Automated microbial fluid sampling and analysis system and method

Abstract

Automated microbial fluid sampling and analysis systems and methods are disclosed herein. Such a system may include a processor that may execute stored computer instructions to control an air sampling and analysis system; a consumable cartridge comprising a cartridge body and a sample capture substrate (SCS); an air handler for moving air through the SCS; the thermal circulator is used for enabling the air sampling reaction chamber to reach one or more required temperatures so as to directly perform nucleic acid amplification on the SCS; and an optical device capable of measuring a fluorescence signal from the air sampling reaction chamber. The system can automatically collect samples, and can automatically perform nucleic acid amplification and analysis.

Description

Background Art

[0001] Throughout human history, improvements in cleanliness have led to better health and longer lifespans. This is true for both simple improvements, such as better personal hygiene, and more complex ones, such as the development of treated water and sewage systems.

[0002] The SARS-CoV-2 outbreak has powerfully demonstrated the need for further improvements in cleanliness. In particular, there are currently limited avenues for detecting and / or limiting airborne pathogens. Many countries have experienced extremely harmful lockdowns, illness, and death due to the inability to detect and / or limit airborne pathogens.

[0003] While SARS-CoV-2 exhibits deficiencies in the detection and treatment of airborne pathogens, similar deficiencies exist in other settings where target agents or pathogens are present at low levels. Thus, there is a need for improved detection of target agents and / or pathogens, including airborne pathogens. Summary of the invention

[0004] A system of one or more computers can perform specific operations or actions by installing software, firmware, hardware or a combination thereof on the system, which software, firmware, hardware or a combination thereof causes the system to perform actions in operation. One or more computer programs can perform specific operations or actions by including instructions, which, when executed by a data processing device, cause the device to perform actions. A general aspect includes an air sampling and analysis system. The air also includes a processor that can execute stored computer instructions to control the air sampling and analysis system. The air also includes a consumable box that includes a box body and a sample capture substrate (SCS). The air also includes an air handler that can pass air through the SCS. The air also includes a thermal cycler that can make the air sampling reaction chamber reach one or more desired temperatures to perform nucleic acid amplification directly on the SCS. The air also includes an optical device that can measure the fluorescent signal from the air sampling reaction chamber. Other embodiments of this aspect include corresponding computer systems, devices, and computer programs recorded on one or more computer storage devices, each of which can perform the actions of the method.

[0005] Embodiments may include one or more of the following features. The system also includes a communication module for electronically transmitting data to another system and optionally receiving operating instructions. The SCS extends to an air sampling reaction chamber defined by a box body. The box receptacle includes at least one seal that can be sealably coupled to the box body around the air sampling reaction chamber, thereby sealing the air sampling reaction chamber and the SCS. The volume of the sealed air sampling reaction chamber is between 501 and 2001. The volume of the sealed air sampling reaction chamber is approximately 1001. The box body includes a front and a rear portion, wherein the seal includes a first seal and a second seal, wherein the first seal can be sealably coupled to the front of the box body around the air sampling reaction chamber, and wherein the second seal can be sealably coupled to the rear of the box body around the air sampling reaction chamber. The first seal is sealably coupled to the front of the box body and the second seal is sealably coupled to the rear of the box body, sealing the air sampling reaction chamber and the SCS. The first seal is transparent, wherein the box receptacle is positioned relative to the optical device to expose the SCS to the optical device through the first seal. The system also includes an adhesive that can sealably couple the seal to the box body around the air sampling reaction chamber. The adhesive is heat activated. The adhesive extends to the periphery of the seal. The system also includes a sealer that can seal the seal to the box body. The system also includes: a mechanism for ejecting a used box body and positioning a new box body for sample capture and analysis; and a cassette including a plurality of new box bodies and a box receiver. The box body includes a first container capsule containing a dry reagent and a second container capsule containing an aqueous reagent. The box body also includes a first fluid channel coupling the first container capsule and the second container capsule, and a second fluid channel coupling the first container capsule and the air sampling reaction chamber. Each of the first container capsule and the second container capsule is separated into a first chamber and a second chamber by a membrane. The first chamber of the first container capsule contains a dry reagent, wherein the first chamber of the second container capsule contains an aqueous reagent, and wherein the second chamber of each of the first container capsule and the second container capsule contains at least one puncture feature that can pierce the membrane and release the contents of the first chamber. The first fluid channel and the second fluid channel are coupled to the second chamber of the first container capsule, and wherein the first fluid channel is coupled to the second chamber of the second container capsule. The system also includes: a first actuator capable of piercing the membrane of the first containing capsule; a second actuator capable of compressing the second containing capsule to pierce the membrane; and a third actuator for compressing the first containing capsule to move the contents of the first containing capsule into the air sampling reaction chamber. The processor can: control the first actuator and the second actuator to mix the aqueous reagent and the dry reagent; and control the third actuator to move the mixed reagent into the air sampling reaction chamber through the second fluid channel. The consumable box includes one or more containing capsules, and the containing capsules contain nucleic acid amplification primers specific for at least one of the following: Clostridium botulinum, Listeria monocytogenes, Campylobacter,trichinellosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Bacillus anthracis, Acinetobacter baumannii including multidrug-resistant Acinetobacter baumannii, Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli including fluoroquinolone-resistant Escherichia coli and O157:H7 Escherichia coli, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B and C), coronaviruses (including SARS-CoV, SARS cov-2 (including alpha (bl1.7 and q lineages), beta (b.1.351 and descendant lineages), gamma (pl and descendant lineages), epsilon (b.1.427 and b.1.429), eta (b.1.525), iota (b.1.526), ​​kappa (b.1.617.1 and 1.617.3), mu (b.1.621, b.1.621.1), zeta (p.2), delta (b.1.617.2 and ay lineages), and omicron (b.1.1.529 and bah lineages)), as well as middle east respiratory syndrome, adenovirus, influenza virus (including type a and type b); parainfluenza virus; respiratory syncytial virus (including type a and type b); enterovirus; norovirus (including genogroups gi, gii, giii, giv, gv, gvi, and gvii); rotavirus, astrocytosis viruses that cause measles, rubella, varicella / shingles, roseola, smallpox, and fifth disease, chikungunya, hepatitis (including A, B, C, D, and E), herpes, papillomaviruses; molluscum contagiosum; polio; rabies, viruses that cause viral meningitis and encephalitis, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6 、H5N8、H5N9、H6N1、H6N2、H7N1、H7N2、H7N3、H7N4、H7N7、H7N9、H9N2、H10N7、H10N8、H11N2、H11N9、H17N10、H18N11、HPV-1、HPV-2、HPV-3、HPV-4、HADV-B、HADV-C、229E、OC43、NL63、HUK1、Sin Nombre Hantavirus、Black Creek Canal Hantavirus、Pumala Virus、Talander Virus、HRV-A1、HRV-A2、hrv-a7-13, hrv-a15, hrv-a16, hrv-a18-25, hrv-a28-34, hrv-a36, hrv-a38-41, hrv-a43-47, hrv-a49-51, hrv-a53-68, hrv-a71, hrv-a73-78, hrv-a8 0-82, hrv-a85, hrv-a88-90, hrv-a94-96, hrv-a98, hrv-a100-103, hrv-b3-6, hrv-b14, hrv-b17, hrv-b26, hrv-b27, hrv-b35, hrv-b37, hrv-b42, hrv- b48, hrv-b52, hrv-b69, hrv-b70, hrv-b72, hrv-b79, hrv-b83, hrv-b84, hrv-b86, hrv-b91-93, hrv-b97, hrv-b99 and hrv-c1-51, human-associated microorganisms such as actinomycetes, aerobic bacteria, akima, acrocystis, anaerobic cocci, anaerobes, mirabilis, bacteroides, bamiella, bifidobacterium, blautella, butyrivibrio, chlamydia, clostridium, corynebacterium, propionibacterium (formerly known as propionibacterium), bacillus, bichromococcus, enterobacterium, enterococcus, escherichia coli, faecalis, fusobacterium, gardnerella, bacillus, haemophilus, gram Rabbiella, Lactobacillus kluyveri, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, Mobiluncus, Moraxella, Mycobacterium, Mycoplasma, Neisseria, Oxalobacter, Papilloma, Parabacteroides, Micromonas, Peptotrophic, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Roseburia, Ruminococcus, Snailia, Spirochetes, Staphylococcus, Streptococcus, Villous, Alternaria, Aspergillus, Candida, Cladosporium, Curvularia, Ebeli, Fusarium, Penicillium, Saccharomyces, Stachybotrys, Thermophilic fungi, Trichophyton, Malassezia and Rhodotorula, Human RNase-P, Allergic molds including Alternaria, Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium , Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium filutanum, Echinococcus, and Penicillium virens), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum, and Fusarium moniliforme), Pullulan, Phoma, Smut, Rhizopus, and Mucor, and pollen, including pollen from plants and trees, including ragweed, mountain cedar, ryegrass, maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, North American maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper,Oak, hickory, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, cattail, plantain, quinoa, red amaranth, sagebrush and tumbleweed (Russian thistle). The optical device can measure the fluorescence signal of at least four channels. The processor can control the air handler to move air through the SCS at a desired flow rate. The flow rate is between 0.1lpm / mm2 of the SCS and 10lpm / mm2 of the SCS. The system is capable of collecting and analyzing 10 to 80 air samples per day, and wherein at least some of these air samples are collected by passing approximately 500l of air through the SCS and passing 100,000l of air through the SCS. The system is capable of generating less than 50db at a distance of 36 inches from the system at a flow rate between 0.1lpm / mm2 and 10lpm / mm2 of the SCS. The flow rate is about 100 1pm. The area of ​​the SCS is between 0.5 mm2 and 2,000 mm2. The thickness of the SCS is between about 0.02 mm and 0.5 mm. The air handler and the SCS can achieve a pressure drop between about 1 kPa and 30 kPa. The weight of the SCS is between about 5 g / m2 and about 60 g / m2. The SCS has at least one of the following: an area of ​​about 115 mm2; a width or diameter of about 12 mm. The system is capable of collecting and analyzing up to about 32 air samples per day, at least some of which are collected by passing about 3,000 liters of air through the SCS. During the reverse transcription phase prior to the nucleic acid amplification phase, the thermal cycler can maintain the reaction chamber at a temperature between 20C and 60C. Cleavage of the analyte occurs during the sample capture and reverse transcription phases. The target nucleic acid can be exposed to reagents during the sample capture and reverse transcription phases. The system performs RT-qPCR. The implementation of the technology may include hardware, methods or processes, or computer software on a computer-accessible medium. ,

[0006] A general aspect includes an automated air sampling and analysis method. The automated air sampling method further includes: passing air through a sample capture matrix (SCS) to capture analytes. The automated air sampling method further includes: enclosing the SCS within a reaction chamber. The automated air sampling method further includes: performing a nucleic acid amplification reaction directly on the SCS within the reaction chamber. The automated air sampling method further includes: measuring fluorescent signals from the reaction chamber and the SCS, wherein the method is performed within a single instrument without human intervention. Other embodiments of this aspect include corresponding computer systems, apparatus, and computer programs recorded on one or more computer storage devices, each of which can perform the actions of the method.

