A recombinant Streptomyces strain that enhances the synthesis of tetrahydropyrimidine and hydroxytetrahydropyrimidine and its application

By overexpressing the ectABCD and ectD genes in Streptomyces, recombinant strains were constructed, solving the problem of low degradation efficiency of agricultural waste by microorganisms, realizing the efficient degradation and resource utilization of agricultural waste, and producing high-value products.

CN119391788BActive Publication Date: 2025-10-31SOUTH CHINA UNIV OF TECH
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411382397.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2025-10-31
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

In existing technologies, microorganisms have low degradation efficiency for agricultural waste, which is difficult to meet the needs of industrial production. Traditional treatment methods have problems such as high energy consumption, environmental pollution and high cost. Enzymatic treatment is inefficient and costly, which limits the efficient utilization of agricultural waste.

Method used

By overexpressing the genes encoding tetrahydropyrimidine and hydroxytetrahydropyrimidine, ectABCD and ectD, in Streptomyces, a recombinant strain was constructed. Agricultural waste was used as the sole carbon and nitrogen source for fermentation, thereby improving the microbial degradation capacity of the waste.

Benefits of technology

It significantly enhances the ability of Streptomyces to synthesize tetrahydropyrimidine and hydroxytetrahydropyrimidine, enabling efficient degradation and resource utilization of agricultural waste, reducing water usage and drying costs, and the products can be used as animal feed and organic fertilizer. The process is simple and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391788B_ABST
    Figure CN119391788B_ABST
Patent Text Reader

Abstract

This invention discloses a recombinant Streptomyces strain with enhanced tetrahydropyrimidine and hydroxytetrahydropyrimidine synthesis capabilities and its applications. Using Streptomyces SCUT-1 as the starting strain, the invention utilizes the highly efficient promoter scutP1 to overexpress the genes encoding tetrahydropyrimidine and hydroxytetrahydropyrimidine synthesis. The recombinant strain exhibits significantly improved tetrahydropyrimidine and hydroxytetrahydropyrimidine synthesis capabilities and high osmotic pressure tolerance compared to the starting strain, Streptomyces SCUT-1. The degradation efficiency of the recombinant strain is also significantly enhanced, allowing direct fermentation using waste feathers, cottonseed meal, and shrimp shells as the sole carbon and nitrogen source. The yields of the highest soluble amino acids and peptides recovered are 2.15, 1.18, and 1.15 times that of the starting strain, respectively. This invention has significant implications for the high-value conversion of agricultural waste, eliminating the need for additional reducing agents and offering mild reaction conditions, which is of great value in reducing production costs and increasing yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a recombinant Streptomyces strain that enhances the synthesis of tetrahydropyrimidine and hydroxytetrahydropyrimidine, and its applications. Background Technology

[0002] Every year, global agricultural production generates a large amount of waste, including poultry feathers, shrimp shells, soybean meal, rice husks, and corn stalks. Statistics show that approximately 12 million tons of feathers, 8 million tons of shrimp shells, and over 300 million tons of soybean meal and straw are generated globally each year. These wastes are rich in protein, cellulose, chitin, and other components, possessing potential economic value. However, due to the difficulty in processing them and the immaturity of recycling technologies, the vast majority of agricultural waste is discarded, incinerated, or landfilled, leading to resource waste and environmental pollution.

[0003] In recent years, with increasing public awareness of environmental issues, many researchers have begun to explore the development and application of agricultural waste, such as using it as animal feed or organic fertilizer. Currently, traditional methods for treating agricultural waste mainly employ physical and chemical methods.

[0004] Physical methods of waste treatment require high energy consumption and have limited effectiveness, yielding only a single product and hindering efficient waste utilization. Chemical methods suffer from environmental pollution and high costs; the chemical reagents used can easily generate harmful byproducts, increasing the risk of secondary pollution, and the complex processes pose certain safety hazards. These factors limit the effectiveness of traditional treatment methods in large-scale agricultural waste treatment, driving the exploration of more environmentally friendly and efficient technologies. Biological methods offer mild reaction conditions and less secondary pollution, making them an environmentally friendly recycling approach. Biological methods include enzymatic hydrolysis and microbial degradation, utilizing enzymes produced by microorganisms or directly using microorganisms to treat agricultural waste, degrading materials rich in protein, cellulose, chitin, etc., into soluble peptides, amino acids, reducing sugars, chitosan oligosaccharides, etc. While enzymatic methods offer advantages in terms of being green and sustainable, enzyme production and purification costs are high, especially with significant increases in costs for large-scale applications. Furthermore, enzymatic treatment typically requires long reaction times and is less efficient when processing large volumes of waste, limiting their widespread application in agricultural waste treatment. Microbial fermentation is currently the fastest-growing and most promising method. This method primarily utilizes microorganisms such as bacteria and fungi to degrade agricultural waste. Compared to traditional treatment methods, microbial fermentation can efficiently degrade complex organic matter. The fermentation process typically takes place under mild conditions, requiring no high temperature, high pressure, or strong acids and alkalis, resulting in low energy consumption and environmental friendliness. Furthermore, valuable byproducts such as bio-fertilizers, enzymes, and antibiotics are produced during fermentation, further improving the resource utilization rate of waste. Finally, microbial fermentation is highly adaptable, capable of treating various types of agricultural waste, and its flexible process facilitates large-scale application. However, currently screened microorganisms have relatively low degradation efficiency for agricultural waste, failing to meet the demands of industrial production. Therefore, genetically modifying microorganisms to further enhance their degradation capabilities is crucial for achieving efficient and green recycling of agricultural waste in the future. Thus, it is necessary to obtain new microbial strains capable of efficiently degrading and recycling agricultural waste. Summary of the Invention

[0005] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide applications for the overexpression of genes encoding synthetic tetrahydropyrimidine and hydroxytetrahydropyrimidine.

[0006] Another object of the present invention is to provide recombinant bacteria that overexpress genes encoding the synthesis of tetrahydropyrimidine and hydroxytetrahydropyrimidine, and their applications.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] Application of overexpression of genes encoding tetrahydropyrimidine and / or genes encoding hydroxytetrahydropyrimidine in promoting the synthesis of tetrahydropyrimidine and hydroxytetrahydropyrimidine in Streptomyces.

