Marker for predicting treatment sensitivity of liver cancer lenvatinib and application of marker

Abstract

The invention relates to the technical field of bioengineering, and discloses a marker for predicting liver cancer treatment sensitivity and application thereof.The marker for predicting liver cancer treatment sensitivity comprises HECTD2, the nucleotide sequence of the HECTD2 is shown as SEQ ID NO: 1, oxidative stress of the HECTD2 is limited through KEAP1 / NRF2 so as to promote drug resistance of the revatinib, the marker comprises H3K181a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a, H3K182a The nucleotide sequence of the H3K18la is as shown in SEQ ID NO: 2, and the H3K18la induces up-regulation of HECTD2 in HCC cells, so that the drug resistance of the lenvatinib is promoted. According to the present invention, the HECTD2 is adopted as the E3 ubiquitin ligase, and the K48-connected multi-ubiquitin chain is added on the K551 residue of the KEAP1 so as to alleviate the oxidative stress stimulated by the treatment of the lenvatinib; the transcription of the HECTD2 is enhanced by the H3K18la; the expression level of the HECTD2 is an independent prediction index of prognosis of the HCC patient; a new visual angle is provided for understanding the drug resistance of the HCC to the lenvatinib, and a promising diagnosis and treatment strategy is possibly provided for clinical treatment of the HCC.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a marker for predicting the sensitivity of liver cancer to lenvatinib treatment and its application. Background Art

[0002] Primary liver cancer is the sixth most common cancer and the third leading cause of cancer death worldwide. Hepatocellular carcinoma (HCC) accounts for more than 80% of primary liver cancer. Surgical resection and liver transplantation remain effective treatments for curing HCC patients. However, most HCC cases are diagnosed in the advanced stage and are not eligible for surgery. Lenvatinib is a multi-target tyrosine kinase inhibitor (TKI) that effectively targets VEGFR1 to VEGFR3, FGFR1 to FGFR4, PDGFRα, KIT, and RET. It has been approved as a first-line treatment for advanced HCC since 2018. However, its drug resistance remains a major obstacle to its therapeutic efficiency. A large number of patients will develop resistance to lenvatinib or show intrinsic resistance, which greatly limits its clinical application and efficacy. Therefore, understanding the molecular mechanism of lenvatinib resistance is crucial to developing effective treatment strategies and improving the prognosis of HCC patients.

[0003] HECT domain E3 ubiquitin protein ligase 2 (HECTD2) is a member of the HECT-type E3 ligase family and was first identified as a susceptibility gene for neurodegenerative diseases. As a relatively poorly studied member of the HECT family of E3 ligases, HECTD2 has recently been found to play multifaceted roles in human cancers. For example, downregulation of HECTD2 promotes proteasomal degradation of EHMT2, thereby inhibiting the growth of colorectal cancer. HECTD2 can accelerate the cell cycle and play a dominant control role in the progression of melanoma. Overexpression of HECTD2 promotes inflammatory responses, proliferation, and migration in renal cell carcinoma cells. Interestingly, HECTD2 has both tumor suppressive and oncogenic roles in malignancies, adding another layer of complexity. Our previous bioinformatics analysis described the distribution of HECTE3 ligases in HCC and demonstrated that upregulation of HECTD2 is associated with unfavorable survival outcomes. However, the substrates and mode of action of HECTD2 in HCC remain largely unknown.

[0004] Post-translational modifications of histones are part of the epigenetic regulatory machinery. Lactate-derived histone lactylation is thought to directly promote gene transcription in a variety of biological processes. As a hallmark of cancer, hypoxic microenvironment and enhanced glycolysis lead to the accumulation of lactate. Histone lactylation is a common post-translational modification in HCC. Recent studies have also shown that histone lactylation can regulate the drug resistance of colorectal cancer, bladder cancer, and glioblastoma. However, how histone lactylation is involved in the response of HCC to lenvatinib resistance remains unclear.

[0005] Here, we established HCC cell lines, patient-derived organ tissues, and xenografts resistant to lenvatinib and found that upregulation of HECTD2 was closely associated with lenvatinib resistance. Functional experiments validated that HECTD2 could cause lenvatinib resistance in vitro and in vivo. Mechanistically, HECTD2 promoted the ubiquitination of KEAP1 as an E3 ubiquitin ligase, which in turn triggered an antioxidant response and inhibited the response of HCC cells to lenvatinib. Lactylation on histone 3 lysine residue 18 (H3K18la) induced upregulation of HECTD2 in lenvatinib-resistant HCC cells. Summary of the invention

[0006] In order to solve the technical problems existing in the prior art, the present invention provides a marker for predicting the sensitivity of liver cancer to lenvatinib treatment and its application.

[0007] The present invention is implemented by the following technical scheme: a marker for predicting the sensitivity of liver cancer to lenvatinib treatment, the marker comprising HECTD2, the nucleotide sequence of the HECTD2 being shown in SEQ ID NO:1.

[0008] As a further improvement of the above scheme, HECTD2 limits oxidative stress through KEAP1 / NRF2 to promote lenvatinib resistance.

[0009] A marker for predicting the sensitivity of liver cancer to lenvatinib treatment, the marker comprising H3K18la, the nucleotide sequence of H3K18la being shown in SEQ ID NO:2.

[0010] As a further improvement of the above scheme, the H3K18la induces upregulation of HECTD2 in HCC cells, thereby promoting lenvatinib resistance.

[0011] A marker for predicting the sensitivity of liver cancer to lenvatinib treatment. The primers include a HECTD2-PCR primer pair, which includes a forward primer HECTD2-PCR-F with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer HECTD2-PCR-R with a nucleotide sequence as shown in SEQ ID NO: 4.

[0012] As a further improvement of the above scheme, the HECTD2-PCR primer inhibits HECTD2 expression, thereby reducing lenvatinib resistance.

[0013] A biological product for predicting the sensitivity of liver cancer to lenvatinib treatment, the biological product comprising a marker, wherein the marker comprises at least one of HECTD2, H3K18la and a HECTD2-PCR primer pair.

[0014] As a further improvement of the above solution, the biological product includes: reagents, test kits, and chips.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. HECTD2 of the present invention acts as an E3 ubiquitin ligase to add K48-linked polyubiquitin chains to the K551 residue of KEAP1, thereby alleviating oxidative stress stimulated by lenvatinib treatment; H3K18la enhances the transcription of HECTD2; and the expression level of HECTD2 is an independent predictor of the prognosis of HCC patients.