[0007] Implementations may include one or more of the following features. The method also includes: detecting the presence of one or more airborne pathogens based on the measured fluorescent signal. The method also includes: transmitting the results to another system. The results indicate that the presence of one or more airborne pathogens is detected. The method also includes: detecting the absence of one or more airborne pathogens based on the measured fluorescent signal. The method also includes transmitting the results to another system. Air passes through the SCS at a rate between about 1 lpm / mm2 of the SCS and 5 lpm / mm2 of the SCS. The method also includes: generating less than 50 db at a flow rate between 0.1 lpm / mm2 of the SCS and 10 lpm / mm2 of the SCS at a distance of 36 inches. The SCS is connected to a box body, and the box body defines a reaction chamber. The diameter of the reaction chamber defined by the box body is between about 1 mm and 50 mm. The thickness of the SCS is between about 0.02 mm and 0.5 mm. The weight of the SCS is between about 1 g / m2 and 100 g / m2. Enclosing the SCS within the reaction chamber comprises: inserting the cartridge body at least partially into a cartridge receptacle comprising a first seal and a second seal; and sealing the seal around a perimeter of the reaction chamber defined by the cartridge body. The volume of the enclosed reaction chamber is between about 501 and about 2001. The volume of the enclosed reaction chamber is about 1001. The SCS fills about 1L of chamber volume / mm2 of the SCS. The cartridge body comprises a front portion and a rear portion, wherein the seal comprises a first seal and a second seal, and wherein sealing the seal around a perimeter of the reaction chamber defined by the cartridge body comprises: sealing the first seal to the front portion of the cartridge body; and sealing the second seal to the rear portion of the cartridge body. Performing the nucleic acid amplification reaction directly on the reaction chamber and the SCS comprises: filling the reaction chamber with a nucleic acid amplification reagent; and thermal cycling the reaction chamber and the SCS. Filling the reaction chamber with a nucleic acid amplification reagent comprises: mixing an aqueous nucleic acid amplification reagent with a dry nucleic acid amplification reagent; and filling the mixed nucleic acid amplification reagent into the reaction chamber. The dry nucleic acid amplification reagent is contained in a first containing capsule, wherein the aqueous nucleic acid amplification reagent is contained in a second containing capsule, wherein the first containing capsule and the second containing capsule are connected by a first fluid channel, and wherein the first containing capsule and the reaction chamber are connected by a second fluid channel. Mixing the aqueous nucleic acid amplification reagent with the dry nucleic acid amplification reagent comprises: compressing the second containing capsule to move at least some of the aqueous nucleic acid amplification reagent to the first containing capsule to mix with the dry nucleic acid amplification reagent, and wherein filling the mixed nucleic acid amplification reagent into the reaction chamber comprises: compressing the first containing capsule to move at least some of the mixed nucleic acid amplification reagent from the first containing capsule to the reaction chamber via the second fluid channel.The method also includes: ejecting the cartridge body after completing the measurement of the fluorescent signal from the reaction chamber and the SCS; retrieving a new cartridge body from a cassette containing a plurality of unused cartridge bodies; and positioning the new cartridge body so that air passes through the SCS of the new cartridge body. The total autofluorescence of the SCS is less than 50% of the baseline fluorescence. The nucleic acid amplification reaction includes at least one of: qPCR, PER, RT-PCR, RT-qPCR, digital PER, isothermal amplification process, immuno-PCR, and proximity ligation PER. After collecting the sample, analyzing each of the 6 to 48 samples includes: enclosing the SCS in the reaction chamber, performing the nucleic acid amplification reaction directly on the reaction chamber and the SCS, and measuring the fluorescent signal from the reaction chamber and the SCS. Each collected sample captures analytes from about 500 liters of air passing through the SCS to about 5,000 liters of air passing through the SCS. Air sampling begins upon receiving a signal from another system that is initiated in response to a rise in carbon dioxide levels above a threshold level within the building where the system is located. Wherein the SCS is not electrostatically charged. Implementations of the techniques may include hardware, a method or process, or computer software on a computer-accessible medium.

[0008] One general aspect includes a system for air sampling. The system also includes a consumable box, the consumable box including: a box body, which defines an air sampling reaction chamber, and a sample capture substrate coupled to the box body and extending through the air sampling reaction chamber. The system also includes a box receptacle, the box receptacle defining a container that can receive the sample capture substrate, wherein the box receptacle includes a first seal and a second seal, the first seal and the second seal can be sealingly coupled to the box body around the air sampling reaction chamber, thereby enclosing the air sampling reaction chamber, wherein the sample capture substrate is enclosed within the air sampling reaction chamber. Other embodiments of this aspect include corresponding computer systems, apparatus, and computer programs recorded on one or more computer storage devices, each of which can perform the actions of the method.

[0009] Implementations may include one or more of the following features. A system in which an air sampling reaction chamber is integrated into a box body. Air sampling is performed within a predetermined number of hours, the predetermined number of hours corresponding to human occupancy time above a certain human density per square foot. A sample capture substrate is coupled to the box body around the perimeter of the air sampling reaction chamber. The sample capture substrate can capture airborne microorganisms. The sample capture substrate includes at least one of: polypropylene; polytetrafluoroethylene (ptfe); and polycarbonate. The sample capture substrate includes melt-blown polypropylene. The sample capture substrate does not exhibit autofluorescence or exhibits autofluorescence at a level that does not interfere with nucleic acid amplification analysis using fluorescent probes for target identification. The sample capture substrate produces less than 5% of the total system fluorescence. The sample capture substrate exhibits autofluorescence less than 50% of the baseline fluorescence. The sample capture substrate does not inhibit nucleic acid amplification reactions. The sample capture substrate is stable at temperatures between 4°C and 100°C. At least one seal is transparent. At least one seal includes at least one of: polycarbonate, polyester, polyethylene terephthalate, glass, and polypropylene. At least one seal includes an extruded film. The thickness of at least one seal is less than about 200 μm. The thickness of at least one seal is between about 50 μm and about 500 μm. The system also includes an adhesive that can sealably couple the seal to the box body around the air sampling reaction chamber. The adhesive is heat activated. The adhesive extends to the periphery of the seal. The box body includes a first containment capsule containing a dry reagent and a second containment capsule containing an aqueous reagent. The box body also includes: a first fluid channel coupling the first containment capsule and the second containment capsule, and a second fluid channel coupling the first containment capsule and the air sampling reaction chamber. Each of the first containment capsule and the second containment capsule is separated into a first chamber and a second chamber by a membrane. The first chamber of the first containment capsule contains the dry reagent, wherein the first chamber of the second containment capsule contains the aqueous reagent, and wherein the second chamber of each of the first containment capsule and the second containment capsule contains at least one puncture feature that can pierce the membrane and allow the contents of the first chamber to enter the second chamber. The first fluid channel and the second fluid channel are coupled to the second chamber of the first containing capsule, and wherein the first fluid channel is coupled to the second chamber of the second containing capsule. The dry reagent includes a freeze-dried nucleic acid amplification reagent, and wherein the aqueous reagent includes an aqueous nucleic acid amplification reagent. At least one reagent includes a surfactant. The surfactant includes at least one of the following: Tween; NP40; and Triton X-100. The width of the air sampling reaction chamber is between 1 mm and 50 mm. The air sampling reaction chamber is circular and has a diameter between 1 mm and 50 mm. When closed by the first seal and the second seal, the volume of the air sampling reaction chamber is between 101 and 2501.The volume of the closed air sampling reaction chamber is about 100 L. The system performs RT-qPCR. In some embodiments, the SCS is not electrostatically charged. Implementations of the technology may include hardware, methods or processes, or computer software on a computer-accessible medium.

[0010] A general aspect includes. The consumable sampling unit also includes a first portion that defines a sample capture substrate (SCS). The consumable sampling unit also includes a second portion that defines a container that can receive the SCS and enclose it in a reaction chamber, wherein the SCS is enclosed in the reaction chamber. The consumable sampling unit also includes at least one containing capsule that includes at least nucleic acid amplification reagents, wherein at least one containing capsule is capable of being coupled to the reaction chamber and the SCS fluid. Other embodiments of this aspect include corresponding computer systems, devices, and computer programs recorded on one or more computer storage devices, each of which can perform the actions of the method.

[0011] Implementations may include one or more of the following features. A consumable sampling unit, wherein at least one containment capsule includes: at least one first containment capsule containing a dry nucleic acid amplification reagent; and at least one second containment capsule containing an aqueous nucleic acid amplification reagent. At least one containment capsule is located on the first portion. At least one containment capsule is located on the second portion. At least one first containment capsule is located on one of the first portion and the second portion, and at least one second containment capsule is located on the other of the first portion and the second portion. At least one first containment capsule is fluidly connected to at least one second containment capsule and a reaction chamber. The first portion and the second portion are connected by a pivot. The first portion and the second portion are coupled. The first portion and the second portion are not connected. The SCS is not electrostatically charged. The sampling unit can collect a sample from air. The sampling unit can collect a sample from a liquid. A consumable sampling unit, wherein the SCS includes at least one of: a membrane; a swab; a brush; and a spoon. The chamber includes a reaction chamber. The consumable sampling unit also includes a second portion defining a container. The container can enclose the chamber of the first portion. The container can receive at least the chamber and the SCS. At least one containment capsule is located on the first portion. At least one containment capsule is located on the second portion. At least one containing capsule includes a first containing capsule containing a dry reagent and a second containing capsule containing an aqueous reagent. The consumable sampling unit also includes a first fluid channel coupling the first containing capsule and the second containing capsule, and a second fluid channel coupling the first containing capsule and the air sampling reaction chamber. Each of the first containing capsule and the second containing capsule is separated into a first chamber and a second chamber by a membrane. The first chamber of the first containing capsule contains a dry reagent, wherein the first chamber of the second containing capsule contains an aqueous reagent, and wherein the second chamber of each of the first containing capsule and the second containing capsule contains at least one puncture feature that can pierce the membrane and allow the contents of the first chamber to enter the second chamber. The first fluid channel and the second fluid channel are coupled to the second chamber of the first containing capsule, and wherein the first fluid channel is coupled to the second chamber of the second containing capsule. The dry reagent includes a lyophilized nucleic acid amplification reagent, and wherein the aqueous reagent includes an aqueous nucleic acid amplification reagent. At least one reagent includes a surfactant. The surfactant includes at least one of the following: tween; np40; and triton x-100. Wherein the SCS is not electrostatically charged. The implementation scheme of the technology may include hardware, methods or processes, or computer software on a computer-accessible medium.