[0009] Furthermore, the gene encoding the synthesized tetrahydropyrimidine includes ectA, ectB and ectC At least one of the following; the gene encoding the synthetic hydroxytetrahydropyrimidine is ectD .

[0010] Furthermore, the gene encoding tetrahydropyrimidine... ectA The sequence is as shown in SEQ ID No. 1:

[0011] .

[0012] Furthermore, the gene encoding tetrahydropyrimidine... ectB The sequence is as shown in SEQ ID No. 2:

[0013]

[0014] Furthermore, the gene encoding tetrahydropyrimidine... ectC The sequence is as shown in SEQ ID No. 3:

[0015] GTGATCGTTCGTTCCTTCAAGGACATCGAGGGCACCGACCGCGACGTGACCGCCGAGACCGGCACCTGGCGCAGCAAGCGCATCGTCCTGGCAAAGGAGGGCGTGGGCTTCTCCCTGCACGAGACGGTGATGTACGCGGGCACCGAGACCTCCATGTGGTACGCCAACCACTACGAGGCGGTGCTGTGCGTCGAGGGCGAGGGGGAGCTGACCAACGACGAGACC GGCGAGAAGCACTGGATCTCCCCCGGCACCATGTACCTGCTCGACGGCCACGAGAAGCACGATGCGGCCCAAGACGGACCTGCGCTTCGTCTGCGTGTTCAACCCCCCGGTCACCGGCCGCGAGGTCCACGACGAGAACGGCGTGTACCCCCTGCTGACCGAGCCCCTTCCCGAGCGGCCGAGGCCGCTGCGGCGCACGCCGCGGAGGCCGCCTCCGCCTGA.

[0016] Furthermore, the gene encoding the synthesis of hydroxytetrahydropyrimidine... ectD The sequence is ectD (As shown in SEQ ID No. 4):

[0017] ATGACCACGGCACCCGAACGCATCGCGGACCTGTATCCCACCCGTGGCACGAGCGAGGTGCTGACCGCCCGACAGGACCCGGTCGTCTGGTCCGCCCCGGGCACCCCCGGCCCCGTCTCCCCGGAGGACCTGGCCGGCTTCGAGCACGACGGCTTCCTCACCGTCGACCGGCTCCTCGCCCCCGACGAGGTCGCCCGCTACAAGGCCGAGCTCGACCGCCTGTGCGCCGACCCCGTCATGCGGGCCGACGAGCGCTCCGTCGTGGAGCCCAAGTCCGAGTCGATCCGCTCGATCTTCGAGATCCACAAGGTCAGCGAGGTCTTCGCCGAGCTGGTCAGCGACCCCCGCGTCCTCGACCGCGCCCGGCAGATCCTCGGCTCCGACGTCTACGTCCACCAGAGCCGCGTCAACGTCAAGCCCGGTTTCGGCGCCAGCGGCTTCTACTGGCACTCCGACTTCGAGACCTGGCACGCCGAGGACGGCCTGCCCCGCATGCGCACCGTCTCGATCTCCATCGCGCTGACCGAGAACCTGCCCACCAACGGCGGGCTGATGATCATGCCGGGCTCCCACAGGACCTTCGTCGGCTGCGCGGGCGAGACCCCCCGGGACAACTACAAGAAGTCCCTGCAGATGCAGGACGCCGGCACCCCCTCCGACGAGGCCCTGACGAGGATGGCCGACGCCCACGGCATCCGCCTGTTCACCGGCCCCGCCGGCTCGGCCACGATGTTCGACTGCAACGCCATGCACGGCTCCGGCGACAACATCACGCCCTACCCGCGCAGCAACGTCTTCATCGTCTTCAACAGCGTCGAGAACGCCGCGGTCGAACCCTTCGCCGCCCCTGTGCGCAGGCCCGAGTTCATCGGCGCCCGCGACTTCACCCCCGTCAGCCGCAAGGCCTGA。

[0018] Furthermore, the overexpression of the coding gene for synthesizing ectoine and / or the overexpression of the coding gene for synthesizing hydroxyectoine is: gene ectABCD Overexpressed and geneectD overexpression , The aforementioned gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence.

[0019] Furthermore, the Streptomyces mentioned includes Streptomyces SCUT-1.

[0020] Gene ectABCD Overexpression and gene ectD Application of overexpression in improving the tolerance of Streptomyces to hyperosmolar environments.

[0021] Furthermore, the aforementioned gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence.

[0022] Furthermore, the aforementioned gene ectD The sequence is shown in SEQ ID No. 4.

[0023] Furthermore, the Streptomyces mentioned includes Streptomyces SCUT-1.

[0024] Application of overexpression of genes encoding synthetic tetrahydropyrimidine and / or genes encoding synthetic hydroxytetrahydropyrimidine in enhancing the ability of Streptomyces to degrade agricultural waste.

[0025] Furthermore, the gene encoding the synthesized tetrahydropyrimidine includes... ectA, ectB and ectC At least one of the following; the gene encoding the synthetic hydroxytetrahydropyrimidine is ectD Furthermore, the aforementioned ectA The sequence is shown in SEQ ID No. 1. ectB The sequence is shown in SEQ ID No. 2. ectC The sequence is shown in SEQ ID No. 3, and the... ectD The sequence is shown in SEQ ID No. 4;

[0026] Furthermore, the overexpression of the gene encoding the synthetic tetrahydropyrimidine and / or the gene encoding the synthetic hydroxytetrahydropyrimidine refers to: gene ectABCD Overexpression and gene ectD overexpression , The aforementioned gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence.

[0027] Furthermore, the Streptomyces mentioned includes Streptomyces SCUT-1.

[0028] Furthermore, the degradation of agricultural waste involves degrading biomass into amino acids and polypeptides; even further, the biomass includes at least one of feathers, cottonseed meal, and shrimp shells.

[0029] Gene ectABCD Application of overexpressed Streptomyces in the degradation of agricultural waste.

[0030] Furthermore, the aforementioned gene ectABCD The original strains of Streptomyces overexpressed include Streptomyces SCUT-1.

[0031] Furthermore, the aforementioned gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence.

