Tightly linked molecular marker Site1773 for the leaf yellowing trait in melon and its application

Through Site1773, a molecular marker with tightly linked traits of melon leaf yellowing, PCR and electrophoresis technology were used to identify leaf yellowing mutants in the melon seedling stage, solving the problem of difficult prediction of leaf yellowing mutants in melon breeding, and achieving early identification and efficient breeding.

CN119391890BActive Publication Date: 2025-08-12HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411308705.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-19
Publication Date
2025-08-12
Estimated Expiration
2044-09-19

AI Technical Summary

Technical Problem

In melon breeding, leaf yellowing mutants lead to problems such as decreased photosynthetic rate, dwarfing, and reduction in yield, which affects the growth and economic value of melons. It is difficult for the existing technology to effectively predict and eliminate these mutants.

Method used

The molecular marker Site1773, which is closely linked to the yellowing traits of melon leaves, was developed, and the leaf yellowing mutants were identified in the seedling stage of melon seedlings by PCR amplification and polyacrylamide gel electrophoresis. Specific primers Site1773F and Site1773R were designed for DNA detection through InDel labeling assisted breeding method.

Benefits of technology

Early prediction and accurate identification of leaf yellowed mutants during melon breeding process has been achieved, which has reduced breeding costs and time, improved breeding efficiency, and improved the breeding efficiency and product quality of melons.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391890B_ABST
    Figure CN119391890B_ABST
Patent Text Reader

Abstract

The molecular marker Site1773, tightly linked to the leaf yellowing trait in muskmelon, and its application, belong to the field of plant molecular genetics and breeding research. This molecular marker was used to detect leaf yellowing in several natural muskmelon populations. Using DNA from candidate material as a template, primers for the molecular marker Site1773 were used for PCR amplification. The amplified product was subjected to polyacrylamide gel electrophoresis and combined with field trait analysis. The molecular marker achieved 100% accuracy in seedling identification. This molecular marker is of great value in muskmelon production and breeding practices. Its simple operation, high stability, rapidity, and accuracy provide a new method for assisted selection in melon molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the research field of plant molecular genetic breeding and provides a molecular marker Site1773 tightly linked to the yellowing trait of melon leaf color and an application thereof. Background Art

[0002] Muskmelon (Cucumis melo L.) is a key commercial crop in the Cucurbitaceae family, widely favored by consumers for its unique color, aroma, and flavor, and widely cultivated both domestically and internationally. Leaves are the primary site of photosynthesis in plants, and leaf color largely determines the plant's total photosynthetic productivity. However, various mutations are common in melon cultivation and breeding, with yellow leaf mutants being a particularly common type. Yellow leaf mutants exhibit low chlorophyll content and reduced photosynthetic rate, leading to dwarfing, yield reduction, and even mortality, severely negatively impacting crop growth and the production of commercial products. In melons, yellow leaf mutants begin to exhibit yellowing at the cotyledon stage and persist throughout their entire growth cycle. Furthermore, yellow leaf mutants exhibit dwarfed, thin plants, small fruits with poor marketability, poor taste, and low fruit set rates, severely impacting the commercial properties of melons and directly reducing their yield and economic value. Fruits with yellow leaf color mutants exhibit yellow skin before maturity and slow fruit expansion, significantly reducing their marketability. Therefore, timely prediction and elimination of melon leaf color mutants can improve melon product quality. Elucidating the genetic basis and regulatory mechanisms underlying the development of yellow leaf color mutants in melons provides valuable insights into leaf color mutants and has practical implications for accelerating melon leaf color research and molecular breeding. Summary of the Invention

[0003] Based on the research in the background technology section, the present invention provides a molecular marker Site1773 closely linked to the yellowing leaf trait of melon and its application. The leaf yellowing mutant melon variety ZT00091 is used as the female parent and the normal leaf color melon variety ZT249 is used as the male parent. The hybrid combination is configured to obtain F1, and the obtained F1 is continuously self-pollinated to obtain its F2 and F 2:3 The F2 population was used to preliminarily locate the yellowing trait of melon leaf color. 2:3 The family was used for fine mapping of candidate genes. According to the results of BSA (Bulk Segregating Analysis), the 8.49 Mb obtained by F 2:3 Further fine positioning of the family narrowed the candidate interval and selected more efficient molecular markers linked to the melon leaf yellowing trait, which can be directly used to identify leaf yellowing mutants in the offspring of melon plants.

[0004] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0005] The molecular marker Site1773, which is tightly linked to the melon leaf yellowing trait, has a primer sequence of:

[0006] Site1773F:TCCCATACCAAAACACAA,

[0007] Site1773R:AACTTGTTCAGCCGGATTCA.

[0008] The molecular marker Site1773 is used to identify leaf yellowing mutants in offspring of melon plants at the seedling stage.