[0012] Implementations may include one or more of the following features. A consumable sampling unit, wherein the SCS includes at least one of the following: a membrane; a swab; a brush; and a spoon. The chamber includes a reaction chamber. The consumable sampling unit also includes a second portion defining a container. The container can enclose the chamber of the first portion. The container can receive at least the chamber and the SCS. At least one containing capsule is located on the first portion. At least one containing capsule is located on the second portion. At least one containing capsule includes a first containing capsule containing a dry reagent and a second containing capsule containing an aqueous reagent. The consumable sampling unit also includes a first fluid channel coupling the first containing capsule and the second containing capsule, and a second fluid channel coupling the first containing capsule and the air sampling reaction chamber. Each of the first containing capsule and the second containing capsule is separated into a first chamber and a second chamber by a membrane. The first chamber of the first containing capsule contains a dry reagent, wherein the first chamber of the second containing capsule contains an aqueous reagent, and wherein the second chamber of each of the first containing capsule and the second containing capsule contains at least one piercing feature that can pierce the membrane and allow the contents of the first chamber to enter the second chamber. The first fluid channel and the second fluid channel are coupled to the second chamber of the first containing capsule, and the first fluid channel is coupled to the second chamber of the second containing capsule. The dry reagent includes a lyophilized nucleic acid amplification reagent, and the aqueous reagent includes an aqueous nucleic acid amplification reagent. At least one reagent includes a surfactant. The surfactant includes at least one of the following: tween; np40; and tritonx-100. Wherein the SCS is not electrostatic. The implementation scheme of the technology may include hardware, method or process, or computer software on a computer accessible medium. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is a schematic diagram of one embodiment of an environmental control system.

[0014] Figure 2 is a schematic diagram of one embodiment of a fluid sampling and analysis system.

[0015] Figure 3 is a diagrammatic representation of one embodiment of a sampling and analysis system.

[0016] Figure 4 is a perspective view of one embodiment of a sampling unit.

[0017] Figure 5 is a perspective view of one embodiment of a box body partially inserted into a box receptacle.

[0018] Figure 6 is an exploded view of one embodiment of a sampling unit.

[0019] Figure 7 is a perspective front view of another embodiment of a sampling unit.

[0020] Figure 8 is a perspective front view of another embodiment of a sampling unit with a cartridge body partially inserted into a cartridge receptacle.

[0021] Fig. 9 is a front view of another embodiment of a sampling unit.

[0022] Fig.10 is a rear view of another embodiment of a sampling unit.

[0023] Fig.11 is a perspective view of one embodiment of a transparent box body.

[0024] Fig.12 is a perspective cutaway view of one embodiment of a cartridge body.

[0025] Fig.13 is a side sectional view of an embodiment of the box body.

[0026] Fig.14 is an exploded perspective view of one embodiment of a sampling unit.

[0027] Fig.15 is a front view of one embodiment of a sampling unit.

[0028] Fig.16 is a perspective view of another embodiment of a sampling unit.

[0029] Fig.17 is a perspective view of another embodiment of a sampling unit with an SCS positioned in a holder.

[0030] Fig.18 is a perspective view of a flip cover embodiment of a sampling unit in an open configuration.

[0031] Fig.19 is a perspective view of a flip cover embodiment of a sampling unit in a closed configuration.

[0032] Fig. 20 is a perspective view of a flag embodiment of a sampling unit in an open configuration.

[0033] Fig.21 is a perspective view of a flag embodiment of a sampling unit in a closed configuration.

[0034] Fig. 22 is a perspective view of a sampling unit including a sleeve-shaped cartridge receptacle.

[0035] Fig.23 is a perspective view of a sampling unit including a flexible seal in an open configuration.

[0036] Fig.24is a perspective view of a sampling unit including a flexible seal in a closed configuration.

[0037] Fig.25 is a schematic diagram of one embodiment of operating a sampling unit.

[0038] Fig.26 is a flow chart illustrating one embodiment of a process for collecting and analyzing samples.

[0039] Fig. 27 is a flow chart illustrating one embodiment of a process for performing a nucleic acid amplification process.

[0040] Fig.28 Two graphs are shown, each depicting SARS-CoV-2 RT-qPCR curves from air and nasal swab samples.

[0041] Fig.29 Shown are graphs depicting RT-qPCR curves for the positive control and two SCS materials.

[0042] Fig.30 Shown is a graph depicting RT-qPCR curves evaluating the capture efficiency of SCS materials.

[0043] Fig.31 The capture of aerosol coronavirus and RT-qPCR amplification of aerosol coronavirus using a box body including a reaction chamber, to which the SCS is connected. DETAILED DESCRIPTION

[0044] Detecting targets in fluids can be challenging. This is especially true when the target concentration is low or the target size is small or difficult to capture and / or separate from the fluid.

[0045] These challenges are particularly acute when the target is a living organism. Challenges arise because wet biochemical reactions can be used to detect such biological analytes. While such assays are commonly performed on materials such as blood, urine, skin, and saliva, there are unique challenges in detecting one or more target analytes in other fluids such as water, sewage, or air. These challenges may be related to, for example, turnaround time, sensitivity, suppression, and automation.

[0046] Detection of target analytes, such as detection of airborne pathogens in human-occupied building environments, is most useful when the turnaround time from when sampling is completed to when results are produced is short. When samples are taken off-site for analysis, turnaround times can be hours or even days. To maximize the utility of the results, the assay should provide results quickly enough to allow implementation of measures to mitigate the impact of the detected target analyte. Such mitigation measures could include, for example, modifying ventilation parameters, controlling window opening, and / or evacuating areas and / or buildings containing pathogens.

[0047] Target analytes, such as pathogens, particularly airborne pathogens, can cause infection and / or allergic reactions even when present in very low concentrations. In addition, collecting a sample from a large volume of fluid (e.g., by pumping a large volume of air through a filter) is not a suitable solution. For example, increasing the amount of air passing through the filter increases the noise generated by the pump and / or blower driving the fluid through the filter. In addition, increasing the air flow rate through the filter also results in an increase in the noise generated by the air passing through the filter. In addition, increasing the flow rate through the filter increases the pressure drop across the filter, thereby requiring more expensive equipment and greater energy consumption. Finally, many materials that are capable of capturing biological pathogens (e.g., biological airborne pathogens) have a high resistance to airflow. This high airflow resistance results in a greater pressure drop across the filter and greater noise generation. Therefore, the sampling and analysis system must be sensitive enough to limit the amount of fluid passed through the filter to produce a sample.

[0048] Unlike tissue samples such as blood, many fluids, such as air (including air in buildings), sewage, or treated and / or untreated water, do not contain consistent types or concentrations of compounds. For example, air contains particles that vary widely in size, from submicron to visible to the human eye. The chemical composition of these particles varies greatly depending on building type, outdoor air conditions, building use, weather, geography, and many other factors. These compounds may inhibit nucleic acid amplification analysis, for example, may inhibit polymerase chain reaction ("PCR") analysis. Limiting inhibition (including inhibition caused by the sample) can beneficially improve the accuracy, speed, and / or effectiveness of analysis of the collected sample.

[0049] In order to be useful, the test system should be able to quickly collect and analyze samples. This can include collecting and analyzing a large number of samples over a period of time (e.g., a full day or part of a day). Diagnostic testing of air is traditionally a manual process, which is not conducive to quickly collecting and analyzing samples. In some embodiments, the sampling and analysis system can be automated, specifically, samples can be collected and analyzed by automation. For example, such a device can be programmed and / or controlled according to a stored computer code to perform determinations at any desired intervals and send the results to a control system (e.g., a building control system) electronically.

[0050] definition

[0051] As used herein, a "nucleic acid amplification process" is any process that amplifies one or more nucleic acids. This can include nucleic acid amplification processes, such as isothermal amplification or non-isothermal amplification, such as polymerase chain reaction (PCR). Specific examples include qPCR, RT-qPCR, PCR, RT-PCR, loop-mediated amplification (LAMP), recombinase polymerase amplification (RPA), transcription-mediated amplification (TMA), helicase-dependent amplification (HDA), amplification based on nucleic acid amplification (NASBA), rolling circle amplification (RCA), catalytic hairpin assembly (CHA), hybridization chain reaction (HCR), strand displacement amplification (SDA), and exponential amplification reaction (EXPAR).

[0052] As used herein, a "box" is a physical component for connecting to a sampling system, including a sample capture substrate ("SCS"). The box can include various shapes and sizes, and can be made of various materials. The box may include a box body, which can define a reaction chamber, also referred to as an "air sampling reaction chamber" herein. The SCS may extend through the reaction chamber. The box body may also include reagents for nucleic acid amplification processes. These reagents may include dry reagents (lyophilized reagents) and / or aqueous reagents. In some embodiments, these reagents may include one or more surfactants, probes (e.g., fluorescent probes), reverse transcriptases, DNA polymerases, oligonucleotides, etc. The box is also referred to as a "sampling unit" herein. In some embodiments, the box is a consumable and is used only once to analyze a sample captured by the SCS as part of the box.

[0053] The box can be used in combination with a fluid sampling and analysis system, or can be used without such a sampling and analysis system. In some embodiments, the box can be used to collect and analyze samples (e.g., fluids). In some embodiments, the box can be used to collect samples from fluids (e.g., air, water, sewage, body fluids, such as blood, saliva, urine, semen, mucus, bile, blood components, pus, etc.).