[0032] Furthermore, the overexpression described above is performed using the overexpression promoter scutP1, and the nucleic acid sequence of the promoter scutP1 is (as shown in SEQ ID No. 5):

[0033] CGGCCCCTGAGCACGAAGTAGGCGCCGACGGCCAGCAGCAGCTGCGCCCAGGCCGCCAGGAGCACCAGTCCCCGGTCCGCCATCGTCCGCCCTCCGCCCTTGCCTCCGTGTGGGCGGCCGCCTACCCCGGCCCCCGCGTCCGGATGCGCGGCGGCCGGCAGGCACCCGTCCGGTGTGCGGCCGGGCGGGGGGCCGTCCCGCCGGGCGGGGGCCGTCCCGCCG GGCGGGGCCCGGGTCCTACCACTCCGGGGGCGTGGATTTTCGGACGTTTCCCGCCGGGCGAGGGGGTACGGCGCCCGCGGGCCCGGCCCACCCCTATGCTTCTACATGTCTGTAGAAACAAGCGAGGGCGGTGCGGGCCTCCCCTGCCGTCCTGCGGGACGCGGTCGTCCGGCCCGGCCGGGCCCCGGCCCGCACCTCTCTCTTTCGCATTCGTCCCCGGAAGGACCGTC.

[0034] Furthermore, the degradation of agricultural waste involves degrading biomass into amino acids and polypeptides; even further, the biomass includes at least one of feathers, cottonseed meal, and shrimp shells.

[0035] Gene ectABCD Overexpression and gene ectD Application of overexpressed Streptomyces in the degradation of agricultural waste.

[0036] Furthermore, the aforementioned gene ectABCD The original strains of Streptomyces overexpressed include Streptomyces SCUT-1.

[0037] Furthermore, the aforementioned gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence.

[0038] Furthermore, the aforementioned gene ectD The sequence is shown in SEQ ID No. 4.

[0039] Furthermore, the overexpression described above is performed using the overexpression promoter scutP1.

[0040] Furthermore, the degradation of agricultural waste involves degrading biomass into amino acids and polypeptides; even further, the biomass includes at least one of feathers, cottonseed meal, and shrimp shells.

[0041] A recombinant Streptomyces strain containing a recombinant vector; the recombinant vector contains the promoter scutP1; the recombinant vector also contains a gene. ectABCD .

[0042] Furthermore, the aforementioned gene ectABCD The sequence is SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence;

[0043] Furthermore, the recombinant vector also contains genes. ectD The aforementioned gene ectD The sequence is shown in SEQ ID No. 4;

[0044] Furthermore, the nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No. 5.

[0045] Furthermore, in the recombinant vector, the nucleic acid sequence of the promoter scutP1 is linked to the gene. ectABCD Furthermore, in the recombinant vector, the nucleic acid sequence of the promoter scutP1 is linked to the gene. ectABCDThe sequence is then linked to the nucleic acid sequence of the promoter scutP1 and the gene. ectD sequence.

[0046] Furthermore, the original strain of the recombinant Streptomyces includes Streptomyces SCUT-1.

[0047] The application of the above-mentioned recombinant Streptomyces strain in the degradation of agricultural waste.

[0048] The above-mentioned application in the degradation of agricultural waste includes the following steps:

[0049] Inoculate the above-mentioned bacteria into the fermentation medium and allow fermentation;

[0050] The fermentation medium described uses agricultural waste as the sole source of carbon and nitrogen.

[0051] Furthermore, the fermentation medium includes agricultural waste; even further, the agricultural waste includes at least one of feathers, cottonseed meal, and shrimp shells. Even further, the fermentation medium also includes water.

[0052] Furthermore, the fermentation conditions are: 30–45°C, 150–250 rpm, and a culture time of 72–120 h. Preferably, it is 40°C, 220 rpm, and a culture time of 72 h.

[0053] Furthermore, the bacteria are cultured in seed culture medium, that is, inoculated into a seed culture medium to obtain seed culture.

[0054] Furthermore, the seed culture medium comprises the following components: 10.0 g / L tryptone, 10.0 g / L sodium chloride, and 5.0 g / L yeast extract.

[0055] Furthermore, the inoculation volume of the seed liquid is 1% of the fermentation medium volume.

[0056] The present invention has the following advantages and effects compared with the prior art:

[0057] (1) This invention uses the endogenous high-efficiency promoter scutP1 of the starting strain Streptomyces SCUT-1 to construct two recombinant Streptomyces strains that overexpress tetrahydropyrimidine and hydroxytetrahydropyrimidine through genetic engineering. Compared with the starting strain, the recombinant strains have significantly improved ability to synthesize tetrahydropyrimidine and hydroxytetrahydropyrimidine.

[0058] (2) The recombinant Streptomyces strain constructed in this invention can ferment agricultural waste in a fermentation medium with lower moisture content, which can reduce the amount of water used and reduce the time and cost of drying fermentation products.

[0059] (3) This invention uses agricultural waste as the sole carbon and nitrogen source to prepare a fermentation medium. The agricultural waste is degraded through microbial degradation to recover soluble amino acids and peptides, while also synthesizing higher-value tetrahydropyrimidine and hydroxytetrahydropyrimidine. It has advantages such as being green and efficient, realizing the high-value conversion of inexpensive waste.

[0060] (4) This invention does not require complex pretreatment processes, separate enzyme preparation processes, or the use of reducing agents, acids, bases or other toxic chemical reagents. It has the advantages of mild reaction conditions, simple process, low cost and green environmental protection.

[0061] (5) The fermentation products prepared by this invention can be used as high-quality raw materials for animal feed, plant organic fertilizer and other products, and can be applied in agricultural production. Attached Figure Description

[0062] Figure 1 This is the diagram of the recombinant vector pSET152-scutP1-ectABCD.

[0063] Figure 2 This is a diagram of the recombinant vector pSET152-scutP1-ectD.

[0064] Figure 3 The image shows the recombinant vector pSET152-scutP1-ectABCD-scutP1-ectD.

[0065] Figure 4 This is a comparison chart of the tetrahydropyrimidine and hydroxytetrahydropyrimidine contents measured in LB medium by the starting strain Streptomyces SCUT-1 and the recombinant strains SCUT-ectABCD and SCUT-ectABCD-ectD.

[0066] Figure 5 This is a comparison of the growth curves of the starting strain *Streptomyces SCUT-1* and the recombinant strain *SCUT-ectABCD-ectD* in LB medium with different sodium chloride concentrations, and the measured contents of tetrahydropyrimidine and hydroxytetrahydropyrimidine.

