efficacy and immune-related side effects after treatment.

[0003] The poor therapeutic effect of TCR-T cells in solid tumors is an important problem facing the current field of cancer immunotherapy. Although TCR-T cell therapy technology has achieved certain success in some blood tumors, its therapeutic effect in solid tumors (such as lung cancer, breast cancer, colorectal cancer, etc.) is relatively poor. The lack of persistence of TCR-T cell activity is an important factor limiting its therapeutic effect in solid tumors. The complexity of the solid tumor environment and the immune escape mechanism make it difficult for TCR-T cells to maintain activity and function in tumor tissues for a long time, thereby affecting its therapeutic effect. TCR-T cells may be affected by the tumor microenvironment in solid tumors, resulting in a shorter duration of their activity. Once leaving the in vitro culture environment and entering the body, TCR-T cells may be affected by immunosuppressive cells, inhibitory factors, etc., causing their activity to drop rapidly, resulting in poor therapeutic effects.

[0004] In order to overcome the limitations of existing TCR-T cell therapy, researchers are constantly exploring various methods to enhance the function of TCR-T cells. Among them, gene modification technology is considered to be an effective means to enhance the activity and specificity of TCR-T cells. Through gene modification, researchers can regulate the function of TCR-T cells to better identify and attack tumor cells, thereby improving the therapeutic effect. Summary of the invention

[0005] The technical problem to be solved by this application is: how to improve the activity of T cells.

[0006] To solve the above technical problems, the present application provides a method for transforming T cells, which comprises knocking out or silencing the CBLB protein encoding gene in the target T cells to obtain transformed T cells, wherein the target T cells are isolated T cells containing the CBLB protein encoding gene.

[0007] In the present application, the CBLB protein is a protein with a reference sequence number of Q13191 in the UniProtKB database (website: https: / / www.uniprot.org / ).

[0008] In this application, the reference sequence number of the CBLB gene is NCBI Reference Sequence: NM_170662.5 (public update date 12-AUG-2024).

[0009] Furthermore, in the method, the silencing is achieved by introducing shRNA targeting the CBLB protein encoding gene into the target T cells, and the shRNA is transcribed from a DNA molecule having a nucleotide sequence of SEQ ID NO.3.

[0010] Furthermore, in the method, the knockout is achieved by introducing a CRISPR / Cas system into the target T cells, wherein the CRISPR / Cas system includes a gRNA targeting the gene encoding the CBLB protein and an effector protein of the CRISPR / Cas system: Cas9 protein, and the target sequence of the gRNA is positions 1-20 of SEQ ID NO.5 (TTCCGCAAAATAGAGCCCCA).

[0011] Furthermore, the method for transforming T cells also includes introducing a TCR encoding gene into the target T cells, wherein the TCR is a T cell antigen receptor.

[0012] The TCR encoding gene can be any T cell antigen receptor encoding gene.

[0013] In one embodiment of the present application, the TCR encoding gene is a DNA molecule shown in SEQ ID NO.1.

[0014] Compared with the target T cells, the modified T cells have at least one of the following characteristics:

[0015] 1) Enhanced T cell activity;

[0016] 2) Enhanced killing of tumor cells;

[0017] 3) T cell secretion of interferon-γ increased;

[0018] 4) T cell secretion of interleukin-2 increased;

[0019] 5) T cell secretion of interleukin-5 increased;

[0020] 6) T cell secretion of interleukin-8 increased;

[0021] 7) The ability of T cells to inhibit the growth of tumor cell volume is improved.

[0022] Furthermore, the recombinant T cell may also contain a TCR encoding gene, where the TCR is a T cell antigen receptor.

[0023] Furthermore, the TCR encoding gene is a DNA molecule shown in SEQ ID NO.1.

[0024] The present application also provides a method for improving T cell activity, which comprises improving the T cell activity by down-regulating the expression of the CBLB protein encoding gene in the T cell or down-regulating the content of the CBLB protein in the T cell.

[0025] In the present application, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated by the gene).

[0026] In the present application, the regulating gene expression may be inhibiting or reducing the gene expression, and the inhibiting or reducing the gene expression may be achieved by gene knockout or by gene silencing.

[0027] The gene knockout is to inactivate a specific target gene by changing the DNA sequence.