[0054] As used herein, a "box body" may be a portion of a box that can accommodate an SCS. Specifically, the box body may define a reaction chamber through which the SCS can extend. In addition, the box body may contain one or more reagents for performing a nucleic acid amplification process. These one or more reagents may be contained in one or more containment capsules formed in the box body. The box body may be made of a variety of materials, such as polypropylene, polycarbonate, etc.

[0055] As used herein, a "sample capture substrate", also referred to herein as an "SCS", is a substrate that can capture and / or hold a sample. In some embodiments, the SCS may include a substrate through which a liquid or gaseous medium can flow and from which analytes are captured. In embodiments where the medium is a liquid, the liquid may be, for example, water, sewage, bodily fluids, etc. In some embodiments, the gaseous medium may include air, such as air from a room, a building, a vehicle (e.g., a passenger compartment of a vehicle such as a bus, a train, an airplane, etc.), a portion of a building, etc. The SCS may also be referred to herein interchangeably as a filter membrane or a filter.

[0056] The SCS can be made of a variety of materials, including, for example, polypropylene (including meltblown polypropylene), polytetrafluoroethylene (PTFE), and polycarbonate. The SCS can be configured to be compatible with nucleic acid amplification. This can include being stable at temperatures used in the nucleic acid amplification process, and / or not inhibiting the nucleic acid amplification process. The SCS can also have no or limited autofluorescence. This can include producing less than a desired percentage of total system fluorescence, such as, for example, producing less than 5% of total system fluorescence in a qPCR reaction.

[0057] As used herein, a "box receiver" can be a component configured to engage with a box. The box receiver can include a variety of shapes and sizes and can be made of a variety of materials. The box receiver can include a body made of, for example, polycarbonate (particularly molded polycarbonate). The box receiver can also include one or more seals configured to seal around the reaction chamber of the box body.

[0058] As used herein, a "seal" may be a component configured to seal to a cartridge body and surround a reaction chamber to close one side of the reaction chamber. The seal may include a variety of shapes and sizes and may be made of a variety of materials, including, for example, glass, polycarbonate, polypropylene, polyester, polyethylene terephthalate, etc. The seal may include a film, and in some embodiments may include an extruded film. The seal may include, for example, a polycarbonate film, a polyester film, a polyethylene terephthalate film, or a polypropylene film.

[0059] After the air flows through the SCS, the seal can be sealed to the cartridge body. The seal can be sealed to the cartridge body to close one side of the reaction chamber for the nucleic acid amplification process. In embodiments where the reaction chamber has two open sides, the seal can be sealed around the reaction chamber on each side of the cartridge body, thereby closing the reaction chamber and enclosing the SCS within the reaction chamber. The combination of two seals, each sealing one of the open sides of the reaction chamber, together can close the reaction chamber.

[0060] As used herein, a "containment capsule" includes an area configured to contain materials for performing a nucleic acid amplification process. The material can be one or more reagents, including one or more aqueous reagents and / or one or more dry reagents. The containment capsule can be sealed and can be, for example, a blister pack.

[0061] As used herein, "baseline fluorescence" is the total fluorescence measured from a reaction chamber prior to the nucleic acid amplification process when the reaction chamber is filled with reagents but does not include SCS.

[0062] As used herein, "total system fluorescence" is the complete fluorescence of a reaction chamber when the reaction chamber is filled with reagents, SCS, and sample and the nucleic acid amplification process has been completed to detect one or more target analytes.

[0063] As used herein, a "fluid channel" is a passage through the box body and coupled to at least one chamber through which a fluid can flow. The fluid channel can be used to move a reagent from one position in the box body to another position in the box body. For example, a fluid channel can couple one or more chambers storing reagents to each other, and / or a fluid channel can couple one or more chambers storing reagents to a reaction chamber.

[0064] As used herein, a "fluorescence channel" is a fluorescence wavelength or a range of fluorescence wavelengths. A fluorescence channel can be associated with one or more fluorescent probes that bind to the target analyte. In some embodiments, the optical unit 304 can emit and / or detect multiple fluorescence channels corresponding to multiple fluorescent probes, each of which recognizes and anneals to a different sequence of nucleic acid.

[0065] As used herein, a "sampling module" is a part of a sampling and analysis system that is configured to facilitate the use of a box (particularly a box body) to collect samples. In some embodiments, the sampling module can be configured to move a fluid through the reaction chamber of the box body, and the fluid can be air. The sampling module may include one or more pumps, vacuum devices, fans, impellers, etc. The sampling module is also referred to as an "air handler" and a "fluid delivery module" in this article.

[0066] As used herein, a "thermal cycler" is a device configured to maintain a desired temperature for the purpose of bringing one or more adjacent components (e.g., reaction chambers) in close physical contact to the same desired temperature. A thermal cycler can also cyclically heat and cool one or more adjacent components, such as performing a PCR reaction.

[0067] Sampling and analysis systems

[0068] Reference now Figure 1, a schematic diagram of one embodiment of an environmental control system 100 is shown. The environmental control system 100 can be configured to sample and analyze a fluid (e.g., air, water, sewage, etc.). The environmental control system 100 may include a fluid sampling and analysis system 102 (also referred to herein as a "sampling and analysis system 102" or a "biosensor system 102"), a control system 104, and / or one or more additional systems / devices 106.

[0069] The sampling and analysis system 102, which will be discussed in more detail below, can be configured to collect and analyze one or more fluid samples. Specifically, this can include collecting and analyzing one or more air samples within a building. The sampling and analysis system 102 can be in communication with a control system 104. The control system 104 can be a different device, such as a control unit, from which operating instructions are sent to the biosensor system 102. The control system can send operating instructions to the biosensor manually or according to pre-programmed instructions using human intervention, including instructions such as changing the sampling frequency or box selection in response to previous results transmitted by the biosensor system 102 to the control system 104. Alternatively, the control system can be a user interface through which a user can view the collected data.

[0070] In some embodiments, the control system 104 may include software that enables a user to log into the control system 104. In some embodiments, the user may log into the control system 104 remotely, or may log into the control system 104 in person. In some embodiments, by logging into the control system 104, the user may analyze data and / or transmit operating instructions through, for example, a web browser interface, etc. The additional system / device may be any system or device that performs a function in response to data received from the biosensor system 102, and / or any system or device that transmits data to the biosensor system 102, such as a control system, an access portal, an alarm, and a notification system. In addition, see U.S. Patent Application Nos. 17 / 094,632 and 17 / 180,627, which are incorporated herein by reference, which introduce examples of biosensors that communicate with additional systems (e.g., building ventilation systems). In some embodiments, the biosensor system 102 may be programmed to send instructions and other data directly to the additional system / device 106.

[0071] Reference now Figure 2, a schematic diagram of an embodiment of a fluid sampling and analysis system 102 is shown. The sampling and analysis system 102 may include a cassette 202. The cassette 202 may be configured to accommodate one or more sampling units, which may include, for example, a box body and a box receptacle. In some embodiments, each sampling unit may include a disposable sampling unit, which may be used to collect and analyze a sample. The cassette 202 may be configured to accommodate one or more sampling units in one or more desired positions and / or one or more desired orientations. In some embodiments, the cassette 202 may be accessed to load one or more new sampling units into the cassette 202 and / or the cassette 202 may be accessed to remove one or more used sampling units from the cassette 202. In some embodiments, one or more sampling units may be removed from the cassette 202, and these sampling units may be used to collect and analyze samples.

[0072] The sampling and analysis system 102 may include an analysis module 204. The analysis module 204 may be configured to analyze samples in one or more sampling units. In some embodiments, the analysis module 204 may be configured to perform nucleic acid amplification and analyze the output of the nucleic acid amplification to determine the presence and / or concentration of one or more target analytes. Nucleic acid amplification may be, for example, an isothermal amplification process or a non-isothermal amplification process. In some embodiments, for example, the isothermal amplification process may include, for example, one or more of the following: loop-mediated amplification (LAMP); recombinase polymerase amplification (RPA); transcription-mediated amplification (TMA); helicase-dependent amplification (HDA); nucleic acid amplification-based amplification (NASBA); rolling circle amplification (RCA); catalytic hairpin assembly (CHA); hybridization chain reaction (HCR); strand displacement amplification (SDA); exponential amplification reaction (EXPAR); and the like. In some embodiments, the non-isothermal amplification process may include, for example, at least one of qPCR, PCR, RT-qPCR, digital PCR, immune PCR, proximity ligation PCR, and the like.

[0073] In embodiments where the analysis module 204 is configured to perform a non-isothermal amplification process, the analysis module 204 may include, for example, a thermal cycler. In some embodiments, the thermal cycler may be configured to periodically change the temperature of one or more sampling units containing the sample being analyzed. In some embodiments, the change in temperature may include cyclically heating and / or cooling the one or more sampling units containing the sample being analyzed.

[0074] In some embodiments, the analysis module 204 may also include an optical device. In some embodiments, the optical device may be configured to emit and receive electromagnetic energy from the sample and detect the presence or absence of one or more target analytes based on the received electromagnetic energy. In some embodiments, the received electromagnetic energy may include light emitted by the sample, specifically, for example, light emitted by a probe that binds to one or more target analytes. Such light emitted by the sample may include fluorescence.

[0075] In some embodiments, each target analyte can be identified by one or more probes that together form a unique fluorescence distribution. The optical device can be configured to emit and receive fluorescence and detect the presence or absence of one or more target analytes based on the fluorescence distribution and / or multiple fluorescence features received from the sample. In some embodiments, the optical device can be multi-channel so as to be able to detect multiple target analytes simultaneously.

[0076] The sampling and analysis system 102 can include a manipulation module 206. The manipulation module 206 can be configured to move the sample unit to a location within the sampling and analysis system 102 and / or between locations within the sampling and analysis system 102. In some embodiments, the manipulation module 206 can include a mechanism for ejecting a used cartridge body and positioning a new cartridge body for sample capture and analysis.