[0009] Furthermore, the application is: using the molecular marker for early prediction in the seedling stage of several natural melon populations, using the DNA of the selected material as a template and the primers of the molecular marker Site1773 for PCR amplification, subjecting the amplified product to polyacrylamide gel electrophoresis and combining it with field trait analysis.

[0010] Furthermore, the application is:

[0011] (1) Using the DNA of the material to be identified as a template, PCR amplification was performed using primers for the molecular marker Site1773; PCR product detection: the reaction product was electrophoresed on a 7% non-denaturing polyacrylamide gel and stained with silver nitrate;

[0012] (2) Identification of labeled primers: After the DNA sample to be tested is amplified by PCR, it can be detected by electrophoresis. The 158bp specific band is a mutant variety with yellow leaf color, the 147bp and 158bp hybrid bands are intermediate varieties, and the 147bp band is a variety with normal leaf color.

[0013] Furthermore, in step (1), the PCR amplification system is 10 μL: including 1 μL of Site1773F, 1 μL of Site1773R, 3 μL of Taq Master Mix, 1 μL of DNA template, and 4 μL of ddH2O.

[0014] Furthermore, in step (1), the PCR amplification procedure was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, (denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s repeated for 35 cycles), extension at 72°C for 10 min, and storage at 4°C.

[0015] The beneficial effects of the present invention compared to the prior art are:

[0016] 1. InDel (Insertion-deletion) molecular markers are designed based on sequences flanking an insertion / deletion site, using specific primers for PCR amplification. Essentially, they are length polymorphic markers and can be typed using polyacrylamide gel electrophoresis. Based on BSA sequencing technology and by comparing melon genomic data, the present invention has designed and developed InDel markers linked to the melon leaf yellowing trait. Using InDel molecular marker-assisted breeding methods, the probability of leaf yellowing mutants in melon plant offspring can be identified during the seedling stage. Utilizing this molecular marker significantly reduces the investment in manpower and material resources, lowers breeding costs, and shortens the breeding cycle.

[0017] 2. By using the specific primer pair provided by the present invention to detect the genomic DNA of the melon to be tested using the PCR method, the InDel molecular marker Site1773 was amplified. The gene amplification product of the melon leaf color yellow mutant material was 158 bp, and the gene amplification product of the melon normal leaf color trait material was 147 bp. Through this molecular marker, breeders can more effectively predict and screen melon plants with the genetic trait of melon leaf color yellow, greatly improving the breeding efficiency of melon.

[0018] 3. The molecular markers of the present invention have important value in melon production practice and breeding.

[0019] 4. The operation method of the present invention is simple and has strong stability, providing a new method for melon molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a fine-grained mapping of the yellowing trait of melon leaves;

[0021] Figure 2 Electropherograms of the melon Site1773 marker detected in 24 natural populations. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention that does not depart from the spirit and scope of the technical solution of the present invention should be included in the scope of protection of the present invention.

[0023] The present invention studies the genetic mechanism and gene location of the yellow leaf mutant of melon. Using the yellow leaf mutant melon variety ZT00091 as the female parent and the normal leaf color melon variety ZT249 as the male parent, a hybrid combination was prepared to construct the F2 segregating population and the F 2:3 The gene of the melon leaf yellowing mutant was preliminarily located using the F2 segregating population. 2:3The family was further fine-mapped to identify the candidate region controlling yellow leaf color and to design molecular markers linked to the yellow leaf color mutation in melon.

[0024] Specific embodiment 1: This embodiment describes a molecular marker Site1773 that is closely linked to the melon leaf yellowing mutation, and its primer sequence is:

[0025] Site1773F:GCACAACTCTTAAAGAAAACCCA,

[0026] Site1773R:TCCCATACCAAAACACAA.

[0027] The method for obtaining the molecular marker Site1773 is as follows:

[0028] 1. Construction of melon genetic population

[0029] The leaf yellow mutant muskmelon variety ZT00091 was used as the female parent and the normal leaf color muskmelon variety ZT249 was used as the male parent to configure the hybrid combination "ZT00091×ZT249" to obtain the F1 population, and the F1 was self-pollinated to obtain the F2 segregating population, and the obtained F2 segregating population was self-pollinated to obtain the F 2:3 Family. The hybridization of male and female parents can produce numerous F1 plants, the genotype and phenotype of these plants are consistent, and F1 plants can be randomly selected and self-fertilized to obtain F2 plants, and F2 plants can be randomly selected and self-fertilized to obtain F 2:3 family lineage;

[0030] In 2022, ZT00091 (20 plants), ZT249 (20 plants), F1 single plants (20 plants), and F2 segregating populations (193 plants) were planted at the Heilongjiang Bayi Agricultural University Space Breeding Base; in 2023, F 2:3 Families (320 families in total, 10 plants in each family). The above melon materials were all grown in greenhouses, with conventional water and fertilizer management and single-plant pollination.