[0067] Figure 6 This is a comparison chart of the amino acid and peptide recoveries, as well as the tetrahydropyrimidine and hydroxytetrahydropyrimidine contents in the fermentation products, of the starting strain Streptomyces SCUT-1 and the recombinant strain SCUT-ectABCD-ectD in feather medium with different solid-liquid ratios during solid-state fermentation. Detailed Implementation

[0068] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available.

[0069] Example 1

[0070] Construction of recombinant Streptomyces strains with overexpression of the genes encoding synthetic tetrahydropyrimidine and hydroxytetrahydropyrimidine, and with overexpression of both the genes encoding synthetic tetrahydropyrimidine and hydroxytetrahydropyrimidine.

[0071] 1. Culture of Streptomyces SCUT-1

[0072] A suitable amount of Streptomyces sp. SCUT-1 was inoculated onto solid Gao's No. 1 medium plates (solid Gao's No. 1 medium consists of the following components: 20 g soluble starch, 1 g potassium nitrate, 0.5 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.5 g sodium chloride, 0.01 g ferrous sulfate heptahydrate, 20 g agar powder, and 1 L distilled water), and cultured at 37 ℃ for 5-7 days until gray-green spores were produced. The Streptomyces sp. SCUT-1 strain, with accession number GDMCCNo: 60612, was deposited on March 20, 2019, at the Guangdong Provincial Microbial Culture Collection Center, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and has been disclosed in Chinese invention patent application CN201910491700.8.

[0073] 2. Extraction of genomic DNA from Streptomyces SCUT-1

[0074] (1) Use an inoculation loop to pick up the spores of Streptomyces SCUT-1 obtained in step 1 and inoculate them into the seed culture medium (the seed culture medium consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water), and culture at 37 ℃ and 220 rpm for 24 h with shaking to obtain the Streptomyces SCUT-1 seed culture.

[0075] (2) Take 1 mL of Streptomyces SCUT-1 seed liquid and use a soil genomic DNA rapid extraction kit (purchased from Sangon Biotech Co., Ltd.) to extract genomic DNA. The extraction steps are performed according to the standard procedure in the kit's instructions.

[0076] 3. Preparation of Streptomyces SCUT-1 spore preservation solution

[0077] Using an inoculation loop, pick up the spores of Streptomyces SCUT-1 obtained in step 1 and inoculate them into the spore preservation medium (the spore preservation medium consists of the following components: 16 g tryptone, 10 g yeast extract, 5 g sodium chloride and 1 L distilled water), and store at 4°C for 5-7 days to obtain the SCUT-1 spore preservation solution.

[0078] 4. Construction of recombinant vectors pSET152-scutP1-ectABCD, pSET152-scutP1-ectD, and pSET152-scutP1-ectABCD-scutP1-ectD: The pSET152-scutP1 plasmid (the construction of pSET152-scutP1 has been disclosed in the patent "A promoter for overexpressing a protease, a recombinant Streptomyces strain and its construction method and application, publication number: CN 115927332A") was treated with NdeI restriction endonuclease and purified to obtain the linearized pSET152-scutP1 vector.

[0079] Using the Streptomyces SCUT-1 genome as a template, primers ectA-Fw (5'- CGGAAGGACCGTC CAATGACCGCCGCACAAGCTGAAC-3' (underlined portion indicates homologous fragments required for seamless cloning) and ectD-Rv (5'- TC TAGAGGATCCCCAACA The fragment ectABCD (TCAGGCCTTGCGGCTGAC-3') (the underlined part indicates the homologous fragment required for seamless cloning ligation) was obtained by PCR amplification and purification.

[0080] Using the Streptomyces SCUT-1 genome as a template, primers ectD-Fw (5'- CGGAAGGACCGTC CAATGACCACGGCACCCGAA' (underlined part indicates homologous fragments required for seamless cloning ligation) and ectD-Rv (5'- TCTAGAG GATCCCCAACA The ectD fragment (TCAGGCCTTGCGGCTGAC-3') (the underlined part indicates the homologous fragment required for seamless cloning ligation) was obtained by PCR amplification and purification.

[0081] The pSET152-scutP1 linearized vector was seamlessly cloned and ligated with the ectABCD and ectD fragments, respectively. The ligation reagent used was the TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (purchased from Beijing Qingke Biotechnology Co., Ltd.). The ligation reaction system is shown in Table 1.

[0082] Table 1. Connection Reaction System

[0083]

[0084] The ligation product was transformed into *E. coli* DH5α. Single colonies were picked from LB agar plates containing apramycin (LB agar plates containing apramycin consist of 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 20 g agar powder, and 1 L distilled water), plasmids were extracted, and sequencing was performed to verify the results, yielding the recombinant vectors pSET152-scutP1-ectABCD and pSET152-scutP1-ectD. (A schematic diagram of the recombinant vectors is shown below.) Figures 1 - 2 As shown, the pSET152-scutP1-ectABCD plasmid was treated with XbaI restriction endonuclease and purified to obtain the linearized pSET152-scutP1-ectABCD vector.

[0085] Using the recombinant vector pSET152-scutP1-ectD as a template, primers scutP1-Fw (5'-) were designed. GGTCGACTCGG TACCA CGGCCCCTGAGCACGAA' (the underlined part indicates the homologous fragment required for seamless cloning ligation) and ectD-Rv (5'- TCTAGAGGATCCCCAACA The scutP1-ectD fragment (TCAGGCCTTGCGGCTGACG-3') (the underlined part indicates the homologous fragment required for seamless cloning ligation) was amplified by PCR and purified to obtain the fragment.

[0086] The linearized pSET152-scutP1-ectABCD vector was seamlessly cloned and ligated with the scutP1-ectD fragment. The ligation reagent used was the TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (purchased from Beijing Qingke Biotechnology Co., Ltd.). The ligation reaction system is shown in Table 2.