[0077] In some embodiments, the manipulation module 206 can be configured to remove one or more sampling units from the cassette 202 and position one or more sampling units to collect samples. After collecting the sample, the manipulation module 206 is configured to move one or more sampling units to the analysis module 204 from the position where the sample is collected. In some embodiments, the manipulation module 206 can be further configured to manipulate one or more features of the one or more sampling units to facilitate the execution of the analysis. This can include, for example, manipulating one or more holding capsules comprising one or more reagents so that these reagents are mixed and these reagents are entered into the reaction chamber of the sampling unit with these holding capsules. In some embodiments, after the analysis is completed, the manipulation module 206 can be configured to remove one or more sampling units from the analysis module 204, and discard one or more sampling units.

[0078] In some embodiments, the sampling and analysis system 102 may include a fluid delivery module 208, also referred to herein as a "sampling module 208" or "air handler 208". The sampling module 208 may be configured to direct and / or draw fluid through one or more sampling cells, thereby collecting samples on portions of the one or more sampling cells. In some embodiments, the sampling module 208 may include, for example, one or more fans, pumps, vacuum devices, etc. In some embodiments, the sampling module 208 may be configured to push fluid through one or more sampling cells, and / or draw or pull fluid through one or more sampling cells. In some embodiments, the sampling module 208 may include directing portions of already flowing air, such as air that is moved through a sampling cell through an HVAC vent. In such embodiments, the sampling module 208 is configured to direct fluid through one or more sampling cells.

[0079] In some embodiments, the sampling and analysis system 102 may include one or more processors 210. In some embodiments, the processor 210 may be configured to generate signals to control the operation of other modules of the sampling and analysis system 102 and / or receive signals from other modules of the sampling and analysis system 102. In some embodiments, for example, the processor 210 may receive data from the cartridge 202 indicating the number of sampling units in the cartridge 202 and / or whether the cartridge 202 should be refilled. In some embodiments, the processor 210 may receive data from the analysis module 204, such as indicating the temperature of the reaction chamber of the sampling unit, the fluorescence captured by the optical device, etc. In some embodiments, the processor 210 may receive data from the manipulation module 206 indicating which manipulations have been completed and / or the status of one or more manipulations being completed. In some embodiments, the processor 210 may receive data from the sampling module 208, which may indicate, for example, flow rate, volume of fluid passing through the sampling unit, etc. In some embodiments, the processor 210 may generate signals, such as controlling the analysis module 204 to perform a nucleic acid amplification process and / or identify a target analyte in a sample. In some embodiments, the processor 210 can generate signals, such as controlling the manipulation module 206 to place the sampling unit in the sampling module 208, remove the sampling unit from the sampling module 208 after sampling is completed, place the sampling unit in the analysis module, manipulate one or more features of the sampling unit to perform analysis, remove the sampling unit from the analysis module 206 after analysis is completed, and dispose of the sampling unit. In some embodiments, the processor 210 can generate signals, such as controlling the flow rate of the sampling module 208.

[0080] The processor 210 may be implemented as one or more integrated circuits (e.g., conventional microprocessors or microcontrollers). The processor 210 may include one or more processors, including single-core processors and / or multi-core processors. The processor 210 may be implemented as one or more independent processing units, each of which includes a single-core or multi-core processor and a processor cache. In other embodiments, the processor 210 may also be implemented as a quad-core processing unit or a larger multi-core design (e.g., a six-core processor, an eight-core processor, a ten-core processor or larger).

[0081] The processor 210 may execute various software processes embodied in program code and may maintain multiple concurrently executing programs or processes. At any given time, some or all of the program code to be executed may reside in the processor 210 and / or the memory 212. In some embodiments, the sampling and analysis system 102 may include one or more special-purpose processors, such as a digital signal processor (DSP), an external processor, a graphics processor, a special-purpose processor, etc.

[0082] The sampling and analysis system 102 may include a memory 212 including hardware and software components for storing data and program instructions, such as system memory and computer-readable storage media. The system memory and / or computer-readable storage media may store program instructions that may be loaded and executed on the processor 210, as well as data generated during the execution of these programs.

[0083] The system memory may be stored in volatile memory (e.g., random access memory (RAM)) and / or non-volatile storage drives (e.g., read-only memory (ROM), flash memory, etc.). The RAM may contain data and / or program modules that are immediately accessible and / or currently being operated and executed by the processor 210. In some embodiments, the system memory may include a variety of different types of memory, such as static random access memory (SRAM) or dynamic random access memory (DRAM). In some embodiments, the basic input / output system (BIOS) contains basic routines that facilitate the transfer of information between elements within the sampling and analysis module 102 (e.g., during startup), and the BIOS may generally be stored in a non-volatile storage drive. By way of example and not limitation, the system memory may include application programs (e.g., client applications, web browsers, middle-tier applications, server applications, etc.), program data, and an operating system.

[0084] The memory 212 may also provide one or more tangible computer-readable storage media for storing basic programming and data constructs that provide the functionality of some embodiments. Software (programs, code modules, instructions) that provide the functionality described herein when executed by the processor may be stored in the memory 212. These software modules or instructions may be executed by the processor 210. The memory 212 may also provide a repository for storing data used in accordance with the present invention.

[0085] The memory 212 may also include a computer-readable storage medium reader, which may be further connected to a computer-readable storage medium. Computer-readable storage media, together with system memory and optionally in combination, may comprehensively represent remote, local, fixed and / or removable storage devices and storage media for temporarily and / or more permanently containing, storing, transmitting and retrieving computer-readable information.

[0086] Computer-readable storage media containing program code or portions of program code may include any suitable media known or used in the art, including storage media and communication media, such as, but not limited to, volatile and non-volatile, removable and non-removable media implemented in any method or technology for storing and / or transmitting information. This may include tangible computer-readable storage media, such as RAM, ROM, electronically erasable programmable ROM (EEPROM), flash memory or other storage technology, CD-ROM, digital versatile disk (DVD) or other optical storage, cassettes, magnetic tape, disk storage or other magnetic storage devices, or other tangible computer-readable media. This may also include intangible computer-readable media, such as data signals, data transmissions, or any other media that can be used to transmit the desired information and can be accessed by processor 210.

[0087] By way of example, computer-readable storage media may include hard drives that read from or write to non-removable, non-volatile magnetic media, magnetic disk drives that read from or write to removable, non-volatile magnetic media, and magnetic disk drives that read from or write to removable, non-volatile disks and removable, non-volatile optical disks such as CD ROMs, DVDs, and disk or other optical media) to read or write removable, nonvolatile optical disks (such as CD ROM, DVD, and Computer readable storage media may include, but are not limited to, Drives, flash memory cards, universal serial bus (USB) flash drives, secure digital (SD) cards, DVD disks, digital video tapes, etc. Computer-readable storage media may also include: solid-state drives (SSDs) based on non-volatile memory, such as flash-based SSDs, enterprise flash drives, solid-state ROMs, etc., SSDs based on volatile memory, such as solid-state RAM, dynamic RAM, static RAM, DRAM-based SSDs, magnetoresistive RAM (MRAM) SSDs, and hybrid SSDs using a combination of DRAM and flash-based SSDs. The disk drives and their associated computer-readable media may provide non-volatile storage of computer-readable instructions, data structures, program modules, and other data for the sampling and analysis system 102.

[0088] The sampling and analysis system 102 may include a communication module 214. The communication module may be configured to send information to and / or receive information from other systems, including wired or wireless transmissions, using standard, commercially available components (e.g., receivers, transceivers, transmitters, modems, Ethernet ports, wifi routers, etc.). In some embodiments, the communication module may be configured to electronically transmit information to another system and optionally to receive information such as operating instructions.

[0089] Reference now Figure 3 , a description of one embodiment of a sampling and analysis system 102 is shown. As shown, the sampling and analysis system 102 includes a cassette 202 that can be configured to accommodate one or more sampling units. In some embodiments, the cassette 202 can be configured to accommodate one or more new sampling units and / or one or more used sampling units. In some embodiments, for example, after completing the analysis with the sampling unit, the used sampling unit can be disposed of in a portion of the cassette 202 designated for the used sampling unit. The nucleic acid remaining in the used sampling unit can be further analyzed to obtain additional data about the environment in which the sample was obtained.

[0090] The sampling and analysis system 102 may include a thermal cycler 302. The thermal cycler 302 may be configured to control the temperature of the sampling unit during analysis. This may include heating and / or cooling the sampling unit, and in some embodiments, periodically heating and / or cooling the sampling unit. In some embodiments, the thermal cycler 302 may be configured to maintain a desired temperature of the sampling unit over a desired time period. In some embodiments, for example, after the sampling unit is placed in the analysis module 204, the thermal cycler 302 may heat and / or cool the sampling unit according to one or more temperature profiles.

[0091] In some embodiments, the heating and / or cooling of the sampling unit may include the heating and / or cooling of the reaction chamber defined by the sampling unit. The heating and / or cooling of the reaction chamber may be periodic and / or may be part of the nucleic acid amplification process. In some embodiments, the heating and / or cooling of the reaction chamber may include the heating and / or cooling of the SCS that may be contained within the reaction chamber. In some embodiments, with the SCS located in the reaction chamber, the nucleic acid amplification process may be performed directly on the SCS. Performing the nucleic acid amplification process directly on the SCS has a higher sensitivity than flushing or extracting the analyte on the SCS and transferring it to the reaction chamber (which may result in a loss of analyte yield). This allows for shortening the sampling time before analyzing and detecting very small amounts of analyte in the fluid. The preferred materials for the SCS exhibit limited autofluorescence or no detectable autofluorescence.

[0092] The thermal cycle of the sampling unit can include, for example, maintaining the reaction chamber of the sampling unit at a temperature between 20°C and 60°C during the reverse transcription step before the PCR amplification stage. In some embodiments, the target nucleic acid of the target analyte can be used to be exposed to the reagent during the sample capture and reverse transcription steps. After the reverse transcription stage is completed, the thermal cycler 302 can be configured to cycle the heating and / or cooling of the reaction chamber of the sampling unit at a temperature between 4°C and 100°C. Many analytes (such as respiratory viruses) can be detected without any extraction or other enrichment steps after being captured on the SCS. Some analytes containing encapsulated nucleic acids that are not released by the 20°C to 60°C step can be analyzed by, for example, maintaining the reaction chamber at 95°C to 100°C for a period of time (e.g., 30 seconds to 5 minutes or more) before the thermal cycle begins. The use of detergents can also help analysis without the need for separate extraction or other enrichment steps.