[0028] The gene silencing refers to the phenomenon that the gene is not expressed or is underexpressed without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or is underexpressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0029] Furthermore, in the method, the down-regulation of the expression of the CBLB protein encoding gene or the down-regulation of the CBLB protein content is achieved by gene silencing or gene knockout; the gene silencing is achieved by introducing shRNA targeting the CBLB protein encoding gene into the T cells, and the shRNA is transcribed from a DNA molecule having a nucleotide sequence of SEQ ID NO.3;

[0030] The gene knockout is achieved by the CRISPR / Cas system, which includes a gRNA targeting the gene encoding the CBLB protein and an effector protein of the CRISPR / Cas system: Cas9 protein, and the target sequence of the gRNA is SEQ ID NO.5, positions 1-20 (TTCCGCAAAATAGAGCCCCA).

[0031] Furthermore, in the method, the T cells may be T cells that have not been otherwise modified.

[0032] Furthermore, in the method, the T cells may also be T cells that have been modified in other ways.

[0033] Furthermore, in the method described above, the "other modified T cells" include T cells (TCR-T cells) expressing T cell receptors (T cell receptor, TCR) and / or the T cells are T cells (CAR-T cells) expressing chimeric antigen receptors (Chimeric Antigen Receptor, CAR).

[0034] Furthermore, in the method described above, the "other modified T cells" also include other modifications that are feasible in the art and / or appear in the future.

[0035] In some embodiments of the present application, the gene silencing is achieved by transfecting the T cells with a lentivirus containing the shRNA.

[0036] In some embodiments of the present application, the lentivirus containing shRNA is obtained by mixing a lentiviral plasmid containing the shRNA gene with a lentiviral packaging plasmid in a ratio of 2:1:1, and then transfecting 293T cells and culturing them.

[0037] In some embodiments of the present application, the gRNA and Cas9 protein of the CRISPR / Cas system are transfected into the T cells in the form of Cas9 RNP (ribonucleoprotein complex).

[0038] In some embodiments of the present application, the T cell is a T cell expressing a T cell receptor.

[0039] Furthermore, the coding sequence of the T cell receptor is SEQ ID NO.1.

[0040] The present application also provides the use of CBLB protein or a substance for regulating the expression of a gene encoding the CBLB protein or a substance for regulating the content of the CBLB protein in regulating T cell activity, wherein the substance may be a biological material, and the biological material may be any of the following:

[0041] B1), a nucleic acid molecule that inhibits or reduces the expression of the CBLB protein encoding gene;

[0042] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0043] B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0044] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0045] B5), a ribonucleoprotein complex containing the nucleic acid molecule described in B1).

[0046] Furthermore, in the application, the nucleic acid molecule may be any of the following:

[0047] G1), shRNA encoded by a DNA molecule having a nucleotide sequence of SEQ ID NO.3;

[0048] G2), a DNA molecule whose nucleotide sequence is SEQ ID NO.3;

[0049] G3), gRNA with a target sequence of SEQ ID NO.5, positions 1-20 (TTCCGCAAAATAGAGCCCCA);

[0050] G4), RNA molecule whose nucleotide sequence is SEQ ID NO.5.

[0051] Furthermore, in the present application, the expression cassette described in B2) refers to a DNA capable of expressing the RNA in a host cell, and the DNA may include not only a promoter for initiating RNA gene transcription, but also a terminator and / or enhancer sequence for terminating RNA gene transcription.

[0052] In some embodiments of the present application, the recombinant vector described in B3) may be a pU6-shCBLB plasmid.

[0053] Furthermore, in the present application, the recombinant microorganism may specifically be a recombinant virus, yeast, bacteria, algae and fungi.

[0054] In some embodiments of the present application, the recombinant virus may be pU6-shCBLB lentivirus.

[0055] In some embodiments of the present application, the ribonucleoprotein complex described in B5) includes the Cas9 protein and the gRNA described in G2) above.

[0056] The biological material is also the protection content of this application.

[0057] The present application also provides a recombinant T cell, wherein the recombinant T cell comprises any of the following:

[0058] A1), recombinant T cells prepared by the above method;

[0059] A2), the recombinant T cells do not contain the CBLB protein encoding gene (that is, the CBLB protein encoding gene in the recombinant T cells is knocked out);

[0060] A3), the recombinant T cells contain a shRNA gene targeting a CBLB protein encoding gene (i.e., the CBLB protein encoding gene in the recombinant T cells is silenced by the shRNA;

[0061] A4), T cells containing the above biological materials.

[0062] Furthermore, among the recombinant T cells, the recombinant T cells described in any one of A2) to A4) also contain a TCR encoding gene, and the TCR is a T cell antigen receptor.

[0063] Furthermore, the coding sequence of the T cell receptor is SEQ ID NO.1.