[0087] Table 2. Connection Reaction System

[0088]

[0089] The ligation product was transformed into *E. coli* DH5α. Single colonies were picked from LB agar plates containing apramycin (LB agar plates containing apramycin consist of 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 20 g agar powder, and 1 L distilled water), plasmids were extracted, and sequencing was performed to obtain the recombinant vector pSET152-scutP1-ectABCD-scutP1-ectD. (A schematic diagram of the recombinant vector is shown below.) Figure 3 (As shown)

[0090] 5. Construction of recombinant Streptomyces strains

[0091] The recombinant vectors pSET152-scutP1-ectABCD and pSET152-scutP1-ectABCD-scutP1-ectD obtained in step 4 were electroporated into the host Escherichia coli ET12567 / pUZ8002 to obtain the transformed E. coli strains ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD. The above-mentioned E. coli strains were inoculated into LB medium containing apramycin, chloramphenicol, and kanamycin (the LB medium containing apramycin, chloramphenicol, and kanamycin consisted of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 25 mg chloramphenicol, 50 mg kanamycin, and 1 L distilled water) and cultured at 37°C and 220 rpm for 16 h with shaking. Take 4 mL of the culture medium containing ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD, centrifuge at 6000×g for 2 min, and remove the supernatant. Resuspend the cells in 2 mL of fresh LB medium, centrifuge at 6000×g for 2 min, and remove the supernatant to remove antibiotics from the culture.

[0092] Take 100 μL of the spore preservation solution of Streptomyces SCUT-1 prepared in step 3, which was stored at 4℃, and incubate it at 50℃ for 10 min. Then, mix it evenly with the collected Escherichia coli transformed strains ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD, and spread it on solid MS medium plates (the solid MS medium consists of the following components: 20 g mannitol, 20 g soybean powder, 10 mM magnesium chloride, 20 g agar powder and 1 L distilled water), and incubate it upside down at 30℃ for 16 h.

[0093] Remove the MS agar plates after culturing. Take another 1 mL of an aqueous solution containing apramycin and naphthylpyrrolidone (the aqueous solution containing apramycin and naphthylpyrrolidone consists of: 1 mg apramycin, 0.5 mg naphthylpyrrolidone, and 1 mL sterile water) and evenly spread it on the MS agar plate. After the plates are thoroughly dried, incubate them at 37°C for 3–5 days. Once distinct single colonies have grown on the MS agar plates, use an inoculation needle to pick a single colony and transfer it to a seed culture medium containing apramycin and naphthylpyrrolidone (the seed culture medium containing apramycin and naphthylpyrrolidone consists of: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 25 mg naphthylpyrrolidone, and 1 L distilled water). Incubate at 37°C with shaking at 220 rpm for 48 h. Take 1 mL of the cultured bacterial solution and extract genomic DNA using a soil genomic DNA rapid extraction kit (purchased from Sangon Biotech Co., Ltd.). The extraction procedure should be performed according to the standard procedure in the kit's instructions. Use universal primers.

[0094] M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3') and

[0095] M13-48 (5'-AGCGGATAACAATTTCACACAGGA-3'),

[0096] Using the extracted genomic DNA as a template, PCR verification yielded recombinant Streptomyces strains, named SCUT-OectABCD and SCUT-OectABCD-OectD. SCUT-OectABCD and SCUT-OectABCD-OectD were obtained by conjugating Escherichia coli transformed strains ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD with SCUT-1, respectively.

[0097] Example 2

[0098] Assessment of the ability of recombinant Streptomyces strains SCUT-OectABCD and SCUT-OectABCD-OectD to produce tetrahydropyrimidine and hydroxytetrahydropyrimidine:

[0099] (1) The starting strain Streptomyces SCUT-1, the recombinant strains SCUT-OectABCD and SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed culture medium (the seed culture medium consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water) and cultured at 37°C and 220 rpm for 24 h with shaking to obtain the seed culture of Streptomyces SCUT-1, the seed culture of recombinant strain SCUT-OectABCD and the seed culture of recombinant strain SCUT-OectABCD-OectD.

[0100] (2) The seed cultures of Streptomyces SCUT-1, recombinant strain SCUT-OectABCD, and recombinant strain SCUT-OectABCD-OectD were transferred to the fermentation medium (which consisted of 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, and 1 L distilled water) at 40 °C and 220 rpm for 48 h with shaking. The cultures were centrifuged at 12000 × g and 4 °C for 5 min, and the supernatant fermentation broth and bacterial cells were collected for determination of tetrahydropyrimidine and hydroxytetrahydropyrimidine content, respectively.

[0101] (3) The specific steps for determining the content of tetrahydropyrimidine and hydroxytetrahydropyrimidine are as follows:

[0102] Supernatant treatment method: Take 200 µL of the collected Streptomyces SCUT-1, recombinant strain SCUT-OectABCD, and recombinant strain SCUT-OectABCD-OectD supernatant fermentation broth, mix thoroughly with 800 µL of anhydrous ethanol, filter through a 0.22 µm organic filter membrane, and store at 4℃.

[0103] Cell processing method: Resuspend Streptomyces SCUT-1, recombinant strain SCUT-OectABCD, and recombinant strain SCUT-OectABCD-OectD in 1 mL of 80% ethanol, shake in a shaker at 220 rpm and 37℃ for 1 h, then centrifuge at 12000 rpm for 3 min, collect the supernatant, filter through a 0.22 µm organic filter membrane, and store at 4℃.

[0104] The contents of tetrahydropyrimidine and hydroxytetrahydropyrimidine in the fermentation broth were detected using a Vertex™ NH2 (4.6×250 mm, 5 µm) liquid chromatography column. A UV detector was selected, and 70% acetonitrile was chosen as the mobile phase. The column temperature was 30℃, the detection wavelength was 210 nm, and the flow rate was 1.0 mL / min.

[0105] The yields of tetrahydropyrimidine and hydroxytetrahydropyrimidine of the starting strain SCUT-1, recombinant strain SCUT-OectABCD, and recombinant strain SCUT-OectABCD-OectD are as follows: Figure 4 As shown in the figure. The results showed that the tetrahydropyrimidine and hydroxytetrahydropyrimidine yields of *Streptomyces SCUT-1* were 67.4 mg / L and 59.3 mg / L, respectively; the tetrahydropyrimidine and hydroxytetrahydropyrimidine yields of the recombinant strain SCUT-OectABCD were 250.7 mg / L and 269.0 mg / L, respectively, which were 3.7 times and 4.5 times that of the original strain; the tetrahydropyrimidine and hydroxytetrahydropyrimidine yields of the recombinant strain SCUT-OectABCD-OectD were 101.3 mg / L and 513.8 mg / L, respectively, which were 1.5 times and 8.7 times that of the original strain. The recombinant strain SCUT-OectABCD-OectD had the highest combined tetrahydropyrimidine and hydroxytetrahydropyrimidine yields, and this strain was selected for subsequent applications.