[0093] The sampling and analysis system 102 may include an optical device 304. The optical device 304 may be configured to send electromagnetic radiation to the reaction chamber and / or the contents of the reaction chamber and receive electromagnetic radiation emitted from the reaction chamber and / or the contents of the reaction chamber, respectively, thereby identifying the presence, absence and / or concentration of one or more target analytes in the reaction chamber of the sampling unit. In other words, the optical device may be configured to send fluorescent signals to the sampling reaction chamber and receive fluorescent signals from the sampling reaction chamber, thereby measuring the fluorescent signals from the sampling reaction chamber, which reaction chamber includes the SCS. Therefore, in some embodiments, the optical device may be configured to send fluorescent signals to the reaction chamber and receive fluorescent signals from the reaction chamber and / or measure fluorescent signals, including any fluorescent markers received from the SCS contained in the reaction chamber.

[0094] In some embodiments, the optical device can include one or more electromagnetic radiation emitters, one or more electromagnetic radiation detectors, etc. In some embodiments, the one or more electromagnetic radiation emitters can be configured to emit excitation energy to excite fluorescence of one or more probes coupled to the target analyte. In some embodiments, the one or more electromagnetic radiation detectors can be configured to receive and / or detect electromagnetic radiation emitted by one or more probes coupled to the target analyte in the reaction chamber of the sampling unit.

[0095] In some embodiments, the optical device 304 can be configured to measure at least four fluorescence channels having different fluorescence wavelengths. In some embodiments, each fluorescence channel can be configured to measure a fluorescence signal, so the optical device 304 having four fluorescence channels can be configured to measure four different fluorescence signals.

[0096] In some embodiments, the sampling and analysis system 102 may include a sealer 306. The sealer 306 may be configured to seal one or more fluid channels of the sampling unit and / or one or more seals of the cartridge receptacle to the cartridge body, thereby enclosing the reaction chamber of the cartridge body around the SCS. In some embodiments, the sealer 306 may be configured to seal the seal to the cartridge body around the periphery of the reaction chamber, thereby enclosing the reaction chamber around the SCS. In some embodiments, the sealer 306 may be configured to seal one or more fluid channels of the sampling unit and / or one or more seals of the cartridge receptacle to the cartridge body, thereby enclosing the reaction chamber of the cartridge body by, for example, at least one of the following means: heat, vibration, pressure, etc. For example, heat may be applied to activate the adhesive, which may provide a stable, watertight seal once the adhesive cools.

[0097] In some embodiments, sampling and analysis system 102 may include one or more fluid actuators 308. One or more fluid actuators 308 may be configured to control the release, mixing and movement of one or more reagents in one or more fluid channels and chambers of box body. In some embodiments, one or more reagents may be contained in one or more holding capsules on box body. These one or more holding capsules may be configured to hold one or more reagents separately. One or more holding capsules may include a first holding capsule, which first holds one or more wet reagents (also referred to as aqueous reagents in this article), and a second holding capsule, which second holds one or more dry reagents. In some embodiments, one or more fluid actuators 308 may combine aqueous reagents with dry reagents, mix them into a single homogeneous solution, and may fill the reaction chamber with a mixed reagent.

[0098] In some embodiments, the sampling and analysis system 102 may include a sampling module 208, which may include a fan, a pump, a vacuum device, a compressor, etc. The sampling module 208 can be configured to draw a fluid for sampling through a sampling unit, thereby capturing the sample on a filter membrane, which is also referred to herein as a sample capture substrate (SCS). In some embodiments, the sampling module 208 can be configured to achieve a pressure drop across the filter membrane of between about 1 kPa and about 30 kPa.

[0099] In some embodiments, as previously described, the processor 210 may be configured to receive inputs from the modules and / or components of the sampling and analysis system 102, and may generate one or more control signals based on these received inputs and based on the instructions stored in the memory 212. In some embodiments, these instructions may direct the modules and / or components of the sampling and analysis system 102 to place a new sampling unit in the fluid transfer module 208, so that the fan, pump, vacuum device, compressor, etc. in the sampling module 208 can move the fluid (e.g., air) through the sampling unit, and specifically through the SCS of the sampling unit, thereby collecting the sample. These instructions may, for example, cause the manipulation module 206 to move the sampling unit from the fluid transfer module 208 to the analysis module 204, and cause the sealer 306 to seal the reaction chamber of the sampling unit by sealing the seal of the cartridge receptacle to the cartridge body. These instructions may also cause the manipulation module 206 to combine and mix the reagents and fill the reaction chamber with the mixed reagents. These instructions may also direct the analysis module 204 to perform a nucleic acid amplification process and determine the presence, absence, and / or concentration of the target analyte in the reaction chamber. Specifically, the instructions can direct the thermal cycler 302 to heat and / or cool the sampling unit, specifically, to heat the reaction chamber of the sampling unit according to the desired nucleic acid amplification program. The instructions can also direct the optical device 304 to emit electromagnetic radiation to the reaction chamber and collect electromagnetic radiation from the reaction chamber, so that the presence, absence and / or concentration of the target analyte in the reaction chamber can be determined.

[0100] In some embodiments, for example, the processor can be configured to control the sampling module 208 so that air passes through the sampling unit, particularly through the SCS and the reaction chamber, at a desired flow rate. In some embodiments, the flow rate can be, for example, a flow rate through the SCS of 0.1 LPM / mm 2 Up to 10LPM / mm 2 In some embodiments, the flow rate can be between 10 LPM and 500 LPM, and / or can be about 100 LPM. In some embodiments, the flow rate through the SCS is between 0.1 LPM / mm 2 Up to 10LPM / mm 2The sampling and analysis system 102 can be configured to produce less than 50 Db at a distance of 36 inches from the system 102.

[0101] In some embodiments, the sampling and analysis system 102 can be configured to collect 1 to 100 samples per day, 10 to 80 samples per day, 20 to 50 samples per day, about 32 samples per day, or any other value or intermediate values. In some embodiments, at least some of these samples can be collected by moving about 500 L of air through the SCS and reaction chamber and 100,000 L of air through the SCS and reaction chamber. In some embodiments, at least some of these samples can be collected by moving about or at least 3,000 L of fluid through the SCS of the sampling unit.

[0102] Reference now Figure 4 , a perspective view of one embodiment of a sampling unit 400 is shown. In some embodiments, the sampling unit 400 can be configured to receive and / or collect a sample. In some embodiments, the sampling unit 400 can be configured to collect a sample from a fluid (e.g., from air) or from a liquid. The sampling unit 400 can be, for example, disposable or can be reusable.

[0103] The sampling unit 400 may include a consumable body including a cartridge body 402 and a cartridge receptacle 404. One of the cartridge body 402 and the cartridge receptacle 404 may be referred to as a first portion of the sampling unit 400, and the other of the cartridge body 402 and the cartridge receptacle 404 may be referred to as a second portion. In some embodiments, the cartridge body 402 and the cartridge receptacle 404 may be coupled, such as by a hinge, a pivot, a slider, etc., and in some embodiments, the cartridge body 402 and the cartridge receptacle 404 may be separate, or in other words, not connected.

[0104] In some embodiments, such as Figure 5As shown, the cartridge body 402 can be completely or partially separated from the cartridge receptacle 404. In some embodiments, the cartridge body 402 can be inserted into the cartridge receptacle 404, and specifically, can be inserted into a container defined by the cartridge receptacle 404, by moving the cartridge body 402 relative to the cartridge receptacle 404 as shown by arrow 500. In some embodiments, the cartridge body 402 can be removed from the cartridge receptacle 404 by moving the cartridge body 402 relative to the cartridge receptacle 404 as shown by arrow 502, and specifically, can be removed from a container defined by the cartridge body 404 by moving the cartridge body 402 relative to the cartridge receptacle 404 as shown by arrow 502. The ability to move the cartridge body 402 relative to the cartridge receptacle 404 allows the sampling unit 400 to collect analytes on the SCS when in the first position, wherein the fan or pump 208 causes a fluid (e.g., air) to flow through the SCS. Once the sample has been captured, the manipulation module 206 moves the cartridge body 402 to a second position wherein the SCS is no longer in a position to allow fluid to flow through the SCS, but instead the SCS is placed in a position to allow the seal to seal the reaction chamber and around the SCS, such that nucleic acid amplification reagents can be moved into the reaction chamber via the fluid delivery module 208, and nucleic acid amplification can be performed directly on the SCS.

[0105] The manipulation module 206 can move the cartridge body 402 to a first position, a second position, a position to collect a sample, a position for nucleic acid amplification and / or analysis, and / or into and / or out of the cartridge 202. In some embodiments, this can include rotating the cartridge body 402 about one or more axes; longitudinally displacing the cartridge body 402 along one or more axes, and the like. In some embodiments, for example, the cartridge body 402 can be placed in a first position and can be inserted into a gap in a channel for fluid flow such that the fluid flowing through the channel passes through the SCS. In some embodiments, such insertion can include rotation, longitudinal displacement, and the like.

[0106] After collecting the sample, the manipulation module 206 can remove the box body 402 from the channel for fluid flow and place the box body 402 in the second position. In some embodiments, the manipulation module 206 can position the box body 402 so that the sealer 306 can seal the seal 632 to the box body 402, thereby closing the reaction chamber 606. The manipulation module 206 can position the box body 402 relative to the analysis module 204 so that nucleic acid amplification and analysis can be performed. In some embodiments, this can include inserting the box body 402 into a position that contacts the thermal cycler 302 and / or the optical device 304. In some embodiments, the box body 402 can be longitudinally displaced and / or rotated to reach this position. In some embodiments, one or both of the thermal cycler 306 and the optical device 304 can be moved relative to the box body 402. After completing nucleic acid amplification and / or analysis, the manipulation module 206 can place the used sampling unit 400 in the cassette 202, and specifically in the part of the cassette for accommodating the used sampling unit 400.

[0107] Reference now Figure 6 , an exploded view of one embodiment of a sampling unit 400 is shown. The box body 402 can include a variety of shapes and sizes and can be made of a variety of materials. In some embodiments, the box body 402 can include metal, man-made materials, or natural materials. In some embodiments, the box body can include, for example, man-made materials, such as polymers, such as polypropylene, polyethylene, polycarbonate, polytetrafluoroethylene (PTFE), etc.