[0064] Furthermore, the T cells are T cells (TCR-T cells) expressing T cell receptors (T cell receptor, TCR) and / or the T cells are T cells (CAR-T cells) expressing chimeric antigen receptors (Chimeric Antigen Receptor, CAR).

[0065] Furthermore, the T cell may be a T cell expressing a T cell receptor.

[0066] Furthermore, the coding sequence of the T cell receptor is SEQ ID NO.1.

[0067] The present application also provides the use of the recombinant T cells and / or the biomaterials as drugs for treating diseases.

[0068] The present application also provides a method for using the recombinant T cells and / or the biomaterials to prevent or treat MAGOHB target-related diseases, the method comprising administering an effective dose of the recombinant T cells and / or the biomaterials to a subject suffering from a MAGOHB target-related disease.

[0069] The present application also provides a method for preventing or treating a MAGOHB target-related disease, comprising administering an effective dose of the recombinant T cells and / or the biological material to a subject suffering from the MAGOHB target-related disease.

[0070] In the present application, the MAGOHB target-related disease may be a disease caused by a G17A mutation in the MAGOHB target, including but not limited to tumors and / or blood diseases.

[0071] In the present application, "subject" includes a person who is being treated for a disease or preventing a disease as a patient. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, rodents (order Rodentia) mammals, such as mice and hamsters, and lagomorpha (order Logomorpha) mammals, such as rabbits. Mammals can be carnivores (order Carnivora), including felines (cats) and canines (dogs). Mammals can be even-toed ungulates (order Artiodactyla), including bovines (cows) and suids (pigs), or odd-toed ungulates (order Perssodactyla), including equines (horses). Mammals can be primates (order Primate), four-legged monkeys (order Ceboid) or monkeys (order Simoid) (monkeys) or humanoids.

[0072] Order Anthropoid (humans and apes). In some embodiments, the mammal is a human.

[0073] The term "effective" as applied to dosage or amount refers to an amount of a compound or pharmaceutical composition sufficient to produce the desired activity upon administration to a subject in need thereof. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amount of each ingredient that would be effective if administered alone. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the specific drug or drugs employed, the mode of administration, and the like.

[0074] The beneficial technical effects achieved by this application are as follows:

[0075] The innovation of this application lies in the gene modification method for TCR-T cells, especially by intervening in the CBLB pathway to enhance the activity and function of TCR-T cells, thereby improving their efficacy and safety in tumor immunotherapy.

[0076] The gene modification method of the present application can be widely used in the field of tumor immunotherapy, providing new ideas and technical support for the development of more effective TCR-T cell therapy programs. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 In order to analyze the transduction rate of shRNA by flow cytometry, the positive rate of co-expressed GFP fluorescent protein was used to represent the transduction rate of shRNA vector.

[0078] Figure 2 The results of quantitative PCR analysis of the gene silencing rate of CBLB shRNA.

[0079] Figure 3 is the death rate of tumor cells after co-culture with TCR-T cells.

[0080] Figure 4 Schematic diagram of sgRNA targeting the CBLB locus.

[0081] Figure 5 To detect the knockout effect of the CBLB gene using Sanger sequencing.

[0082] Figure 6 To detect the knockout effect of CBLB gene using T7E1 endonuclease method.

[0083] Figure 7 is the death rate of tumor cells after co-culture with TCR-T cells.

[0084] Figure 8 is the concentration of interferon-γ in the culture supernatant after co-culture with TCR-T cells.

[0085] Fig. 9 is the concentration of interleukin-2 in the culture supernatant after co-culture with TCR-T cells.

[0086] Fig.10 is the concentration of interleukin-5 in the culture supernatant after co-culture with TCR-T cells.

[0087] Fig.11 is the concentration of interleukin-8 in the culture supernatant after co-culture with TCR-T cells.

[0088] Fig.12 Comparison of tumor sizes in each group of mice. DETAILED DESCRIPTION

[0089] The present application is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present application, not for limiting the scope of the present application. The examples provided below can be used as a guide for further improvements by ordinary technicians in the technical field, and do not constitute a limitation of the present application in any way.

[0090] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0091] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0092] The following examples used GraphPad Prism statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. The t-test was used for the test. P < 0.05 (*) indicated a significant difference, and P < 0.001 (***) indicated a very significant difference.

[0093] In the present application, the reference sequence number of the CBLB gene is NCBI Reference Sequence: NM_170662.5 (public update date 12-AUG-2024), and the reference sequence number of its encoded protein is UniProtKB database ID: Q13191 (updated date 24-Jul-2024).