[0017] 2. This invention provides a new perspective for understanding the resistance of HCC to lenvatinib and may provide a promising diagnostic and therapeutic strategy for the clinical treatment of HCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The expression graph of HECTD2 expression level and lenvatinib resistance provided by the present invention; wherein:

[0019] Figure 1 A is an expression diagram showing that lenvatinib-resistant HCCLM3 cells (HCCLM3-LR and Huh7-LR) and corresponding parental cells (HCCLM3-Par and Huh7-Par) were treated with different doses of lenvatinib for three days, and the cell viability was detected to compare the half-maximal inhibitory concentration (IC50) values ​​of lenvatinib-resistant cells and parental cells. Among them, the IC50 value of HCCLM3-Par was 6.93 μM, and the IC50 value of HCCLM3-LR was 20.15 μM;

[0020] Figure 1B is an expression diagram of the half-maximal inhibitory concentration (IC50) values ​​of lenvatinib-resistant Huh7 cells (HCCLM3-LR and Huh7-LR) and corresponding parental cells (HCCLM3-Par and Huh7-Par) treated with different doses of lenvatinib for three days, and the cell viability was detected, and the IC50 values ​​of lenvatinib-resistant cells and parental cells were compared. Among them, the IC50 value of Huh7-Par was 4.51 μM, and the IC50 of Huh7-LR was 15.30 μM;

[0021] Figure 1 C is an expression graph showing the comparison of cell growth between lenvatinib-resistant cells and parental cells after HCCLM3-LR and corresponding parental cells were treated with lenvatinib (LVN) or DMSO for two weeks and then subjected to colony formation assay;

[0022] Figure 1 D is an expression graph showing the comparison of cell growth between lenvatinib-resistant cells and parental cells after Huh7-LR and corresponding parental cells were treated with lenvatinib (LVN) or DMSO for two weeks and then subjected to colony formation assay;

[0023] Figure 1 E is the expression graph of unbiased proteomic screening of lenvatinib-resistant and parental HCC cells, in which the results showed that HECTD2 was one of the top ten upregulated proteins in lenvatinib-resistant HCC cells;

[0024] Figure 1 F is an expression graph showing the mRNA expression level of HECTD2 in lenvatinib-resistant and parental HCC cells by qRT-PCR;

[0025] Figure 1 G, Western blotting to evaluate the protein expression level of HECTD2 in lenvatinib-resistant and parental HCC cells;

[0026] Figure 1 H is the expression diagram of the therapeutic effect of lenvatinib on HCC organ tissues;

[0027] Figure 1 I is a representative image of organoid tissues that are sensitive to lenvatinib and resistant to lenvatinib;

[0028] Figure 1 J is the H&E evaluation of lenvatinib-sensitive and lenvatinib-resistant HCC patients and corresponding organoid tissues and IHC staining of AFP and GPC3;

[0029] Figure 1 K is the IHC staining image of HECTD2 in lenvatinib-sensitive and lenvatinib-resistant HCC patients and corresponding organoid tissues;

[0030] Figure 2 The present invention provides an expression diagram of HECTD2 inhibiting the response of HCC to lenvatinib; wherein:

[0031] Figure 2 A is an expression diagram of the knockout efficiency of HECTD2 in HCCLM3-LR and Huh7-LR cells evaluated by qRT-PCR;

[0032] Figure 2 B is an expression diagram of the knockdown efficiency of HECTD2 in HCCLM3-LR and Huh7-LR cells evaluated by Western blotting;

[0033] Figure 2 C is an expression graph evaluating the overexpression efficiency of HECTD2 in HCCLM3 and Huh7 cells using qRT-PCR;

[0034] Figure 2 D is an expression graph evaluating the overexpression efficiency of HECTD2 in HCCLM3 and Huh7 cells using Western blotting technology;

[0035] Figure 2 E is an expression graph of the proliferation ability of HCCLM3-LR and Huh7-LR cells with HECTD2 gene silencing evaluated using CCK-8 assay;

[0036] Figure 2 F is an expression graph evaluating the proliferation ability of HCCLM3 and Huh7 cells overexpressing the HECTD2 gene using the CCK-8 assay;

[0037] Figure 2 G is an expression graph of the proliferation ability of HCCLM3-LR and Huh7-LR cells with HECTD2 gene silencing detected by colony formation assay;

[0038] Figure 2 H is an expression graph of the cell proliferation ability of HCCLM3 and Huh7 cells overexpressing the HECTD2 gene detected by colony formation assay;

[0039] Figure 2 I is an expression diagram of apoptosis rate of HCCLM3-LR and Huh7-LR cells with HECTD2 knockout evaluated by flow cytometry;

[0040] Figure 2 J is an expression graph evaluating the apoptosis rate of HECTD2-overexpressing HCCLM3 and Huh7 cells by flow cytometry;

[0041] Figure 3 The expression diagram of the interaction between HECTD2 and KEAP1 provided by the present invention; wherein:

[0042] Figure 3 A is the differentially expressed protein profile in Huh7 cells with or without HECTD2 overexpression that are sensitive to lenvatinib;

[0043] Figure 3 B is the expression diagram of molecular pathways related to HECTD2 through KEGG analysis of differentially expressed protein profiles;

[0044] Figure 3 C is a Venn diagram showing the intersection of the differentially expressed protein map when HECTD2 is overexpressed and the HECTD2 interacting protein map;

[0045] Figure 3 D is the expression diagram of the mass spectrometry results of detecting KEAP1 from the immunoprecipitation product of HECTD2;

[0046] Figure 3 E is an expression graph of Western blot analysis to detect the protein expression levels of KEAP1 and NRF2 in HECTD2 gene-silenced HCCLM3-LR and Huh7-LR cells;

[0047] Figure 3 F is the expression diagram of the Co-IP results showing the interaction between KEAP1 and NRF2 in HCC cells;

[0048] Figure 3 G is the expression diagram showing the interaction between HECTD2 and KEAP1 by GST-pulldown analysis;

[0049] Figure 3 H is an immunofluorescence expression diagram showing the co-localization of HECTD2 and KEAP1 in the cytoplasm;

[0050] Figure 3 I is the expression graph of the mRNA expression level of KEAP1 when HECTD2 was knocked out;

[0051] Figure 3 J is the expression graph of the mRNA expression level of KEAP1 when HECTD2 is overexpressed;

[0052] Figure 3 K is the expression graph of KEAP1 protein level in lenvatinib-resistant and lenvatinib-sensitive HCC cells with HECTD2 knockdown treated with CHX, MG-132 or chloroquine:

[0053] Figure 3 L is the expression graph of KEAP1 protein levels in HECTD2-overexpressing lenvatinib-resistant and lenvatinib-sensitive HCC cells treated with CHX, MG-132, or chloroquine;

[0054] Figure 4 The present invention provides an expression diagram of HECTD2, which is an E3 ubiquitin ligase of KEAP1; wherein:

[0055] Figure 4 A is an expression diagram of KEAP1 ubiquitination and KEAP1 protein level detected in HCCLM3-LR and Huh7-LR cells with HECTD2 knockout;

[0056] Figure 4 B is a graph evaluating KEAP1 ubiquitination and KEAP1 protein level expression in HECTD2-overexpressing HCCLM3 and Huh7 cells;

[0057] Figure 4 C is the expression diagram of lysine mutation of ubiquitin molecules detected by immunoprecipitation and immunoblotting;

[0058] Figure 4 D is the expression diagram of lysine retention mutation of ubiquitin molecules detected by immunoprecipitation and immunoblotting;

[0059] Figure 4 E is the expression diagram of different domain truncations of KEAP1;

[0060] Figure 4 F is the expression diagram of different domain truncations of HECTD2;

[0061] Figure 4 G is an expression graph detecting the interaction between HECTD2 and different fragments of KEAP1;

[0062] Figure 4 H is the expression graph evaluating the interaction between KEAP1 and different truncations of HECTD2;

[0063] Figure 4 I is a graph showing the expression of specific KEAP1 lysine residues mediating KEAP1 ubiquitination using K323 or K551 mutated KEAP1 proteins;

[0064] Figure 5 The present invention provides an expression diagram of HECTD2 maintaining lenvatinib resistance by alleviating oxidative stress; wherein:

[0065] Figure 5 A is a staining image of JC-1 staining detection of HECTD2-silenced HCCLM3-LR cells;

[0066] Figure 5 B is the staining image of JC-1 staining detection of Huh7-LR cells with HECTD2 silenced;

[0067] Figure 5 C is a staining image of JC-1 staining detection of HCCLM3 cells overexpressing HECTD2;