[0108] As shown, the box body 402 may include a front portion 602 and a rear portion 604. Although the present application describes and / or depicts that certain features are located on one of the front portion 602 and the rear portion 604, in some embodiments, some or all of these features may be located on the other of the front portion 602 and the rear portion 604. In some embodiments, the front portion 602 and the rear portion 604 of the box body 402 may include the same features and / or may be the same. In such embodiments, the orientation of the box body 402 is not important. In some embodiments, the front portion 602 of the box body 402 may be different from the rear portion 604 of the box body 402. In some embodiments, the box body 402 may be configured to collect samples by flowing a fluid (e.g., air) through a reaction chamber 606 (also referred to herein as an air sampling reaction chamber), which is defined by the box body 402, wherein the air flows from the front portion 602 of the box body 402 to the rear portion 604 of the box body 402. The reaction chamber 606 may include a closable chamber. In some embodiments, reaction chamber 606 can be integrated into cartridge body 402 .

[0109] Reaction chamber 606 can include various shapes and sizes. Reaction chamber 606 can be defined by cartridge body 402. In some embodiments, for example, reaction chamber 606 extends through cartridge body 402, and specifically extends through front portion 604 of cartridge body 402 and / or through rear portion 604 of cartridge body 402. Reaction chamber 606 can include various shapes and sizes, and can be, for example, circular, rectangular, triangular, or have any other desired shape.

[0110] In some embodiments, the reaction chamber 606 can have a width, side length, and / or diameter between about 1 mm and about 50 mm. In some embodiments, for example, the reaction chamber 606 can be circular and can have a diameter between about 1 mm and about 50 mm. In some embodiments, the reaction chamber 606 can have a width, side length, and / or diameter of about 12 mm. The reaction chamber 606 can have a width, side length, and / or diameter greater than 50 mm, such as 500 mm or greater, however, the larger the reaction chamber, the more nucleic acid amplification reagents are needed, and the larger the thermal cycle module 302.

[0111] A filter membrane 608 (also referred to herein as a "sample capture substrate (SCS) 608" or "SCS 608") can be connected and / or coupled to the cartridge body 402. The SCS 608 can be configured to collect, contain, and / or hold a sample. In some embodiments, the SCS 608 can be coupled to the cartridge body 402, and in some embodiments, the SCS 608 can be separate from the cartridge body 402. The SCS 608 can include a variety of shapes and sizes, and can be made of a variety of materials. In some embodiments, the SCS 608 includes at least one of: a membrane; a swab; a brush; and a spoon.

[0112] In some embodiments, the sample capture substrate 608 can be coupled to the cartridge body 402 around the perimeter of the air sampling reaction chamber 606. The SCS 608 can extend through the reaction chamber 606. In some embodiments, the filter membrane 608 extends through the reaction chamber 606 such that the reaction chamber 606 is completely covered by the filter membrane 608 such that there is no fluid path through the reaction chamber 606 except through the filter membrane 608.

[0113] In some embodiments, the filter membrane 608 can have a width, side length, or diameter that is equal to the width or diameter of the reaction chamber 606. Thus, in some embodiments, the filter membrane 608 can have a width, side length, and / or diameter of about 1 mm to about 50 mm. In some embodiments, the filter membrane 608 can have a width, side length, and / or diameter of about 12 mm. In some embodiments, the area of ​​the filter membrane 608 can be between about 0.5 mm 2 To about 2,000mm 2In some embodiments, the area of ​​the filter membrane 608 may be approximately 115 mm 2 In some embodiments, the area of ​​the filter membrane 608 may be at least about 115 mm 2 and a width or diameter of about 12 mm. The area of ​​the filter membrane 608 may be greater than 2,000 mm 2 , e.g. 20,000mm 2 or larger, but a larger reaction chamber requires more nucleic acid amplification reagents, a larger thermal cycling module 302, and the sensitivity will be lower.

[0114] The filter membrane 608 can be configured to collect a sample from the fluid passing through the filter membrane 608 and the reaction chamber 606. This can include, for example, capturing biological matter (including biological pathogens, such as allergens, mold, bacteria, viruses, etc.) from the fluid (e.g., air) passing through the filter membrane 608. In some embodiments, the filter membrane can be configured to capture airborne microorganisms from the air passing through the filter membrane 608.

[0115] The filter membrane 608 may comprise a variety of materials. In some embodiments, the filter membrane 608 may comprise a material configured to capture a sample passing through the reaction chamber 606. In some embodiments, the filter membrane 608 may comprise at least one of polytetrafluoroethylene (PTFE), polycarbonate, and propylene (e.g., polypropylene). In some embodiments, the filter membrane 608 may comprise melt-blown polypropylene. In some embodiments, the filter membrane 608 may be electrostatically charged, and in some embodiments, the filter membrane 608 is not electrostatically charged.

[0116] The filter membrane 608 may include a variety of thicknesses and / or may include a variety of different material weights. In some embodiments, the weight of the filter membrane 608 may be, for example, about 1 g / m 2 Up to 100g / m 2 In some embodiments, the weight of the filter membrane can be, for example, about 5 g / m 2 About 60g / m 2 In some embodiments, the thickness of the filter membrane 608 can be between about 0.02 mm and 0.5 mm. The thickness of the filter membrane 608 can be greater than 0.5 mm, such as 3 mm or thicker, but increasing the thickness increases the pressure drop, thereby increasing the noise, and requires the air delivery duct leading to the reaction chamber 606 to be more robust. Increasing the thickness also requires a larger volume of the reaction chamber, which slows down the thermal cycling process.

[0117] In some embodiments, the filter membrane 608 can be selected to be compatible with the sampling and analysis system 102. In some embodiments, this can include compatibility with the nucleic acid amplification process performed by the sampling and analysis system 102. Compatibility with the nucleic acid amplification process can include, for example, materials that are compatible with the temperature of the nucleic acid amplification process, materials that are compatible with the chemicals and / or reagents used in the nucleic acid amplification process, materials that do not interfere with the nucleic acid amplification process, and / or materials that do not interfere with the detection of target analytes in the sample. In some embodiments, preferred filter membrane 608 materials meet some or all of the above requirements.

[0118] In some embodiments, the filter membrane 608 can be compatible with the temperature of the nucleic acid amplification process, and specifically can remain stable at a temperature between about 4° C. and about 100° C. In some embodiments, the filter membrane 608 can be compatible with the nucleic acid amplification process because the filter membrane 608 does not inhibit the nucleic acid amplification reaction, such as a PCR reaction.

[0119] In some embodiments, the filter membrane 608 can be compatible with the nucleic acid amplification process because the filter membrane 608 does not inhibit the detection of the target analyte in the reaction chamber 606. In some embodiments, the filter membrane 608 does not inhibit the detection of the target analyte in the reaction chamber 606 due to the autofluorescence of the filter membrane 608. For example, in some embodiments, the filter membrane 608 does not exhibit autofluorescence, or exhibits autofluorescence at a level that does not interfere with the quantitative nucleic acid amplification analysis, and specifically, the level of autofluorescence that does not interfere with the quantitative nucleic acid amplification analysis using fluorescent probes for target identification. In some embodiments, the filter membrane does not interfere with the quantitative nucleic acid amplification analysis when the fluorescence produced by the filter membrane is less than, for example, 5%, 10%, 15%, 20%, 25%, or 30% of the total system fluorescence. In some embodiments, the filter membrane does not interfere with the quantitative nucleic acid amplification analysis when the fluorescence exhibited by the sample capture substrate is less than 50% of the baseline fluorescence. In some embodiments, the filter membrane does not interfere with the quantitative nucleic acid amplification analysis because the filter membrane does not exhibit autofluorescence.

[0120] The box body 402 may include one or more containing capsules, which can contain one or more reagents for the nucleic acid amplification process. In some embodiments, the box body 402 may include a first containing capsule 610 that can contain a first reagent; and a second containing capsule 612 that can contain a second reagent. In some embodiments, the first reagent contained in the first containing capsule 610 may include one or more dry reagents. In some embodiments, the second reagent contained in the second containing capsule 612 may include one or more aqueous reagents, also referred to herein as "wet reagents". In some embodiments, dry reagents may include, for example, freeze-dried nucleic acid amplification reagents, such as freeze-dried nucleic acid amplification reagents (primers, fluorescent probes, reverse transcriptases, dNTPs, DNA polymerases, and various buffer components), and in some embodiments, aqueous reagents may include aqueous nucleic acid amplification reagents, specifically aqueous PCR reagents. In some embodiments, at least one reagent includes a surfactant. In some embodiments, the surfactant may include a nonionic surfactant, an ionic surfactant, or a combination of one or more nonionic surfactants and / or one or more ionic surfactants. In some embodiments, the surfactant may include at least one of Tween, NP40, and Triton X-100. Nonspecific nucleic acid amplification can be prevented by mixing all necessary reagents at a temperature equal to or above the annealing and extension temperature of the PCR reaction, thereby keeping key reagents (such as (but not limited to) Mg 2+ ) from the polymerase until the reaction reaches the desired temperature or until the reagents are ready to be transferred to the reaction chamber. Another approach is to block the activity of the reagents (such as (but not limited to) enzymes). This can also be achieved by using reversible, temperature-dependent inhibitors (such as antibodies or aptamers that are inactivated at or above the annealing and extension temperature).