[0094] Example 1: Construction of CBLB gene-silenced TCR-T cells

[0095] 1. Construction of lentiviral vector loaded with TCR gene

[0096] The TCR gene (SEQ ID NO.1) was assembled and cloned into the lentiviral vector pLVX-IRES-ZsGreen1 (Clontech, catalog number 632187) to obtain the pLVX-TCR vector, and the specific insertion site was: the fragment between 2809 and 4112 of the original vector was replaced by the TCR gene (SEQ ID NO.1). The full sequence of the pLVX-TCR vector is shown in Table 1.

[0097] 2. Construction of Lentiviral Vector Loaded with CBLB shRNA

[0098] The nucleotide sequence of the U6 promoter (SEQ ID NO. 2) and CBLB shRNA (SEQ ID NO. 3) were assembled and cloned into the lentiviral vector pCDH-EF1-copGFP-T2A-Puro (Addgene, catalog number #72263) to obtain the pU6-shCBLB vector. The full sequence of the pU6-shCBLB vector is shown in Table 1.

[0099] The nucleotide sequence of the U6 promoter (SEQ ID NO.2) and nonsense shRNA (SEQ ID NO.4) were assembled and cloned into the lentiviral vector pCDH-EF1-copGFP-T2A-Puro (Addgene product, catalog number #72263) to obtain the pU6-controlshCBLB vector. The sequence of the pU6-control shCBLB vector is the sequence of replacing the CBLBshRNA at positions 2045 to 2098 of the pU6-shCBLB vector with the nonsense shRNA sequence.

[0100] 3. Preparation of lentivirus loaded with TCR or CBLB shRNA

[0101] 293T cells (ATCC product, catalog number: CRL-3216) were used. TM ) to produce pLVX-TCR lentivirus or pU6-shCBLB lentivirus. Taking pLVX-TCR lentivirus as an example, the specific implementation steps are as follows:

[0102] Count 3×10 6 293T cells were suspended in 10 mL of serum-free DMEM medium and inoculated on a 10 cm culture dish. Transfection was performed after the cells adhered to the wall and occupied more than 50% of the total area of ​​the culture dish. The pLVX-TCR vector and the lentiviral packaging plasmid pmd2.G (Addgene product, catalog number #12259) and pSPAX2 (Addgene product, catalog number: #12260) were mixed in a ratio of 2:1:1, transfected into 293T cells, and incubated in a 37°C, 5% CO2 cell culture incubator; fresh DMEM medium was replaced 24 hours after transfection, and the culture supernatant containing the pLVX-TCR lentivirus was collected 72 hours later, aliquoted and frozen at -80°C for long-term storage.

[0103] The preparation method of pU6-shCBLB lentivirus refers to the pLVX-TCR lentivirus, the only difference is that the pLVX-TCR vector is replaced by the pU6-shCBLB vector.

[0104] The preparation method of nonsense shRNA lentivirus (also called control shRNA lentivirus) refers to the pLVX-TCR lentivirus, the only difference is that the pLVX-TCR vector is replaced by the pU6-control shRNA vector.

[0105] 4. Construction of CBLB gene-silenced TCR-T cells

[0106] Peripheral blood mononuclear cells donated by healthy people were transfected with pLVX-TCR lentivirus and pU6-shCBLB lentivirus in sequence to prepare CBLB gene silenced TCR-T cells, named CBLB shRNA TCR-T cells. The specific implementation steps are as follows:

[0107] Mononuclear lymphocytes were isolated from peripheral blood donated by healthy individuals using a vacuum venous blood sample collection container (BD Biosciences, catalog number 362761), and CD8-positive T cell subsets (CD8+T) were isolated using a CD8-positive cell isolation kit (Thermo Fisher, catalog number 11333D). CD8+T cells were counted and the cell concentration was adjusted to 1×10 in GT-T551 H3 medium (Takara product, catalog number: #WK551S). 6 / mL, inoculated into 24-well plates, 1mL per well, incubated in a 37°C, 5% CO2 cell culture incubator for 24 hours; added 500μL of viral supernatant (pLVX-TCR lentivirus: pU6-shCBLB lentivirus is 1:1), added protamine sulfate (final concentration 8μg / mL, Sigma Aldrich product, catalog number 53597-25-4), centrifuged at 800×g for 1.5 hours; discarded viral supernatant and added fresh. On the second day, 1ug / mL of puromycin was added to the culture medium for selection, and culture was continued for 12 days. On the 15th day, the proportion of GFP-positive T cells was analyzed by flow cytometry. All remaining cells were collected and frozen in liquid nitrogen for later use.