[0068] Figure 5 D is a staining image of JC-1 staining detection of Huh7 cells overexpressing HECTD2;

[0069] Figure 5 E is the expression graph of ROS levels in HCCLM3-LR cells with HECTD2 silenced;

[0070] Figure 5 F is the expression graph of ROS levels in Huh7-LR cells with HECTD2 silenced;

[0071] Figure 5 G is the expression graph of ROS levels in HCCLM3 cells overexpressing HECTD2;

[0072] Figure 5 H is the expression graph of ROS levels in Huh7 cells overexpressing HECTD2;

[0073] Figure 5 I is a flow cytometry test to compare the expression of ROS levels in HCCLM3-LR and Huh7-LR cells with HECTD2 silenced;

[0074] Figure 5 J is the expression graph of ROS levels in HCCLM3 and Huh7 cells with HECTD2 knockdown detected by flow cytometry;

[0075] Figure 6 The present invention provides an expression diagram of HECTD2 regulating KEAP1 / NRF2 signal transduction and promoting lenvatinib resistance in vivo; wherein:

[0076] Figure 6 A is a diagram of the PDX model for establishing lenvatinib-sensitive and lenvatinib-resistant cells;

[0077] Figure 6 B is the in vivo imaging of xenografts of the HECTD2-overexpressing lenvatinib-sensitive PDX model and the HECTD2-knockout lenvatinib-resistant PDX model;

[0078] Figure 6 C is the tumor image of the lenvatinib-sensitive PDX model with HECTD2 overexpression and the lenvatinib-resistant PDX model with HECTD2 knockout;

[0079] Figure 6 D is the tumor volume curve of the PDX model. E is the tumor weight graph of the PDX model;

[0080] Figure 6 E is the tumor weight graph of the PDX model;

[0081] Figure 6 F is the IHC staining results of HECTD2, KEAP1, and NRF2 in xenografts, and the expression graph showing the immunofluorescence results of Ki-67 and TUNEL in xenografts;

[0082] Figure 6 G is the quantitative results of HECTD2, KEAP1, NRF2, Ki-67, and TUNEL in HECTD2-overexpressing xenografts;

[0083] Figure 6 H is the quantitative results of HECTD2, KEAP1, NRF2, Ki-67, and TUNEL in HECTD2 knockout xenografts;

[0084] Figure 7 The expression diagram of histone lactylation driving HECTD2 transcription provided by the present invention; wherein:

[0085] Figure 7 A is the expression graph of hypoxia detection using penidazole in lenvatinib-sensitive HCCLM3 and Huh7 cells and lenvatinib-resistant HCCLM3-LR and Huh7-LR cells;

[0086] Figure 7 B is the expression diagram of lactate levels in lenvatinib-sensitive HCCLM3 and Huh7 cells and lenvatinib-resistant HCCLM3-LR and Huh7-LR cells;

[0087] Figure 7 C is the expression diagram of Pan-Kla and H3K18la levels in HCCLM3 and Huh7 cells that are sensitive to lenvatinib and HCCLM3-LR and Huh7-LR cells that are resistant to lenvatinib;

[0088] Figure 7 D is the expression graph of H3K18la and HECTD2 levels in HCCLM3 and Huh7 cells after administration of NALA;

[0089] Figure 7 E is the expression graph of H3K18la and HECTD2 levels in HCCLM3-LR and Huh7-LR cells after LDHi treatment;

[0090] Figure 7 F is the expression graph of H3K18la and HECTD2 levels detected by adding rotidone to HCCLM3 and Huh7 cells;

[0091] Figure 7 G is an expression diagram of ChIP-qPCR detection to show the enrichment of H3K18la in the HECTD2 promoter region in HCCLM3-LR and Huh7-LR cells;

[0092] Figure 7 H is a graph comparing the expression levels of H3K18la and HECTD2 in HCCLM3-LR and Huh7-LR cells after administration of C646;

[0093] Figure 7 I is the expression graph evaluating H3K18la and HECTD2 levels in HCCLM3 and Huh7 cells after TSA treatment;

[0094] Figure 8 The present invention provides an expression diagram of HECTD2 associated with lenvatinib resistance and predicted poor survival outcomes of HCC; wherein:

[0095] Figure 8 A is a volcano plot of differentially expressed proteins between lenvatinib-resistant HCCLM3-LR and parental HCCLM3 cells;

[0096] Figure 8 B is a volcano plot of differentially expressed proteins between lenvatinib-resistant Huh7-LR and parental Huh7 cells;

[0097] Figure 8 C is the volcano plot of differentially expressed molecules between HCC tumor and non-tumor samples in the TCGA-LIHC database;

[0098] Figure 8 D is a Venn diagram representing the three groups of intersections;

[0099] Figure 8 E is an expression diagram showing the difference in overall survival rate between the HECTD2 high expression group and the HECTD2 low expression group by Kaplan-Meier curve;

[0100] Figure 8 F is the expression diagram of Kaplan-Meier curve showing the difference in disease-free survival rate between HECTD2 high expression group and HECTD2 low expression group;

[0101] Fig. 9 The expression graph of HECTD2 mRNA expression level in organ tissues and original patient tumor samples resistant to lenvatinib provided by the present invention; wherein:

[0102] Fig. 9A is an expression graph of the expression level of HECTD2 mRNA in the original tumor samples of patients who are sensitive to lenvatinib and resistant to lenvatinib;

[0103] Fig. 9 B is an expression diagram of the expression level of HECTD2 mRNA in organs and tissues that are sensitive to lenvatinib and resistant to lenvatinib;

[0104] Fig.10 The expression diagram of the interaction between the DGR domain of KEAP1 and the HECT domain of HECTD2 provided by the present invention; wherein:

[0105] Fig.10 A is an expression diagram showing the effects of KEAP1-ΔDRG and HECTD2-ΔHECT on HCCLM3 cell proliferation using CCK-8 assay;

[0106] Fig.10 B is an expression graph showing the effects of KEAP1-ΔDRG and HECTD2-ΔHECT on the proliferation ability of HCCLM3 cells in a colony formation assay;

[0107] Fig.10 C is an expression graph showing the effects of KEAP1-ΔDRG and HECTD2-ΔHECT on Huh7 cell proliferation detected by CCK-8;

[0108] Fig.10 D is an expression graph showing the effects of KEAP1-ΔDRG and HECTD2-ΔHECT on the proliferation ability of Huh7 cells in a colony formation assay;

[0109] Fig.11 The present invention provides an immunofluorescence image showing the expression of JC-1 polymers and JC-1 monomers in HCC cells treated with lenvatinib (LVN);

[0110] Fig.12 The NRF2 knockout provided by the present invention can inhibit the cell proliferation ability of HECTD2 overexpressing cells and reduce the expression graph of ROS level; wherein:

[0111] Fig.12 A is an expression graph showing the effect of NRF2 knockout on the proliferation ability of HCCLM3 cells overexpressing the HECTD2 gene in a colony formation assay;

[0112] Fig.12 B is the expression diagram of the effect of NRF2 gene knockout on the proliferation ability of Huh7 cells;

[0113] Fig.12 C is an expression diagram showing the effect of NRF2 knockout on ROS levels in HECTD2-overexpressing HCCLM3 cells;

[0114] Fig.12 D is the expression diagram of the effect of NRF2 knockout on ROS levels in HECTD2-overexpressing Huh7 cells;

[0115] Fig.13 The present invention provides an expression diagram of HECTD2 level with clinical correlation with HCC prognosis and lenvatinib resistance; wherein:

[0116] Fig.13 A is Kaplan-Meier survival analysis showing HECTD2 high and HECTD2 low Expression graph of overall survival of HCC patients;

[0117] Fig.13 B is Kaplan-Meier survival analysis showing HECTD2 high and HECTD2 low Expression profile of disease-free survival of HCC patients;

[0118] Fig.13 C is the expression diagram of independent risk factors for OS shown by Cox multivariate regression analysis;

[0119] Fig.13 D is the expression diagram of independent risk factors for DFS shown in Cox multivariate regression analysis;

[0120] Fig.13 E is the IHC staining image of HECTD2, KEAP1 and NRF2 in HCC tissue cells and original tumor tissues that are resistant to lenvatinib and sensitive to lenvatinib;

[0121] Fig.14 The expression diagram of the clinical correlation between HECTD2 level and lenvatinib resistance provided by the present invention; wherein:

[0122] Fig.14 A is an immunofluorescence graph showing the expression of HECTD2 and KEAP1 in lenvatinib-sensitive and lenvatinib-resistant tumor tissues;

[0123] Fig.14 B is the Ki-67 level and TUNEL staining in lenvatinib-sensitive and lenvatinib-resistant tumor tissues;

[0124] Fig.15 The expression diagram of the immunofluorescence results of HECTD2 and KEAP1 in the PDX model xenografts sensitive to lenvatinib and resistant to lenvatinib provided by the present invention;

[0125] Fig.16The expression diagram of H3K181a driving HECTD2 transcription provided by the present invention; wherein:

[0126] Fig.16 A is the expression diagram of the levels of H3K14la, H3K18la, H3K27la and H4K5la in HCC cells that are sensitive to lenvatinib and resistant to lenvatinib;

[0127] Fig.16 B is a ChIP-seq analysis of H3K18la genomic binding at the target site;

[0128] Fig.16 C is a heat map showing the detection of H3K18la binding sites detected by ChIP-seq;

[0129] Fig.16 D is the ChIP-seq graph of HECTD2 promoter bound to H3K18la. DETAILED DESCRIPTION

[0130] The present invention is further described below in conjunction with the accompanying drawings and specific implementation methods. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form a new embodiment.

[0131] Embodiment 1:

[0132] A marker for predicting the sensitivity of liver cancer to lenvatinib treatment, the marker comprising HECTD2, the nucleotide sequence of HECTD2 being shown in SEQ ID NO:1.

[0133] As a further improvement of the above scheme, HECTD2 limits oxidative stress through KEAP1 / NRF2 to promote lenvatinib resistance.

[0134] A marker for predicting the sensitivity of liver cancer to lenvatinib treatment, the marker comprising H3K18la, and the nucleotide sequence of H3K18la is shown in SEQ ID NO: 2.

[0135] As a further improvement of the above scheme, H3K18la induced the upregulation of HECTD2 in HCC cells, thereby promoting lenvatinib resistance.

[0136] A marker for predicting the sensitivity of liver cancer to lenvatinib treatment. The primers include a HECTD2-PCR primer pair. The HECTD2-PCR primer pair includes a forward primer HECTD2-PCR-F with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer HECTD2-PCR-R with a nucleotide sequence as shown in SEQ ID NO: 4.

[0137] As a further improvement of the above scheme, HECTD2-PCR primers inhibited HECTD2 expression, thereby reducing lenvatinib resistance.

[0138] A biological product for predicting the sensitivity of liver cancer to lenvatinib treatment, the biological product comprises a marker, and the marker comprises at least one of HECTD2, H3K18la and a HECTD2-PCR primer pair.

[0139] As a further improvement of the above solution, the biological products include: reagents, test kits, and chips.

[0140] Embodiment 2:

[0141] Determination of HECTD2 expression level associated with lenvatinib resistance in liver cancer:

[0142] By injecting HCC cells with increasing doses of lenvatinib, lenvatinib-resistant HCC cell lines were established and named HCCLM3-LR and Huh7-LR; compared with the parental cell lines, HCCLM3-LR and Huh7-LR showed higher IC50 values ​​for lenvatinib, such as Figure 1 A and Figure 1 As shown in B;

[0143] Colony formation assays confirmed that HCCLM3-LR and Huh7-LR were less sensitive to lenvatinib treatment. Figure 1 C and Figure 1 As shown in D; To identify the regulatory factors of lenvatinib resistance, proteomic screening was performed on lenvatinib-resistant HCC cells and parental HCC cells, as shown in Figure 8 A and Figure 8 As shown in B; after crossing with the TCGA-LIHC database, Figure 8 C and Figure 8 As shown in D, it was found that the expression level of HECTD2 in HCC cells was higher than that in normal cells; HECTD2 was found to be one of the top ten upregulated proteins in lenvatinib-resistant HCC cells, such as Figure 1 As shown in E;

[0144] Quantitative real-time PCR (qRT-PCR) and Western blot results confirmed that HECTD2 was significantly upregulated in lenvatinib-resistant HCCLM3-LR and Huh7-LR cells. Figure 1 F and G.

[0145] To evaluate the relationship between HECTD2 and the efficacy of lenvatinib in the treatment of HCC patients, organoid tissues from HCC patients were constructed and their responses to lenvatinib treatment were tested; Figure 1As shown in Figure 3, most organ tissues (75%, 9 / 12) were resistant to lenvatinib, and 25% of organ tissues (3 / 12) were susceptible to lenvatinib treatment. In addition, one HCC organ tissue resistant to lenvatinib and one HCC organ tissue sensitive to lenvatinib were randomly selected, and it was found that the resistant organ tissue grew well after 14 days of lenvatinib treatment, as shown in Figure 3. Figure 1 As shown in I; Figure 1 J shows hemoglobin and eosin (H&E) evaluation and IHC staining of AFP, CK7, and CK19 biomarkers of selected organoid tissues and original patient tumor samples, indicating that the organoid tissues retain the same expression pattern as the original tumor tissues.

[0146] In lenvatinib-resistant HCC patient tissues and corresponding organ tissues, the expression level of HECTD2 protein was significantly upregulated, such as Figure 1 K shown;

[0147] Bioinformatics analysis showed that high expression levels of HECTD2 were associated with good overall survival (OS) and disease-free survival (DFS) of patients. Figure 8 E and Figure 8 As shown in F;

[0148] qRT-PCR results confirmed that the mRNA expression level of HECTD2 was increased in lenvatinib-resistant organ tissues and original patient tumor samples, such as Fig. 9 A and Fig. 9 As shown in B; In summary, HECTD2 is highly expressed in HCC cell lines, organ tissues, and patient tissues that are resistant to lenvatinib.

[0149] Embodiment 3:

[0150] Verification that HECTD2 inhibits the therapeutic sensitivity of HCC to lenvatinib:

[0151] To further elucidate the role of HECTD2 in regulating lenvatinib resistance, HECTD2 was knocked down in HCCLM3-LR and Huh7-LR cells, and the knockdown efficiency was evaluated using qRT-PCR and Western blotting. Figure 2 A and Figure 2 As shown in B; si-HECTD2#1 and si-HECTD2#3 had the most significant knockout efficiency and were therefore selected for subsequent experiments;

[0152] In addition, HECTD2 was overexpressed in HCCLM3 and Huh7 cell lines that are sensitive to lenvatinib, and its overexpression efficiency was verified, as Figure 2As shown in Figure C and Figure D; CCK-8 assay measured the proliferation capacity of lenvatinib-resistant HCC cells with HECTD2 knockout and lenvatinib-sensitive cells with HECTD2 overexpression; when the cells were treated with lenvatinib, HECTD2 knockout in HCCLM3-LR and Huh7-LR cells led to a significant decrease in cell proliferation capacity, while HECTD2 overexpression increased cell growth of sensitive HCCLM3 and Huh7 cells, as shown in Figure Figure 2 E and Figure 2 As shown in F;

[0153] Colony formation assays confirmed that HECTD2 knockout inhibited the proliferation of HCCLM3-LR cells, while HECTD2 overexpression promoted the growth of HCCLM3 cells. Figure 2 G and Figure 2 As shown in H; flow cytometry results showed that HECTD2 knockout induced the apoptosis rate of HCCLM3-LR cells, as shown in Figure 2 I; in contrast, after HECTD2 overexpression, apoptosis of HCCLM3 cells was inhibited, as shown in Figure 2 J; In summary, HECTD2 knockout helps to restore the sensitivity of HCC cells resistant to lenvatinib, while HECTD2 overexpression makes HCC cells sensitive to lenvatinib less susceptible to lenvatinib treatment.