[0031] 2. Extraction of genomic DNA and construction of gene pool

[0032] CTAB method was used to extract 320 F 2:3 Genomic DNA of the family.

[0033] 3. InDel molecular marker screening

[0034] By using the yellowing leaf mutant melon variety ZT00091 and the normal leaf color melon variety ZT249 as the male parents for high-throughput sequencing, the genome sequence information of the two parents was obtained, the differential sites between the two parents were analyzed and compared, and the molecular markers closely linked to the yellowing leaf mutant of melon were obtained using the BSA method. A total of 30 pairs of molecular markers were designed and developed. PCR amplification and polymorphism screening were performed between the gene pool of the yellowing leaf mutant melon and the gene pool of the normal leaf color melon varieties, and a total of 8 pairs of primers were screened. Figure 1 As shown, based on the molecular markers linked to the melon leaf yellowing mutant trait, Site1773 was found to be tightly linked to the melon leaf yellowing mutant trait.

[0035] Specific embodiment 2: This embodiment provides a method for molecular marker Site1773 linked to the trait of melon leaf yellowing mutant, and the specific steps are as follows:

[0036] (1) DNA was extracted from the sample to be tested and PCR amplified using the molecular marker Site1773. The 10 μL PCR reaction system consisted of: 1 μL of 50-100 ng / μL DNA, 1 μL of each upstream and downstream primer of Site1773, 3 μL of Taq enzyme mix, and 4 μL of ddH2O. PCR amplification conditions were: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 35 cycles from step 2 to step 4, extension at 72°C for 10 min, and storage at 4°C.

[0037] (2) After the DNA sample is amplified by PCR, the 158 bp fragment detected by electrophoresis is the melon material with yellow leaf color mutant, while the 147 bp fragment is the melon material with normal leaf color. Figure 2 As shown, the DNA2000Maker M-band shows: Band 1 represents the female parent, the yellow leaf mutant muskmelon ZT00091; Band 2 represents the male parent, the normal leaf color muskmelon ZT249; Band 3 is a heterozygous F1 band with a normal leaf color phenotype; Bands 4-11 are identical to ZT00091, representing a cultivar with yellow leaf color; Bands 12-19 are identical to ZT249, representing a cultivar with normal leaf color; Bands 20-27 are intermediate, representing a cultivar with a yellow leaf color phenotype in its offspring. The accuracy of identifying the yellow leaf color trait in muskmelon is 100%. Therefore, amplification of tightly linked markers can accurately distinguish different genotypes at the locus of the yellow leaf mutant trait in muskmelon, achieving the goal of assisted breeding.

Claims

1. Application of primers for molecular marker Site1773 in identifying the leaf yellowing trait of melon plants at the seedling stage, characterized by: The primer sequence of the molecular marker Site1773 is: Site1773F:GCACAACTCTTAAAGAAAACCCA, Site1773R:TCCCATACCAAAACACAA.

2. Use of the primers for the molecular marker Site1773 according to claim 1 in identifying the leaf yellowing trait of melon plants at the seedling stage, characterized in that: The application is: using molecular markers to make early predictions in the seedling stage of several natural melon populations, using DNA of the selected material as a template and primers of the molecular marker Site1773 to perform PCR amplification, subjecting the amplified products to polyacrylamide gel electrophoresis and combining them with field trait analysis.

3. Use of the primers for the molecular marker Site1773 according to claim 2 for identifying the leaf yellowing trait of melon plants at the seedling stage, characterized in that: The applications are: (1) Using the DNA of the material to be identified as a template, PCR amplification is performed using primers of the molecular marker Site1773; PCR product detection: The reaction products were electrophoresed on 7% non-denaturing polyacrylamide gel and stained with silver nitrate; (2) Identification of labeled primers: After the DNA sample to be tested is amplified by PCR, it can be detected by electrophoresis. The 158bp specific band is a mutant variety with yellow leaf color, the 147bp and 158bp hybrid bands are intermediate varieties, and the 147bp band is a variety with normal leaf color.

4. Use of the primers for the molecular marker Site1773 according to claim 3 for identifying the yellowing trait of leaf color in melon plants at the seedling stage, characterized in that: In step (1), the PCR amplification system is 10 μL: including 1 μL of Site1773F, 1 μL of Site1773R, 3 μL of Taq Master Mix, 1 μL of DNA template, and 4 μL of ddH2O.

5. Use of the primers for the molecular marker Site1773 according to claim 3 in identifying the leaf yellowing trait of melon plants at the seedling stage, characterized in that: In step (1), the PCR amplification procedure was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, repeating steps 2 to 4 for 35 cycles, extension at 72°C for 10 min, and storage at 4°C.

Citation Information

Patent Citations

  • Molecular marker based on muskmelon leaf yellowing characteristic SNP (Single Nucleotide Polymorphism) site and application of molecular marker

    CN117925882A

  • CVYV-Resistant Plants of the Species Cucumis Melo

    US20110214202A1