[0106] Example 3

[0107] Assessment of the high osmotic pressure resistance of the recombinant Streptomyces strain SCUT-OectABCD-OectD:

[0108] (1) The starting strain Streptomyces SCUT-1 and the recombinant strain SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed culture medium (the seed culture medium consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water) and cultured at 37°C and 220 rpm for 24 h with shaking to obtain the seed culture of Streptomyces SCUT-1 and the seed culture of recombinant strain SCUT-OectABCD-OectD.

[0109] (2) The Streptomyces SCUT-1 seed culture and the recombinant strain SCUT-OectABCD-OectD seed culture were transferred to a new LB medium at an inoculation rate of 1% of the volume of the LB medium (the LB medium consisted of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water), and cultured at 40°C and 220 rpm for 12 h with shaking. The culture was centrifuged at 5000 rpm and 4°C for 5 min, and after removing the supernatant, the cells were rinsed twice with 1×PBS (the 1×PBS consisted of the following components: 8 g sodium chloride, 0.2 g potassium chloride, 1.44 g disodium hydrogen phosphate, 0.24 g potassium dihydrogen phosphate and 1 L distilled water). After rinsing, the bacterial culture was centrifuged at 5000 rpm and 4℃ for 5 min, and the supernatant was removed. Streptomyces SCUT-1 and recombinant strain SCUT-OectABCD-OectD were each transferred to LB medium containing 1.0% sodium chloride, 5.0% sodium chloride, and 7.5% sodium chloride (LB medium consisted of 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, and 1 L distilled water). The cultures were incubated at 40℃ and 220 rpm with shaking for 6 days. Each day, 1 mL of the bacterial culture was centrifuged at 12000 × g and 4℃ for 5 min. The supernatant fermentation broth and bacterial cells were collected for tetrahydropyrimidine and hydroxytetrahydropyrimidine content determination, respectively. Separately, 100 µL of the bacterial culture was mixed with 100 µL of water in a 96-well ELISA plate, and the absorbance was measured at 600 nm using an ELISA reader.

[0110] (3) For the specific steps of determining the content of tetrahydropyrimidine and hydroxytetrahydropyrimidine, please refer to Example 2;

[0111] The growth curves of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD, and the yields of tetrahydropyrimidine and hydroxytetrahydropyrimidine are shown below. Figure 5As shown in the figure. The results indicated that the growth of both *Streptomyces SCUT-1* and the recombinant strain SCUT-OectABCD-OectD was inhibited with increasing sodium chloride concentration in the culture medium, but the recombinant strain SCUT-OectABCD-OectD exhibited better salinity tolerance than *Streptomyces SCUT-1*. The recombinant strain SCUT-OectABCD-OectD reached the stationary phase faster than *Streptomyces SCUT-1* in LB medium with 5.0% sodium chloride, and also recovered to the stationary phase in LB medium with 7.5% sodium chloride, where *Streptomyces SCUT-1* could not grow normally. Furthermore, the hydroxytetrahydropyrimidine yields of recombinant strain SCUT-OectABCD-OectD after 6 days of culture in LB media containing 1.0% sodium chloride, 5.0% sodium chloride, and 7.5% sodium chloride were 102.8 mg / L, 197.3 mg / L, and 132.5 mg / L, respectively, which were significantly higher than those of Streptomyces SCUT-1 (11.8 mg / L, 111.6 mg / L, and 7.8 mg / L).

[0112] Example 4

[0113] Assessment of the ability of the recombinant Streptomyces strain SCUT-OectABCD-OectD to degrade feathers through solid-state fermentation:

[0114] (1) The starting strain Streptomyces SCUT-1 and the recombinant strain SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed culture medium (the seed culture medium consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water) and cultured at 37°C and 220 rpm for 24 h with shaking to obtain the seed culture of Streptomyces SCUT-1 and the seed culture of recombinant strain SCUT-OectABCD-OectD.

[0115] (2) The Streptomyces SCUT-1 seed culture and the recombinant strain SCUT-OectABCD-OectD seed culture were inoculated into fermentation media with material-to-liquid ratios of 1:2.0, 1:1.75, 1:1.5, 1:1.25, 1:1.0, and 1:0.75, respectively, at an inoculation rate of 10% of the solid mass of the fermentation medium (the fermentation medium consisted of the following components: 12 g of dried feathers, and 24 g, 21 g, 18 g, 15 g, 12 g, and 9 g of distilled water, respectively), and cultured statically at 40℃ for 5 days. After fermentation, the culture was dried in a 65℃ oven to constant weight. Then, the dried fermentation product was dissolved in distilled water at a ratio of 1:20 and shaken at 37℃ and 220 rpm for 2 hours. It was then centrifuged at 4℃ and 12000 ×g for 5 minutes. The supernatant fermentation broth was collected for determination of amino acid, soluble polypeptide, tetrahydropyrimidine, and hydroxytetrahydropyrimidine content.

[0116] (3) The specific steps for determining the amino acid content are as follows:

[0117] Take 200 μL of supernatant fermentation broth into a centrifuge tube, add 50 μL of solution A, then add 50 μL of solution B, mix well, and react at 90 ℃ for 30 min. After the reaction, cool in a 25 ℃ water bath, add 950 μL of distilled water, mix well, and let stand for 5 min. Then take 200 μL and measure the absorbance at 570 nm using a 96-well microplate reader. Calculate the measured OD value... 570 Substitute the values ​​into the standard curve to calculate the amino acid content. The standard curve is prepared by dissolving isoleucine powder in distilled water to prepare standard solutions with concentrations of 0, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, and 350 μg / mL, and constructed using the same assay method as the sample to be tested.

[0118] The preparation steps of solution A are as follows: Weigh 0.0907 g of potassium dihydrogen phosphate trihydrate and 4.5364 g of disodium hydrogen phosphate dodecahydrate and add them to a 200 mL volumetric flask, then add distilled water to make up to 200 mL.

[0119] The preparation steps of solution B are as follows: Weigh 1g of ninhydrin into a beaker containing 70 mL of hot water to dissolve it, add 80mg of stannous chloride, filter, take the filtrate into a 100 mL volumetric flask and add distilled water to make up to 100 mL.