[0154] Embodiment 4:

[0155] Verification of HECTD2 interaction with KEAP1:

[0156] To investigate the HECTD2-mediated mechanism of lenvatinib resistance, we first performed protein sequencing on HECTD2-overexpressing and non-expressing lenvatinib-sensitive Huh7 cells, and established a differentially expressed protein profile when HECTD2 was overexpressed, such as Figure 3 As shown in A; Kyoto Encyclopedia of Genomes (KEGG) analysis of differentially expressed protein profiles showed that the molecular pathways associated with HECTD2 were mainly concentrated in oxidative stress, drug metabolism, and ubiquitination, such as Figure 3 As shown in B; In addition, the immunoprecipitation products of HECTD2 were analyzed by mass spectrometry, and a total of 71 potential HECTD2-binding proteins were identified; after cross-analysis of these two groups of proteins, KEAP1 was found to be the only candidate protein for HECTD2 substrate, as shown in Figure 3 C and Figure 3As shown in D; It is well known that the KEAP1 / NRF2 system is an evolutionarily conserved cellular defense system used to combat oxidative stress; NRF2 is enclosed in the cytoplasm by KEAP1 and degraded by the proteasome under static conditions; NRF2 is released from KEAP1-mediated inhibition under stress stimulation, and the subsequent translocation of NRF2 activates its target genes.

[0157] Then, the protein expression levels of KEAP1 and NRF2 were detected in lenvatinib-resistant HCC cell lines with HECTD2 knockout. Figure 3 As shown in E, after HECTD2 knockout, the expression level of KEAP1 was upregulated, while the expression level of NRF2 was downregulated;

[0158] To further verify the observed results of the interaction between HECTD2 and KEAP1, GST pulldown experiments and co-immunoprecipitation (co-IP) experiments were performed, such as Figure 3 F and Figure 3 As shown in G; the results consistently confirmed the direct interaction between HECTD2 and KEAP1;

[0159] Immunofluorescence showed that HECTD2 and KEAP1 were co-localized in the cytoplasm. Figure 3 H; In addition, knockout or overexpression of HECTD2 had no significant effect on the expression level of KEAP1 mRNA, as shown in Figure 3 I and Figure 3 As shown in J, HECTD2 does not regulate the expression of KEAP1 through transcriptional regulation; therefore, it is speculated that HECTD2 may affect the expression of KEAP1 protein at the level of protein degradation;

[0160] HCC cells expressing HECTD2 or knocking down HECTD2 were treated with CHX, and the half-life of KEAP1 was detected. The results showed that HECTD2 could accelerate the degradation of KEAP1 protein; the autophagy inhibitor chloroquine had no significant effect on the level of KEAP1 protein, while the proteasome inhibitor MG-132 increased the level of KEAP1 protein. Figure 3 K and Figure 3 L; these data taken together suggest that HECTD2 may affect KEAP1 protein levels through the ubiquitin proteasome pathway.

[0161] Embodiment 5:

[0162] Validation that HECTD2 is the E3 ubiquitin ligase of KEAP1:

[0163] The ubiquitination level of KEAP1 in HECTD2 knockdown and HECTD2 overexpressing HCC cells was evaluated by in vivo ubiquitination assay. Figure 4 A and Figure 4 As shown in B, HECTD2 gene knockout resulted in reduced KEAP1 ubiquitination and increased KEAP1 protein levels, while HECTD2 gene overexpression resulted in increased KEAP1 ubiquitination and decreased KEAP1 protein levels; To determine the specific type of polyubiquitin linkage, each lysine residue or six of the seven lysine residues (K6, K11, K27, K29, K33, K48, and K63) of ubiquitin were mutated to arginine, and the ubiquitination levels of KEAP1 were compared, as shown in Figure 4 C and Figure 4 As shown in D; The results showed that HECTD2 promoted the ubiquitination of KEAP1 through K48-linked polyubiquitin chains;

[0164] To identify the specific domains that mediate the interaction between KEAP1 and HECTD2, different truncated domains of KEAP1 and HECTD2 were constructed, such as Figure 4 As shown in E; Figure 4 F and Figure 4 As shown in G, the DGR domain of KEAP1 and the HECT domain of HECTD2 were found to mediate the interaction between KEAP1 and HECTD2;

[0165] Rescue experiments using CCK-8 and colony formation assays showed consistent results, as Fig. 9 A- Fig. 9 As shown in B; In addition, sequencing analysis showed that there are two lysine sites (K323 and K551) in the DGR domain of KEAP1 protein; In order to find the specific lysine residues that mediate KEAP1 ubiquitination, KEAP1 proteins with K323 or K551 mutations were established, and it was found that HECTD2 mediated the ubiquitination of KEAP1 at K551, as shown in Figure 4 H; Taken together, these results indicate that HECTD2 acts as an E3 ubiquitin ligase for KEAP1 and adds K48-linked polyubiquitin chains to the K551 residue of KEAP1.

[0166] Embodiment 6:

[0167] Validation that HECTD2 maintains lenvatinib resistance by alleviating oxidative stress:

[0168] Since previous research results showed that HECTD2-related signaling pathways are mainly enriched in oxidative stress, e.g. Figure 3 B, and KEAP1 / NRF2 signaling is regulated by HECTD2, as shown in Figure 3 As shown in E, we therefore began to explore whether oxidative stress is involved in HECTD2-mediated lenvatinib resistance;

[0169] The ratio of the red fluorescence of JC-1 polymers to the green fluorescence of JC-1 monomers was used to detect the mitochondrial membrane potential (MMP); MMP is often lost during the process of appropriate drug-induced tumor cell death; Lenvatinib treatment leads to a decrease in the ratio between JC-1 polymers and JC-1 monomers, such as Fig.11 As shown, it was confirmed that lenvatinib caused the loss of MMP;

[0170] In addition, it was found that knockout of HECTD2 in lenvatinib-resistant cells resulted in a shift in the JC-1 polymer morphology to the JC-1 monomer morphology, suggesting a reduction in MMPs, such as Figure 5 A and Figure 5 As shown in B; in HCC cells overexpressing HECTD2, an increase in MMP was observed, such as Figure 5 C and Figure 5 As shown in D;

[0171] In addition, reactive oxygen species (ROS) fluorescent probes were used to detect ROS levels in HECTD2-silenced and HECTD2-overexpressing HCC cells; knockout of HECTD2 resulted in increased ROS, e.g. Figure 5 E and Figure 5 F, while overexpression of HECTD2 alleviated the production of ROS, as shown in Figure 5 G and H; similar results were observed using flow cytometry to detect ROS, as shown in Figure 5 I and J; in the response experiment, it was also found that knocking out NRF2 could counteract the increased cell growth in HECTD2-overexpressing cells (as shown in Fig.10 A and Fig.10 B) and reduced ROS (as Fig.10 C and Fig.10 Together, these results suggest that HECTD2 promotes lenvatinib resistance by limiting oxidative stress through the KEAP1 / NRF2 system.