[0108] At the same time, TCR-T cells transduced with nonsense shRNA were set as a control. The preparation method of TCR-T cells transduced with nonsense shRNA referred to CBLB shRNA TCR-T cells, the only difference being that pU6-shCBLB lentivirus was replaced with nonsense shRNA lentivirus. TCR-T cells transduced with nonsense shRNA were named control shRNA TCR-T cells.

[0109] The experimental results are shown in Figure 1 , Figure 1In the figure, control shRNA indicates control shRNA TCR-T cells, and CBLBshRNA indicates CBLB shRNA TCR-T cells. The results show that the transduction rate of shRNA vector is higher than 94%.

[0110] The transduction-positive cells screened by CBLB shRNA TCR-T cells were named CBLB KD TCR-T cells. The transduction-positive cells screened by control shRNA TCR-T cells were named control TCR-T cells.

[0111] 5. Identification of CBLB gene silencing rate

[0112] One million CBLB gene silenced TCR-T cells or one million nonsense shRNA transduced TCR-T cells were taken, and the silencing rate of the CBLB gene was identified by fluorescent quantitative PCR. The specific implementation steps are as follows:

[0113] Total RNA of cells was extracted using an RNA extraction kit (Qiagen, catalog number 74104). Next, cDNA was prepared using a universal reverse transcription kit (Roche, catalog number 5893151001), followed by fluorescence quantitative analysis using CBLB-specific primers (primer sequences: 5'-TGAACTCCTCCTTTCCGTGG-3' and 5'-ATTTTGGCACAGTCTTACCACTT-3') and fluorescence quantitative reagent SYBRGreen (Roche, catalog number 4913914001). GAPDH was used as the internal reference gene, and the ΔΔCT method was used to calculate the relative expression of the CBLB gene.

[0114] The PCR system is as follows:

[0115] Reagents Volume (μL) SYBR green (2×master mix) 5 Primer Forward (10 μM) 0.5 Primer Reverse (10 μM) 0.5 <![CDATA[H2O]]> 2 gDNA (adjust the concentration to 1ng / μL) 2

[0116] qPCR procedure:

[0117]

[0118] The experimental results are shown in Figure 2 , Figure 2 Control TCR-T represents TCR-T cells transduced with nonsense shRNA, and CBLC-KDTCR-T represents TCR-T cells with CBLB gene silenced. The results showed that the relative expression of CBLB gene in TCR-T cells with CBLB gene silenced was significantly reduced compared with that in TCR-T cells transduced with nonsense shRNA.

[0119] VI. Verification of the killing ability of CBLB gene-silenced TCR-T cells

[0120] Use stable transduction of firefly luciferase and MAGOHB G17A The SW480-Luc cell line expressing the mutant peptide (sequence: RYYVGHKAKF) was used as the target cell, and the luciferase activity was detected to determine the mortality of tumor cells after co-culture with CBLB KD TCR-T cells. The specific implementation steps are as follows:

[0121] TCR-T cells and SW480-Luc cells were mixed at a cell number ratio of 0.3:5, 0.6:5, 1.25:5, and 2.5:5, respectively. The number of SW480-Luc cells in each well was 50,000, and they were cultured in a 96-well plate with GT-T551 H3 medium (from Takara, catalog number: #WK551S) overnight. Three wells were set up for each ratio. On the second day, 150 μg / mL of luciferin (Novozyme, catalog number DD1210-03) was added to the culture supernatant. After incubation for 1 minute, the luminescence intensity (C1) was detected using an enzyme reader. The SW480-Luc cell group alone was used as the initial value C0 to calculate the mortality rate of tumor cells in each co-culture group.

[0122] The only difference between the SW480-Luc cell-alone group and the co-culture group was that the TCR-T cells and SW480-Luc cells mixed in the ratio of 0.3:5, 0.6:5, 1.25:5, and 2.5:5 were replaced with 50,000 SW480-Luc cells.

[0123] The calculation formula is as follows:

[0124] Tumor cell death rate (%) = (C0-C1) / C0×100

[0125] Using control TCR-T cells as a control, the specific implementation steps refer to the implementation steps of CBLB KD TCR-T cells, with the only difference being that CBLB KD TCR-T cells are replaced by control TCR-T cells.

[0126] Results Figure 3 The results showed that compared with control TCR-T cells, the killing ability of CBLB KD TCR-T cells was significantly improved.