[0120] (4) The specific steps for determining the content of soluble polypeptides are as follows:

[0121] The assay was performed using the TaKaRa BCA Protein Assay Kit (purchased from Bao Ri Medical Biotechnology Co., Ltd.), following the standard procedure outlined in the kit's instruction manual.

[0122] (5) For the specific steps of determining the content of tetrahydropyrimidine and hydroxytetrahydropyrimidine, please refer to Example 2;

[0123] The amino acid and peptide recoveries of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD from the solid-state fermentation of feathers are as follows: Figure 6As shown in the figure. The results showed that the amino acid recoveries of the starting strain SCUT-1 in fermentation media with material-to-liquid ratios of 1:2.0, 1:1.75, 1:1.5, 1:1.25, 1:1.0, and 1:0.75 were 0.074 g / g, 0.113 g / g, 0.052 g / g, 0.026 g / g, 0.025 g / g, and 0.022 g / g, respectively; the soluble polypeptide recoveries were 0.315 g / g, 0.363 g / g, 0.278 g / g, 0.185 g / g, 0.184 g / g, and 0.178 g / g, respectively; and the total recoveries of amino acids and soluble polypeptides were 0.389 g / g, 0.476 g / g, 0.330 g / g, 0.211 g / g, 0.209 g / g, and 0.200 g / g, respectively. The amino acid recoveries of the recombinant strain SCUT-OectABCD-OectD were 0.172 g / g, 0.173 g / g, 0.131 g / g, 0.094 g / g, 0.055 g / g, and 0.040 g / g, respectively; the soluble polypeptide recoveries were 0.436 g / g, 0.510 g / g, 0.418 g / g, 0.360 g / g, 0.220 g / g, and 0.202 g / g, respectively; and the total recoveries of amino acids and soluble polypeptides were 0.608 g / g, 0.683 g / g, 0.549 g / g, 0.454 g / g, 0.275 g / g, and 0.24 g / g, respectively. These total recoveries were 1.56, 1.43, 1.66, 2.15, 1.32, and 1.20 times that of the original strain SCUT-1, respectively.

[0124] The tetrahydropyrimidine and hydroxytetrahydropyrimidine contents of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD solid-state fermentation feathers are as follows: Figure 6 As shown in the figure. The results showed that the total amount of tetrahydropyrimidine and hydroxytetrahydropyrimidine in the fermentation medium of the starting strain SCUT-1 in the fermentation medium with material-to-liquid ratios of 1:2.0, 1:1.75, 1:1.5, 1:1.25, 1:1.0, and 1:0.75 was 1.90 g / kg, 2.11 g / kg, 2.12 g / kg, 2.09 g / kg, 0.98 g / kg, and 0.13 g / kg, respectively; while the total amount of tetrahydropyrimidine and hydroxytetrahydropyrimidine in the recombinant strain SCUT-OectABCD-OectD was 4.90 g / kg, 6.36 g / kg, 5.08 g / kg, 4.40 g / kg, 1.65 g / kg, and 1.89 g / kg, respectively, and the total yield was 2.58, 3.01, 2.40, 2.11, 1.68, and 14.54 times that of the starting strain SCUT-1.

[0125] Example 5

[0126] Assessment of the ability of the recombinant Streptomyces strain SCUT-OectABCD-OectD to degrade cottonseed meal and shrimp shells through solid-state fermentation:

[0127] (1) The starting strain Streptomyces SCUT-1 and the recombinant strain SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed culture medium (the seed culture medium consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water) and cultured at 37°C and 220 rpm for 24 h with shaking to obtain the seed culture of Streptomyces SCUT-1 and the seed culture of recombinant strain SCUT-OectABCD-OectD.

[0128] (2) The Streptomyces SCUT-1 seed culture and the recombinant strain SCUT-OectABCD-OectD seed culture were inoculated at 10% of the solid mass of the fermentation medium into cottonseed meal fermentation medium with a material-to-liquid ratio of 1:1.5 (the cottonseed meal fermentation medium consists of 12 g cottonseed meal and 18 g distilled water) and shrimp shell fermentation medium with a material-to-liquid ratio of 1:4.0 (the shrimp shell fermentation medium consists of 10 g shrimp shell and 40 g distilled water), respectively, and were cultured at 40℃ for 3 days and 5 days, respectively. After fermentation, the cultures were dried in a 65℃ oven to constant weight. Then, the dried fermentation products were dissolved in distilled water at a ratio of 1:20 and shaken at 37℃ and 220 rpm for 2 h. After that, the cultures were centrifuged at 4℃ and 12000 ×g for 5 min. The supernatant fermentation broth was collected for determination of amino acid, soluble polypeptide, tetrahydropyrimidine, and hydroxytetrahydropyrimidine content.

[0129] (3) The specific steps for determining the amino acid content and soluble polypeptide content are given in Example 4;

[0130] (4) For the specific steps of determining the content of tetrahydropyrimidine and hydroxytetrahydropyrimidine, please refer to Example 2;

[0131] The results of the determination of amino acid and peptide recovery in solid-state fermentation of cottonseed meal and shrimp shells by the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD showed that the amino acid recovery of the starting strain SCUT-1 in the cottonseed meal fermentation medium with a material-to-liquid ratio of 1:1.5 was 0.117 g / g, the soluble peptide recovery was 0.200 g / g, and the total recovery of amino acids and soluble peptides was 0.317 g / g. The amino acid recovery of the recombinant strain SCUT-OectABCD-OectD was 0.128 g / g, the soluble peptide recovery was 0.246 g / g, and the total recovery of amino acids and soluble peptides was 0.374 g / g. The total recovery was 1.18 times that of the starting strain SCUT-1. The amino acid recovery of the starting strain SCUT-1 in shrimp shell fermentation medium with a material-to-liquid ratio of 1:4.0 was 0.150 g / g, the soluble peptide recovery was 0.142 g / g, and the total recovery of amino acids and soluble peptides was 0.292 g / g. The amino acid recovery of the recombinant strain SCUT-OectABCD-OectD was 0.155 g / g, the soluble peptide recovery was 0.180 g / g, and the total recovery of amino acids and soluble peptides was 0.335 g / g. The total recovery was 1.15 times that of the starting strain SCUT-1.