[0172] Embodiment 7:

[0173] Verification of HECTD2 level is associated with HCC prognosis and sensitivity to lenvatinib treatment:

[0174] Using the median expression level of HECTD2 as the critical value, 60 HCC patients were divided into a low HECTD2 expression group and a high HECTD2 expression group. Kaplan-Meier survival analysis showed that compared with the low HECTD2 expression group, the OS and DFS of HCC patients in the high HECTD2 expression group were worse. Fig.13 A and Fig.13 As shown in B;

[0175] Cox multivariate regression analysis showed that the expression level of HECTD2 was an independent risk factor affecting OS and DFS. Fig.13 C and Fig.13 As shown in D;

[0176] IHC staining of HCC organ tissues and original tumor tissues showed that the expression levels of HECTD2 and NRF2 were increased, and the expression level of KEAP1 was decreased in lenvatinib-resistant organ tissues and tumor tissues. Fig.13 As shown in E; Immunofluorescence results showed that in lenvatinib-resistant tumor tissues, the expression level of HECTD2 was high and the expression level of KEAP1 was low, as shown in Fig.14 As shown in A; In addition, high Ki-67 levels and low TUNEL staining were observed in lenvatinib-resistant tumor tissues, as shown in Fig.14 As shown in B.

[0177] Embodiment 8:

[0178] Verification that HECTD2 regulates the KEAP1 / NRF2 signaling pathway and promotes lenvatinib resistance in liver cancer:

[0179] The effect of HECTD2 on lenvatinib resistance was further investigated by in vivo experiments. According to previous reports, lenvatinib-sensitive and lenvatinib-resistant HCC patient tissues were obtained to construct patient-derived xenograft (PDX) models and treated with 10 mg / kg lenvatinib. Figure 6 As shown in A, the tumors were monitored and measured regularly, and the volume and weight of the tumors were compared between the different groups; Figure 6 B- Figure 6 As shown in E, the tumor volume and weight of the HECTD2-overexpressing lenvatinib-sensitive PDX model were larger and heavier than those of the corresponding control group, while the volume and weight of the transplanted tumors in the HECTD2-silenced lenvatinib-resistant group were significantly lower than those of the control group;

[0180] IHC staining results showed that in HECTD2-overexpressing xenografts, the expression levels of NRF2 and Ki-67 were high, while the expression level of KEAP1 was low; in HECTD2-knockout xenografts, low NRF2 and Ki-67 expression levels were observed, and KEAP1 levels were also increased; TUNEL results of xenografts showed that HECTD2 overexpression inhibited cell apoptosis, while HECTD2 knockout promoted cell apoptosis, such as Figure 6 F- Figure 6 As shown in H;

[0181] The immunofluorescence results of HECTD2 and KEAP1 in the xenografts of the HECTD2-high expression group showed that the high expression of HECTD2 was associated with the low expression level of KEAP1, e.g. Fig.15Therefore, these results suggest that high expression of HECTD2 is associated with low expression of KEAP1 and high expression levels of NRF2, and HECTD2 can promote resistance to lenvatinib in PDX models.

[0182] Embodiment 9:

[0183] Verification that histone lactylation modification promotes HECTD2 transcription and upregulates HECTD2 expression:

[0184] To determine the role of lactate-derived histone lactylation in lenvatinib resistance, pimonidazole was used to detect hypoxia in tumor tissues and it was found that hypoxia levels were significantly increased in lenvatinib-resistant HCC, such as Figure 7 As shown in A; In addition, compared with the parental cell line that is sensitive to lenvatinib, the lactate levels of HCCLM3-LR and Huh7-LR cell lines were significantly increased, as shown in Figure 7 As shown in B, using pan-lactylation antibodies, it was found that the protein lactylation level of lenvatinib-resistant cells was increased;

[0185] It was also found that the H3K18la level was significantly higher in HCCLM3-LR and Huh7-LR cells, e.g. Figure 7 C; In addition, administration of sodium lactate (NALA) can increase the expression levels of H3K18la and HECTD2, as shown in Figure 7 As shown in D; LDH inhibitors reduce the expression levels of H3K18la and HECTD2, as shown in Figure 7 As shown in E; Rotidone (an inhibitor of mitochondrial respiratory chain complex I) can increase the expression levels of H3K18la and HECTD2, as shown in Figure 7 As shown in F;

[0186] To confirm that H3K18la regulated the transcription of HECTD2, ChIP-qPCR assay was performed, and the results showed that H3K18la was enriched in the HECTD2 promoter region, e.g. Figure 7 G; p300 and histone deacetylase are reported to be the "readers" and "clearers" of H3K18la modification, respectively; treatment with the p300 inhibitor C646 leads to a decrease in H3K18la and HECTD2 levels, as shown in Figure 7 H, while the histone deacetylase inhibitor TSA leads to increased levels of H3K18la and HECTD2, as shown in Figure 7 As shown in I; In summary, it was found that H3K18la modification promoted the transcription of HECTD2, thereby leading to lenvatinib resistance to HCC.

[0187] Embodiment 10:

[0188] Experimental materials and experimental steps:

[0189] 11. Patients: A total of 60 patients with advanced HCC who received lenvatinib treatment at the First Affiliated Hospital of Wannan Medical College between 2021 and 2023 were included; tumor samples were fixed with 4% paraformaldehyde, embedded in paraffin, and then stained with immunohistochemistry (IHC); written informed consent was obtained from all patients before enrollment; the study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the First Affiliated Hospital of Wannan Medical College.

[0190] 12. Cell culture: Huh7 and HCCLM3 cells were purchased from the Cell Bank / Stem Cell Bank of the Chinese Academy of Sciences (Shanghai, China); all cell lines were maintained in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin in a humidified incubator containing 5% CO2 at 37°C.

[0191] 13. Establishment of lenvatinib-resistant cell lines: In order to determine the half-maximal inhibitory concentration (IC50) of Huh7 and HCCLM3 cells to lenvatinib treatment, cells were cultured with different concentrations of lenvatinib in 96-well plates, and the IC50 values ​​were calculated based on the cell viability measurements; then, Huh7 and HCCLM3 cells were cultured with a concentration slightly lower than the IC50, and the concentration was increased at a rate of 0.5 μM per week for 2 to 3 months; as a result, lenvatinib-resistant HCC cell lines were obtained, which were named Huh7-LR and HCCLM3-LR, respectively; the successfully constructed lenvatinib-resistant cell lines were continuously cultured in the culture medium in the presence of lenvatinib.

[0192] 14. Cell counting kit-8 detection: cells were seeded into 96-well plates at a density of 1×104 cells per well; then, 10 μL of CCK-8 solution reagent (RiboBio, Guangzhou, China) was added to each well at the specified time; after culturing in the dark for 2 hours, the cells were detected using an automatic microscopic reader (BioTek Instruments, Inc.).

[0193] 15. Colony formation test: The cells were inoculated into 6-well plates at a density of 5×102 per well. After 14 days of culture, the colonies on the plates were fixed with 4% paraformaldehyde and stained with 1% amethyst.