[0127] Among them, stable transduction of firefly luciferase and MAGOHB G17A The SW480-Luc cell line with the mutant peptide (sequence: RYYVGHKAKF) was named SW480-Luc-MAGOHB G17A , obtained by the following method: MAGOHB G17ALentiviral transduction into SW480-Luc cells (Wuhan Saiweier Biotechnology, Catalog No. STCC00012P) to obtain stable transduction of firefly luciferase and MAGOHB G17A SW480-Luc cell line with mutant peptide (sequence: RYYVGHKAKF).

[0128] MAGOHB G17A The preparation method of lentivirus refers to the pLVX-TCR lentivirus, the only difference is that the pLVX-TCR vector is replaced by pLVX-MAGOHB G17A Vector, pLVX-MAGOHB G17A The complete sequence of the vector is shown in Table 1.

[0129] Example 2: Construction of CBLB gene knockout TCR-T cells

[0130] 1. Construction of CBLB gene knockout TCR-T cells

[0131] Peripheral blood mononuclear cells donated by healthy people were transfected with pLVX-TCR lentivirus and Cas9 / CBLB sgRNA mixture (ribonucleoprotein complex) to prepare CBLB gene knockout TCR-T cells. The Cas9 in the Cas9 / CBLB sgRNA mixture is a Thermo Fisher product, catalog number: A36499. The nucleotide sequence of CBLB sgRNA is SEQ ID NO.5, which was custom-synthesized by GenScript Biotech.

[0132] Among them, the 1st to 20th positions of SEQ ID NO.5 are the target sequence (protospacer sequence) of CBLB sgRNA, and the 21st to 96th positions are the scaffold sequence (scaffold sequence) of CBLB sgRNA. The site targeted by CBLB sgRNA is located in the 6th exon region of the CBLB locus (see Figure 4 ). At the same time, TCR-T cells transduced with nonsense sgRNA (control sgRNA) were set as controls, and the sequence of control sgRNA was SEQ ID NO.6, wherein positions 1-20 of SEQ ID NO.6 were the nonsense target sequence (protospacer sequence) of sgRNA, and positions 21-96 were the scaffold sequence (scaffold sequence) of control sgRNA.

[0133] SEQ ID NO.5, the complete sequence of CBLB sgRNA: TTCCGCAAAATAGAGCCCCAgttttagagctagaa atagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0134] SEQ ID NO.6, the complete sequence of control sgRNA: TCATGCTTGCTTGGGCAAAAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0135] The specific implementation steps are as follows:

[0136] Mononuclear lymphocytes were isolated from peripheral blood donated by healthy individuals using a vacuum venous blood sample collection container (BD Biosciences, Catalog No. 362761), and CD8-positive T cell subsets (CD8+T) were isolated using a CD8-positive cell isolation kit (Thermo Fisher, Catalog No. 11333D). CD8+T cells were counted, and the cell concentration was adjusted to 1×10 6 / mL, inoculated into 24-well plates, 1mL per well, incubated in a 37°C, 5% CO2 cell culture incubator for 24 hours; added 500μL pLVX-TCR lentiviral supernatant, added protamine sulfate (final concentration 8μg / mL, Sigma Aldrich, catalog number 53597-25-4), centrifuged at 800×g for 1.5 hours; discarded viral supernatant, added fresh culture medium. On the second day, the cells were collected and transferred to an electroporation cup (BIO-RAD, catalog number 165-2088), and 7.5μg Cas9 protein (Thermo Fisher, catalog number A36499) and 3μg sgRNA (custom synthesized by GenScript) were added at the same time. The electroporation cup was placed in an electroporator (BIO-RAD, Gene PulserXcell electroporator) for electrotransfection, and then the cells were transferred to a six-well plate and continued to be cultured for 12 days. On the 15th day, all the remaining cells were collected and frozen in liquid nitrogen for later use.

[0137] II. Identification of CBLB gene knockout effect

[0138] Take 1 million CBLB gene-erased TCR-T cells or 1 million nonsense sgRNA-transduced TCR-T cells, and use the T7E1 endonuclease method to identify the knockout effect of the CBLB gene. The specific implementation steps are as follows:

[0139] The genomic DNA of the cells was extracted using a DNA extraction kit (Qiagen, catalog number 51304). Next, the gene editing region was PCR amplified using CBLB-specific primers (primer sequences: 5'-GACTTGAACGTCTGCTGT-3' and 5'-CAAGCATGCCATCAGCGG-3'). Half of the PCR product was used to detect the proportion of DNA cut by T7E1 by agarose gel electrophoresis to reflect the gene editing effect. At the same time, half of the PCR product was sent to Sanger sequencing, and the proportion of the peaks was observed through the peak graph to reflect the gene editing effect.