[0132] The results of solid-state fermentation of cottonseed meal and shrimp shells by the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD showed that the total tetrahydropyrimidine and hydroxytetrahydropyrimidine content of the starting strain SCUT-1 in the cottonseed meal fermentation medium with a material-to-liquid ratio of 1:1.5 was 1.59 g / kg; the total tetrahydropyrimidine and hydroxytetrahydropyrimidine content of the recombinant strain SCUT-OectABCD-OectD was 5.12 g / kg, and the total yield was 3.22 times that of the starting strain SCUT-1. In the shrimp shell fermentation medium with a material-to-liquid ratio of 1:4.0, the total tetrahydropyrimidine and hydroxytetrahydropyrimidine content of the starting strain SCUT-1 was 2.93 g / kg; the total tetrahydropyrimidine and hydroxytetrahydropyrimidine content of the recombinant strain SCUT-OectABCD-OectD was 5.00 g / kg, and the total yield was 1.70 times that of the starting strain SCUT-1.

[0133] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of overexpression of the gene encoding tetrahydropyrimidine and the gene encoding hydroxytetrahydropyrimidine in promoting the synthesis of tetrahydropyrimidine and hydroxytetrahydropyrimidine in Streptomyces, characterized in that, The gene encoding the synthetic tetrahydropyrimidine includes ectA, ectB and ectC ; The gene encoding the synthetic hydroxytetrahydropyrimidine is ectD ; Gene encoding the synthesis of tetrahydropyrimidine ectA The sequence is shown in SEQ ID No. 1; Gene encoding the synthesis of tetrahydropyrimidine ectB The sequence is shown in SEQ ID No. 2; Gene encoding the synthesis of tetrahydropyrimidine ectC The sequence is shown in SEQ ID No. 3; Gene encoding the synthesis of hydroxytetrahydropyrimidine ectD The sequence is shown in SEQ ID No. 4; The Streptomyces mentioned is Streptomyces SCUT-1; the Streptomyces SCUT-1 has the accession number GDMCC No: 60612, and this strain was deposited on March 20, 2019 at the Guangdong Provincial Microbial Culture Collection Center, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The overexpression is performed using the overexpression promoter scutP1, the nucleic acid sequence of which is shown in SEQ ID No.

5.

2. The application according to claim 1, characterized in that, The overexpression of the gene encoding the synthesis of tetrahydropyrimidine and the overexpression of the gene encoding the synthesis of hydroxytetrahydropyrimidine are as follows: gene ectABCD Overexpression and gene ectD overexpression , The aforementioned gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence.

3. Genes ectABCD Overexpression and gene ectD The application of overexpression in improving the tolerance of Streptomyces to hyperosmolar environments is characterized by, The overexpression of the gene encoding the synthesis of tetrahydropyrimidine and the overexpression of the gene encoding the synthesis of hydroxytetrahydropyrimidine are as follows: gene ectABCD Overexpression and gene ectD overexpression , The aforementioned gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4 linked together in sequence; gene ectD The sequence is shown in SEQ ID No. 4; the Streptomyces is Streptomyces SCUT-1; the Streptomyces SCUT-1 has the accession number GDMCC No: 60612, and this strain was deposited on March 20, 2019 at the Guangdong Provincial Microbial Culture Collection Center, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The overexpression is performed using the overexpression promoter scutP1, the nucleic acid sequence of which is shown in SEQ ID No.

5.

4. The application of overexpression of the gene encoding synthetic tetrahydropyrimidine and the gene encoding synthetic hydroxytetrahydropyrimidine in improving the ability of Streptomyces to degrade agricultural waste, characterized in that, The gene encoding the synthetic tetrahydropyrimidine includes ectA, ectB and ectC ; The gene encoding the synthetic hydroxytetrahydropyrimidine is ectD ; Gene encoding the synthesis of tetrahydropyrimidine ectA The sequence is shown in SEQ ID No. 1; Gene encoding the synthesis of tetrahydropyrimidine ectB The sequence is shown in SEQ ID No. 2; Gene encoding the synthesis of tetrahydropyrimidine ectC The sequence is shown in SEQ ID No. 3; Gene encoding the synthesis of hydroxytetrahydropyrimidine ectD The sequence is shown in SEQ ID No. 4; The Streptomyces mentioned is Streptomyces SCUT-1; the Streptomyces SCUT-1 has the accession number GDMCC No: 60612, and this strain was deposited on March 20, 2019 at the Guangdong Provincial Microbial Culture Collection Center, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The aforementioned degradation of agricultural waste involves degrading biomass into amino acids and polypeptides; The overexpression is performed using the overexpression promoter scutP1, the nucleic acid sequence of which is shown in SEQ ID No.

5.

5. A recombinant Streptomyces strain, characterized in that, The recombinant vector contains a recombinant vector; the recombinant vector contains the promoter scutP1; the recombinant vector also contains a gene. ectABCD ; The aforementioned gene ectABCD The sequence is SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence; The nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No. 5; In the recombinant vector, the nucleic acid sequence of the promoter scutP1 is linked to the gene. ectABCD ; The original strain of the recombinant Streptomyces strain is Streptomyces SCUT-1; the Streptomyces SCUT-1 has the accession number GDMCC No: 60612, and this strain was deposited on March 20, 2019 at the Guangdong Provincial Microbial Culture Collection Center, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

6. The recombinant Streptomyces strain according to claim 5, characterized in that, The recombinant vector also contains genes. ectD The aforementioned gene ectD The sequence is shown in SEQ ID No. 4; In the recombinant vector, the nucleic acid sequence of the promoter scutP1 is linked to the gene. ectABCD The sequence is then linked to the nucleic acid sequence of the promoter scutP1 and the gene. ectD sequence.

7. The application of the recombinant Streptomyces strain according to claim 5 or 6 in the degradation of agricultural waste.

8. The application according to claim 7, characterized in that, Includes the following steps: Inoculate the recombinant Streptomyces strain according to claim 5 or 6 into a fermentation medium and ferment; The fermentation medium described uses agricultural waste as the sole source of carbon and nitrogen.

Citation Information

Patent Citations

  • A Streptomyces strain and its application in feather degradation

    CN110317748B

  • Promoter of overexpression protease, streptomyces recombinant bacteria and construction method and application thereof

    CN115927332A

  • Genetically engineered bacterium for producing hydroxyectoine and application of genetically engineered bacterium

    CN112877270A

  • Genetically engineered bacterium capable of producing ectoine and applied to crop stress resistance

    CN118291496A