[0194] 16. Organoid culture: Organoids were isolated and cultured according to published protocols; briefly, one-quarter of the patient's cancer tissue was cut into small pieces of approximately 1 mm3 and then incubated with digestion solution at 37°C; digestion was stopped when there were no tissue fragments, and the suspension was then filtered with a 100 μm nylon cell strainer and centrifuged at 200 × g for 5 min.

[0195] 17. Plasmid and siRNA transfection: Plasmids overexpressing HECTD2, siRNA targeting HECTD2, Flag-tagged HECTD2 and HA-tagged KEAP1, as well as regional truncation mutants of HECTD2 and KEAP1 were designed and synthesized by GenePharma (Shanghai, China); for transient transfection, cells were seeded into 6-well plates to reach 60%-70% confluence, and then plasmids or siRNAs were transfected using Lipofectamine3000 (Invitrogen, USA) according to the manufacturer's protocol.

[0196] 18. qRT-PCR: cDNA was synthesized using Fastking gDNA Dispelling RT SuperMix (TIANGEN, Beijing, China), and qRT-PCR was performed using Super Real PreMixPlus (TIANGEN) according to the instructions; the relative expression of RNA was calculated using the 2-ΔΔCt quantification method; the following primers were used for qRT-PCR amplification: HECTD2: forward primer: AGTTCACCTGCACATCTTGTTT; reverse primer: GCCTTCATTTCGGATGATGATGC, qRT-PCR primers were designed and synthesized by GenePharma.

[0197] 19. Western blotting and immunoprecipitation: cells were lysed on ice with NP-40 lysis buffer and 1 mm PMSF for 30 min, and then the supernatant was collected by centrifugation at 12,000 × g for 15 min at 4°C; protein concentration was determined by Bradford method and mixed with loading buffer before boiling; for KEAP1 immunoprecipitation, cells were lysed with SDS-containing buffer, boiled and diluted 20-fold with the above-mentioned NP-40 lysis buffer; after centrifugation, the supernatant was incubated with KEAP1 antibody at 4°C overnight; finally, the cells were washed three times with NP-40 solution, boiled, and subjected to Western blotting analysis.

[0198] 21. Cell apoptosis detection: The cultured cells under different treatments were analyzed using FITC Cell Apoptosis Detection Kit I (RiboBio) to detect apoptotic cells; approximately 1 × 106 cells were suspended in 1 × binding buffer and incubated with membrane-bound protein V-FITC and propidium iodide (PI) at room temperature for 15 min; the mixture was then measured by flow cytometry and analyzed using FlowJo software.

[0199] 22. RNA sequencing: After quality control of total RNA, eukaryotic mRNA was enriched with magnetic beads and Oligo-dT. Purified and cleaved RNA fragments were reverse transcribed to form the final cDNA library; finally, low-quality reads in the raw data were removed by HISAT2 sequence alignment software to obtain pure data; the difference in mRNA abundance between the resistant cell line and the parental cell line was analyzed using DESeq2, based on the change fold > 2.0 and p < 0.001.

[0200] 23. Immunofluorescence: For immunofluorescence detection, cells or tissues were fixed in 4% paraformaldehyde solution for 30 minutes, and then permeabilized with 0.5% TritonX-100 at room temperature; then blocked with 3% bovine serum albumin and incubated with the primary antibody at 4°C overnight; after incubation with the corresponding secondary antibody, images were collected on a fluorescence microscope (Leica Microsystems, Germany).

[0201] 24. PDX mouse model: HCC PDX model was constructed using NOD / SCID and BALB / c mice as described previously. Briefly, primary tumor tissues from HCC patients undergoing hepatectomy were preserved in ice-cold culture medium supplemented with 1% penicillin / streptomycin; then, the tissues were cut into 2-3 mm3 pieces and implanted subcutaneously into the abdomen of NOD / SCID mice; when the transplanted tumors grew to 1-2 cm3 in volume, they were removed and then spliced ​​and transplanted into BALB / c nude mice; when the transplanted tumors reached approximately 50 mm3 in volume, mice were injected with the corresponding cells and plasmid groups in the tumors every 3 days for 3 consecutive weeks; tumor volume and weight were measured, and tumors were subjected to qRT-PCR and IHC tests; all animal care and experiments were approved by the Animal Welfare and Ethics Committee of Wannan Medical College.

[0202] 25. Protein half-life determination: To determine the half-life of KEAP1, the classic CHX tracer assay was used; CHX is an inhibitor of protein biosynthesis, and its use allows accurate determination of the degradation rate of existing proteins; in the KEAP1 half-life assay, CHX (10 μg mL-1) was added to the cell culture, and then the cells were harvested at the specified time points and the protein abundance was determined by immunoblot analysis.

[0203] 26. GST-Pulldown analysis: GST-pulldown assay was performed using a GST-pulldown kit (ThermoFisherScientific, USA) according to the manufacturer's protocol; GenePharma designed and synthesized the prokaryotic plasmid of GST-HECTD2; in brief, the bait protein containing HECTD2 and the prey protein containing KEAP1 were rotated and heated overnight; the antibody-bead complex was obtained by purification and elution. The product was detected by Western blotting.

[0204] 27. Co-IP analysis: To detect endogenous interactions, cells with or without specific plasmids were introduced into IP lysis buffer (Beyotime, China) containing the protease inhibitor PMSF (Beyotime) to achieve different experimental purposes; the cell extracts were centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatants were collected and incubated with the indicated antibody or the same immunoglobulin control as the indicated antibody at room temperature for 2 h; the reaction products were washed three times with PBS supplemented with protease inhibitors and then separated by centrifugation; after denaturation of the immunoprecipitated proteins, immunoblotting was performed according to standard procedures to analyze the direct interactions between the proteins.

[0205] 28. Ubiquitination detection: To detect the level of endogenous KEAP1 ubiquitination, cells were transfected with different designated vectors to achieve different experimental purposes, and treated with 10 μM MG-132 (Aladdin, Shanghai, China) for 6 h to prevent proteasomal degradation; cells were collected to extract total protein. Aliquots of protein were pre-cleared by incubation with protein A / G agarose beads; the pre-cleared samples were then immunoprecipitated with anti-KEAP1 antibody according to the manufacturer's instructions; the immunoprecipitated proteins were then subjected to Western blot analysis.

[0206] 29. ROS detection: The transfected cells were inoculated into six-well plates at 1×105 per well; after adherence, lenvatinib (10μм) was added; DCFH-DA (Beyotime) was diluted with serum-free culture medium (1:1000) to a final concentration of 10μмL-1; the cells were resuspended in a buffer containing diluted DCFH-DA and cultured in a tissue culture incubator for 20 minutes; the cells were washed three times with serum-free cell culture medium to completely remove DCFH-DA that did not enter the cells. The results were detected using laser confocal microscopy and flow cytometry.

[0207] 31. JC-1 staining test: JC-1 staining test was performed according to the instructions of the enhanced mitochondrial membrane potential detection kit (Beyotime); in brief, JC-1 staining working solution was prepared according to the proportion, incubated at 37°C for 20 minutes, and then washed with staining buffer; images were acquired using a laser confocal microscope.

[0208] 32. Statistical analysis: Data were expressed as mean ± SD and analyzed using the Prism software package (GraphPad, USA). Statistical differences were tested using Student's t test or two-way ANOVA. p < 0.05 indicated that the difference was statistically significant.

[0209] Lenvatinib has brought huge survival benefits to patients with advanced HCC and has become a first-line treatment drug; however, due to primary or acquired resistance, a large proportion of HCC patients cannot benefit from lenvatinib in the long term; in order to discover new therapeutic targets to overcome lenvatinib resistance, proteomic screening was performed on lenvatinib-resistant and lenvatinib-sensitive HCC cells, and HECTD2 was found to be a key regulator of lenvatinib resistance.