[0140] The mismatch enzyme cleavage method can effectively cut and identify unpaired bases in DNA. Extract the genome of the control group and the experimental group cells, design primers before and after the editing site for PCR, and then mix and anneal the PCR products of the control group and the experimental group. When the wild-type and mutant PCR products are hybridized, unpaired bases will be produced. The nucleic acid mismatch enzyme will recognize and cut the unmatched base sites in the DNA, and cut the PCR product at the mismatch. The DNA cutting rate is analyzed based on the final agarose gel electrophoresis results. The knockout effect of the CBLB gene detected by the T7E1 endonuclease method is shown in Figure 6 , Figure 6 The results showed that a smaller band was cut out in the CBLB-KO group, while the control sample was not cut, indicating that the gene editing of the former CBLB-KO group was successful.

[0141] After successfully obtaining mixed clones or single clones, genomic DNA is extracted for Sanger sequencing to determine the knockout effect or type. Figure 5 , Figure 5 The results showed that the sequencing map had overlapping peaks near PAM, and there was a single clone with successful knockout in the mixed clones.

[0142] 3. Verification of the killing ability of CBLB gene knockout TCR-T cells

[0143] The effect of CBLB knockout on TCR-T cell function was reflected by detecting the continuous killing ability of TCR-T cells on tumor cells. TCR-T cells transduced with nonsense sgRNA were set as controls. The specific implementation steps are as follows:

[0144] Incubation of TCR-T cells with SW480-Luc-MAGOHB G17AThe cells were mixed at a ratio of 1:1, and the number of SW480-Luc cells in each well was 50,000. Cultured in a 96-well plate, GT-T551 H3 medium (source Takara, catalog number: #WK551S) was cultured overnight. On the third day, 150 μg / mL of luciferin (Novozyme, catalog number DD1210-03) was added to the culture supernatant, and after incubation for 1 minute, the luminescence intensity was detected using an enzyme reader (C1). Then, the same amount of SW480-Luc was added again and cultured overnight. On the fifth day, 150 μg / mL of luciferin (Novozyme, catalog number DD1210-03) was added to the culture supernatant, and after incubation for 1 minute, the luminescence intensity was detected using an enzyme reader (C2). The cell culture supernatant was collected and frozen at -80°C for use. The SW480-Luc cell single group was used as the initial value (C0) to calculate the mortality rate of tumor cells in each co-culture group.

[0145] The only difference between the SW480-Luc cell-alone group and the co-culture group was that the TCR-T cells and SW480-Luc cells mixed in a 1:1 ratio were replaced with 50,000 SW480-Luc cells.

[0146] The calculation formula is as follows:

[0147] 1 st Tumor cell mortality (%) = (C0-C1) / C0×100;

[0148] 2 nd Tumor cell death rate (%) = (C0-C2) / C0×100.

[0149] The results of tumor cell mortality after co-culture with TCR-T cells are shown in Figure 7 , Figure 7 Control TCR-T refers to TCR-T cells transduced with nonsense sgRNA, and CBLC-KO TCR-T refers to TCR-T cells with CBLB gene knockout. The results showed that compared with TCR-T cells transduced with nonsense sgRNA, the killing ability of TCR-T cells with CBLB gene knockout was significantly improved.

[0150] In addition, the secretion of cytokines was detected to determine the cytokine secretion capacity of TCR-T cells. The 14-factor joint detection kit (Baiwei Biotechnology, catalog number C6011) was used to detect the content of interferon γ, interleukin 2, interleukin 5, and interleukin 8 in the supernatant according to the instructions. The sampling time was consistent with the above two microplate reader detection of luminescence intensity. The results are shown in Figure 8-11 . Figure 8-11In the figure, control TCR-T refers to TCR-T cells transduced with nonsense sgRNA, and CBLC-KO TCR-T refers to TCR-T cells with CBLB gene knockout. The results showed that compared with TCR-T cells transduced with nonsense sgRNA, the levels of interferon-γ, interleukin-2, interleukin-5, and interleukin-8 in the supernatant of TCR-T cells with CBLB gene knockout were significantly increased, indicating that CBLB gene knockout significantly promoted TCR-T cell activation

[0151] IV. Verification of in vivo activity of CBLB gene knockout TCR-T cells

[0152] The inhibitory effect of TCR-T cells on tumors in mice was tested to reflect the effect of CBLB knockout on TCR-T cell function. TCR-T cells transduced with nonsense sgRNA were set as a control. The specific implementation steps are as follows:

[0153] The subcutaneous tumor-bearing model was established by selecting immunodeficient mice of the NCG strain (purchased from Guangdong Jicui Pharmaceutical Co., Ltd.). Five-week-old mice were subcutaneously inoculated with 2 million SW480-Luc-MAGOHB G17A Cells. The mice were randomly divided into three groups: CBLB knockout TCR-T cell treatment group, control TCR-T cell treatment group and no treatment group, with 3 mice in each group. Eight days after tumor inoculation, 5 million T cells were injected through the tail vein to start treatment. After 14 days of treatment, the mice were killed, the tumors were collected, weighed, and the tumor sizes of each group were compared. The results are shown in Fig.12 , Fig.12 In the table, untreated means no treatment group, control TCR-T means control TCR-T cell treatment group, and CBLC-KO TCR-T means CBLB knockout TCR-T cells. The experimental results show that the control TCR-T cells have basically no therapeutic effect, while the tumors of mice treated with CBLB gene knockout TCR-T cells are significantly reduced (see Fig.12 ).

[0154] Table 1: Sequences in this application

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experimental conditions, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In a word, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including departure from the disclosed scope in the present application and changes made with conventional techniques known in the art.

Claims

1. A method for modifying T cells, characterized in that: The method comprises knocking out or silencing a CBLB protein encoding gene in a target T cell to obtain a modified T cell, wherein the target T cell is an isolated T cell containing a CBLB protein encoding gene.

2. The method according to claim 1, characterized in that The silencing is achieved by introducing into the target T cells shRNA targeting the CBLB protein encoding gene, wherein the shRNA is transcribed from a DNA molecule having a nucleotide sequence of SEQ ID NO.3; The knockout is achieved by introducing a CRISPR / Cas system into the target T cells, wherein the CRISPR / Cas system includes a gRNA targeting the gene encoding the CBLB protein and an effector protein of the CRISPR / Cas system: Cas9 protein, and the target sequence of the gRNA is positions 1-20 of SEQ ID NO.

5.

3. The method according to claim 1 or 2, characterized in that: The method further comprises introducing a TCR encoding gene into the target T cell, wherein the TCR is a T cell antigen receptor.

4. A method for increasing T cell activity, characterized in that: The method comprises the step of down-regulating the expression of the CBLB protein encoding gene in the T cells or down-regulating the content of the CBLB protein in the T cells to achieve the purpose of increasing the activity of the T cells.

5. The method according to claim 4, characterized in that The down-regulation of the expression of the gene encoding the CBLB protein or the down-regulation of the content of the CBLB protein is achieved by gene silencing or gene knockout; The gene silencing is achieved by introducing into the T cells shRNA targeting the CBLB protein encoding gene, wherein the shRNA is transcribed from a DNA molecule having a nucleotide sequence of SEQ ID NO.3; The gene knockout is achieved by introducing a CRISPR / Cas system into the T cells, wherein the CRISPR / Cas system includes a gRNA targeting the gene encoding the CBLB protein and an effector protein of the CRISPR / Cas system: the Cas9 protein, and the target sequence of the gRNA is positions 1-20 of SEQ ID NO.

5.

6. Use of CBLB protein or a substance that regulates the expression of a gene encoding the CBLB protein or a substance that regulates the content of the CBLB protein in regulating T cell activity, wherein the substance is a biological material, and the biological material is any one of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the CBLB protein encoding gene of claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a ribonucleoprotein complex containing the nucleic acid molecule described in B1).

7. The use according to claim 6, characterized in that: The nucleic acid molecule is any of the following: G1), shRNA encoded by a DNA molecule having a nucleotide sequence of SEQ ID NO.3; G2), a DNA molecule whose nucleotide sequence is SEQ ID NO.3; G3), the target sequence is the gRNA of SEQ ID NO.5, positions 1-20; G4), the nucleotide sequence is an RNA molecule of SEQ ID NO.

5.

8. The biomaterial according to claim 6 or 7.

9. A recombinant T cell, characterized in that The recombinant cell is any of the following: A1), a recombinant T cell prepared by the method according to any one of claims 1 to 3; A2), the recombinant T cells do not contain CBLB protein encoding gene; A3), the recombinant T cells contain shRNA genes targeting CBLB protein encoding genes; A4), T cells containing the biomaterial according to claim 8.

10. The T cell according to claim 9, characterized in that The T cell is a T cell expressing a T cell receptor and / or the T cell is a T cell expressing a chimeric antigen receptor.

Images