[0210] HECTD2 is considered to be a member of the HECT family of E3 ubiquitin ligases and exhibits multiple roles in physiological and pathophysiological processes; in vitro and in vivo models were constructed, and it was observed that the expression level of HECTD2 was significantly upregulated in lenvatinib-resistant HCC cell lines, patient-derived organoid tissues, PDX mouse models, and patient tumor tissues; this is consistent with the results of previous bioinformatics studies; survival analysis of the enrolled HCC patient cohort showed that high expression levels of HECTD2 were associated with poor survival outcomes and could serve as an independent predictor of OS and DFS; in order to evaluate the functional role of HECTD2 in lenvatinib resistance, HECTD2 was knocked out in lenvatinib-resistant HCCLM3 and Huh7 cells, and HECTD2 was overexpressed in the corresponding parental lenvatinib-sensitive cells; the results showed that knocking out HECTD2 sensitized HCCLM3-LR and Huh7-LR cells to lenvatinib treatment, while overexpression of HECTD2 inhibited the sensitivity of parental HCCLM3 and Huh7 cells to lenvatinib; in vivo validation was performed using PDX mouse models made from lenvatinib-sensitive and lenvatinib-resistant HCC patient samples; the results were consistent, overexpression of HECTD2 enhanced resistance to lenvatinib treatment and led to an increase in xenograft volume and weight; in contrast, knocking out HECTD2 in lenvatinib-resistant PDX models increased sensitivity to lenvatinib, and the growth of transplanted tumors was inhibited after lenvatinib treatment.

[0211] KEAP1 / NRF2 signaling is essential for cells to resist oxidation and electrophilic stress; when subjected to external and internal oxidative stimulation, cells effectively increase the level of NRF2 by degrading KEAP1; NRF2 then shuttles into the nucleus and activates multiple downstream antioxidant genes to eliminate ROS in the cell; the combination of the KEAP1 / NRF2 system and the cellular stress response makes this pathway a key regulatory node in many diseases; previous studies have shown that the KEAP1 / NRF2 system is involved in the drug resistance of various cancers, including chemotherapy resistance in gastric cancer cells, radiation resistance in lung cancer, chemotherapy resistance in pancreatic cancer cells, and drug resistance in other cancers, radiation resistance in lung cancer, and sorafenib resistance in clear cell renal cell carcinoma; whole-genome CRISPR / Cas9 screening also showed that KEAP1 disruption reduces the sensitivity of HCC cells to sorafenib, lenvatinib, and regorafenib treatment;

[0212] In the present invention, high-throughput screening and mass spectrometry analysis were performed, and it was found that HECTD2 could bind to KEAP1 and downregulate the expression of KEAP1; KEGG analysis showed that the signaling pathways mediated by HECTD2 were mainly enriched in oxidative stress, drug metabolism and ubiquitination; in addition, GST-pulldown, co-IP and immunofluorescence results confirmed the direct interaction between HECTD2 and KEAP1; overexpression or downregulation of HECTD2 had no obvious effect on the expression of KEAP1 mRNA, but would affect the protein expression level of KEAP1; ectopic expression of HECTD2 would reduce the expression of KEAP1 The half-life of KEAP1 protein was decreased by 1.5 fold, while MG-132 treatment restored it. In vivo ubiquitination experiments verified that knocking out HECTD2 inhibited KEAP1 ubiquitination and promoted KEAP1 protein expression, while overexpression of HECTD2 promoted KEAP1 ubiquitination and inhibited KEAP1 protein expression. Using various domain-specific mutations, direct interactions between the HECT domain of HECTD2 and the DGR domain of KEAP1 protein were found. In addition, site-specific mutations were constructed, confirming that HECTD2 can add K48-linked polyubiquitin chains to the K551 residue of KEAP1. These results indicate that KEAP1 is a new substrate of the E3 ubiquitin ligase HECTD2 in HCC.

[0213] Lactylation modification is believed to be involved in a variety of biological processes, and histone lactylation plays a fundamental regulatory role in gene transcription; the involvement of lactylation in lenvatinib resistance is still unclear; the present invention shows that compared with lenvatinib-sensitive HCC, lenvatinib-resistant HCC exhibits more severe hypoxia levels, excessive lactate accumulation, and higher pan-lactylation levels; further studies have shown that H3K18la modification is an upstream mechanism of HECTD2 transcriptional activation in lenvatinib-resistant HCC; H3K18la is reported to be associated with enhanced transcription of target genes; in idiopathic pulmonary fibrosis In HCC, H3K18la favors the transcription of YTHDF1, thereby promoting the m6A modification of NREP; in colorectal cancer, H3K18la can activate the transcription of NSUN2; increased H3K18la in neurons can stimulate the transcription of Piezo2; it is confirmed that H3K18la promotes the transcription of HECTD2 in HCC and ultimately leads to resistance to lenvatinib treatment; the results elucidate the upstream regulation of HECTD2 and provide evidence for the intertwined association between lactoylation and ubiquitination in lenvatinib resistance in HCC.

[0214] In summary, the present invention shows that HECTD2, as an E3 ubiquitin ligase, adds K48-linked polyubiquitin chains on the K551 residue of KEAP1, thereby alleviating oxidative stress stimulated by lenvatinib treatment; H3K18la enhances the transcription of HECTD2; the expression level of HECTD2 is an independent predictor of the prognosis of HCC patients; the present invention provides a new perspective for understanding the resistance of HCC to lenvatinib, and may provide a promising diagnostic and therapeutic strategy for the clinical treatment of HCC.

[0215] The above-mentioned embodiments are only preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by technicians in this field on the basis of the present invention shall fall within the scope of protection required by the present invention.

Claims

1. A marker for predicting the sensitivity of liver cancer to lenvatinib treatment, characterized in that: The marker includes HECTD2, and the nucleotide sequence of HECTD2 is shown in SEQ ID NO:

1.

2. A marker for predicting the sensitivity of liver cancer to lenvatinib treatment according to claim 1, characterized in that: HECTD2 limits oxidative stress through KEAP1 / NRF2 to promote lenvatinib resistance.

3. A marker for predicting the sensitivity of liver cancer to lenvatinib treatment, characterized in that: The marker includes H3K18la, and the nucleotide sequence of H3K18la is shown in SEQ ID NO:

2.

4. A marker for predicting the sensitivity of liver cancer to lenvatinib treatment according to claim 3, characterized in that: The H3K18la induces upregulation of HECTD2 in HCC cells, thereby promoting lenvatinib resistance.

5. A marker for predicting the sensitivity of liver cancer to lenvatinib treatment, characterized in that: The primers include a HECTD2-PCR primer pair, which includes a forward primer HECTD2-PCR-F having a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer HECTD2-PCR-R having a nucleotide sequence as shown in SEQ ID NO:

4.

6. A marker for predicting the sensitivity of liver cancer to lenvatinib treatment according to claim 5, characterized in that: The HECTD2-PCR primers inhibit HECTD2 expression, thereby reducing lenvatinib resistance.

7. A biological product for predicting the sensitivity of liver cancer to lenvatinib treatment, characterized in that: The biological product includes a marker, and the marker includes at least one of HECTD2, H3K18la and a HECTD2-PCR primer pair.

8. A biological product for predicting the sensitivity of liver cancer to lenvatinib treatment according to claim 7, characterized in that: The biological products include: reagents, test kits, and chips.

Images