[0121] The selection of nucleic acid amplification reagents contained in the box determines which biological entities (e.g., microorganisms) can be identified using the box in the sampling and analysis system 102. For example, PCR primers specific to certain respiratory viruses and bacteria can be used in systems placed in indoor environments (e.g., office buildings, public transportation hubs (e.g., airports)) and other built environments containing humans (including hospitals, ships, and residences). Other microorganisms that can be analyzed include fungi (e.g., toxic and allergenic molds that can accumulate in buildings) and microorganisms that can cause hospital-acquired infections. Non-microbial sources of nucleic acids can also be analyzed using certain primers (e.g., primers for identifying certain plant species that produce allergenic pollen). Primers can also be used to identify specific humans near the sampling and analysis system 102, such as primers that identify 13 core short tandem repeat loci, which are used by law enforcement agencies (e.g., the FBI) ​​to identify individuals in the United States by amplifying human cells entrained in air discharged from the respiratory tract using CODIS (Combined DNA Index System). Target organisms and viruses may include one or more of the following: Clostridium botulinum, Listeria monocytogenes, Campylobacter, trichinosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Bacillus anthracis, Acinetobacter baumannii including multidrug-resistant Acinetobacter mandshurica, Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli including fluoroquinolone-resistant Escherichia coli and Escherichia coli O157:H7, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B and C), coronaviruses (including SARS CoV, SARS CoV-2 (including Alpha (Bl1.7 and Q lineages), Beta (B.1.351 and descendant lineages), Gamma (Pl and descendant lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1 and 1.617.3), Mu (B.1.621, B.1.621.1), Zeta (P.2), Delta (B.1.617.2 and AY lineages) and Omicron (B.1.1.529,BA1, BA1.1 and BA2 lineages) as well as MERS, adenovirus, influenza virus (including type A and type B); parainfluenza virus; respiratory syncytial virus (including type A and type B); enterovirus; norovirus (including genogroups GI, GII, GIII, GIV, GV, GVI and GVII); rotavirus, astrovirus, viruses causing measles, rubella, varicella / zoster, roseola, smallpox and fifth disease, chikungunya virus, hepatitis (including type A, B, C, D and E), herpes virus, papillomavirus; molluscum contagiosum; polio virus; rabies virus, viruses causing viral meningitis and encephalitis Inflammatory viruses, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, H10N8, H11N2, H11N9, H17N10, H18N11, HPIV-1, HPIV-2, HPIV-3, HPIV-4, HAdV-B, HAdV-C, 229E, OC43, NL63, HUK1, Sin Nombre Hantavirus, Black Creek Canal Hanta virus, Puumala virus, Tailand virus, HRV-A1, HRV-A2, HRV-A7-13, HRV-A15, HRV-A16, HRV-A18-25, HRV-A28-34, HRV-A36, HRV-A38-41, HRV-A43-47, HRV-A49-51, HRV-A53-68, HRV-A71, HRV-A73-78, HRV-A80-82, HRV-A85, HRV-A88-90, HRV-A94-96 , HRV-A98, HRV-A100-103, HRV-B3-6, HRV-B14, HRV-B17, HRV-B26, HRV-B27, HRV-B35, HRV-B37, HRV-B42, HRV-B48, HRV-B52, HRV-B69, HRV-B70, HRV-B72, HRV-B79, HRV-B83, HRV-B84, HRV-B86, HRV-B91-93, HRV-B97, HRV-B99 and HRV-C1-51. Primers specific for human-associated microorganisms can also be used.For example, Actinomycetes, Aerococcus, Akkermansia, Aspergillus, Deinococcus, Anaerobic cocci, Anaerobic bacteria, Mirabilis, Bacteroides, Bambusia, Bifidobacterium, Blautia, Butyrivibrio, Chlamydia, Clostridium, Corynebacterium, Propionibacterium (formerly Propionibacterium), Bacillus, Bichromococcus, Enterobacter, Enterococcus, Escherichia coli, Faecalibacterium, Fusobacterium, Gardnerella, Bacillus, Haemophilus, Klebsiella, Lactobacillus, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, and Brevibacterium. The present invention relates to the present invention to the present invention to the present invention. The present invention relates to the present invention ... Primers specific for the following can also be used: allergic molds including Alternaria, Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium, Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium filutanum, Echinococcus and Penicillium viride), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum and Fusarium moniliforme), Pullulan, Phoma, Smut, Rhizopus and Mucor. Primers specific for allergenic pollens can also be used, including pollens from plants and trees, including ragweed, mountain cedar, ryegrass, maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, North American maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper, oak, hickory, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, timothy grass, plantain, pigweed, red amaranth, sagebrush, and tumbleweed (Russian thistle). Those skilled in the art also recognize that universal primers are able to identify all organisms at a particular taxonomic level (e.g., phylum, class, order, family, genus, species, and strain). For example, fungi (see J.Nat.Prod.2017,80,3,756-770) and coronaviruses (J Clin Microbiol.2007Mar;45(3):1049-1052).

[0122] In some embodiments, the first holding capsule 610 and the second holding capsule 612 are connected through the first fluid channel 614 in the cartridge body 402. In some embodiments, the first holding capsule 610 is also connected to the reaction chamber 606 and the filter membrane 608 through the second fluid channel 616 in the cartridge body 402. In some embodiments, the second holding capsule 612 can be compressed to move some or all of the wet reagent in the second holding capsule 612 through the first fluid channel 614 to mix with the dry reagent in the first holding capsule 610. After the aqueous reagent is successfully mixed with the dry reagent, the first holding capsule 610 can be compressed to move some or all of the mixed reagent in the first capsule 610 into the reaction chamber 606, thereby wetting and / or immersing the filter membrane in the mixed reagent.

[0123] The cartridge receiver 404 can have a variety of shapes and sizes and can be made of a variety of materials. In some embodiments, for example, the cartridge receiver can be made of a man-made material (e.g., a polymer including polypropylene, polycarbonate, etc.).

[0124] The cartridge receptacle 404 may include a front portion 618, a rear portion 620, a bottom portion 622, a top portion 624, a first side 626, and a second side 628. The cartridge receptacle 404 may define a container 630 configured to receive all or a portion of the cartridge body 402, and in particular configured to enclose the reaction chamber 606 and / or the SCS 608. In some embodiments, the container 630 may include a closable chamber. The cartridge receptacle 630 may be accessed through the top portion 624 of the cartridge receptacle 404. In some embodiments, the cartridge receptacle 630 may be closed on all sides except for an opening through the top portion 624 of the cartridge receptacle 404 through which all or a portion of the cartridge 402 may be inserted into the cartridge receptacle 630. When at least a portion of the cartridge body 402 is inserted into the cartridge receptacle 630, the cartridge receptacle 630 may enclose the reaction chamber 606 of the cartridge body 402 so that a nucleic acid amplification process can be performed. In some embodiments, the container 630 of the box receiver 404 is configured so that at least the reaction chamber 606 and the filter membrane 608 can be inserted into the container 630, so that the contents of the reaction chamber 606 (including the contents on the filter membrane 608) can be amplified and analyzed by nucleic acid.

[0125] The cartridge receiver 404 may comprise a single component, or may be made of multiple components. Figure 6As shown, the box receiver 404 includes a body 405, and the body 405 can have a first body part 405-A, a second body part 405-B, a first seal 632-A and a second seal 632-B. The seal 632 can include a variety of shapes and sizes and can be made of a variety of materials. In some embodiments, the first seal 632-A can be coupled or connected to the inner surface of the front 618 of the box receiver 404, and the second seal 632-B can be coupled or connected to the inner surface of the rear 620 of the box receiver 404. In some embodiments, the seal 632 can be coupled to the box receiver 404 so that when the box body 402 is inserted into the box container 630, the first seal 632-A is located between the first body part 405-A and the box body 402, and when the box body 402 is inserted into the box container 630, the second seal 632-B is located between the second body part 405-B and the box body 402.

[0126] In some embodiments, the seal 632 can be made of the same material as the cartridge receiver 404, and in some embodiments, the seal 632 can be made of a different material than the cartridge receiver 404. In some embodiments, one or both of the seals 632 can be made of a man-made material, such as a polymer, including, for example, polypropylene, polycarbonate, etc. In some embodiments, one or both of the seals 632 can be transparent. Specifically, in some embodiments, at least one of the seals 632 is transparent. In some embodiments, at least the first seal 632-A is transparent, and the sampling unit 400 can be positioned so that the transparent first seal 632-A exposes the reaction chamber 606 and the filter membrane 608 to the optical device 304. In such embodiments, the sampling unit 400 can be positioned so that the first seal 632-A is close to the optical device 306. In such embodiments, the second seal 632-B can be opaque, and in some embodiments, the second seal 632-B can have one or more properties that enhance heat transfer, thereby facilitating the nucleic acid amplification process. In some embodiments, for example, the second seal 632-B can be a good thermal conductor, such as copper or aluminum, and / or can include a color configured to absorb thermal energy, such as black.

[0127] In some embodiments, one or both of the seals 632 can include an extruded film. In some embodiments, one or both of the seals 632 can have a thickness between about 50 μm and about 500 μm. In some embodiments, at least one of the seals 632 has a thickness of less than about 200 μm. In some embodiments, one or both of the seals 632 can include a material having sufficient thickness and properties to remain rigid during, for example, thermal cycling.

[0128] In some embodiments, seals 632 can each be larger than reaction chamber 606 and can be positioned in respective portions of cartridge receptacle 404 such that when cartridge body 402 is fully inserted into the receptacle, each seal 632 covers and closes a portion of reaction chamber 606. In some embodiments, for example, first seal 632-A covers and closes a portion of reaction chamber 606 that extends through front portion 604 of cartridge body 402, and second seal 632-B covers and closes a portion of reaction chamber 606 that extends through rear portion 604 of cartridge body 402.

[0129] In some embodiments, each seal 632 can be configured to sealingly couple to one of the front portion 602 or the rear portion 604 of the cartridge body 402. In some embodiments, each seal 632 can include an adhesive configured to sealingly couple the seal 632 to the cartridge body 402 around the reaction chamber 606. In some embodiments, the adhesive extends to at least the perimeter of the seal 632. In some embodiments, the adhesive can be activated, such as by heating.

[0130] In some embodiments, the adhesive can be evenly distributed over all or a portion of seal 632, and in some embodiments, the adhesive can be located on one or more predetermined portions of seal 632. In some embodiments, for example, the adhesive can be located on seal 632 such that when seal 632 is sealed to cartridge body 402, the adhesive engages reaction chamber 606 around cartridge body 402. In some embodiments, the adhesive can be located in an adhesive ring that is sized, shaped, and positioned such that the adhesive engages reaction chamber 606 around cartridge body 402.

[0131] In some embodiments, seal 632 can be mechanically coupled to cartridge body 402 via one or more coupling features. In such embodiments, seal 632 can include a gasket, such as a rubber O-ring, which can be sized to extend around reaction chamber 606. Seal 632 can also include one or more features configured to engage cartridge body 402 to secure seal 632 to cartridge body 402 with sufficient force such that the gasket seals to cartridge body 402.

[0132] Each seal 632 can be configured to be sealingly coupled to one of the front portion 602 or the rear portion 604 of the cartridge body 402 around the reaction chamber 606, and specifically to be sealingly coupled to one of the front portion 602 or the rear portion 604 of the cartridge body 402 around the perimeter of the reaction chamber 606, thereby enclosing the reaction chamber 606 and the filter membrane 608. In some embodiments, for example, the first seal 632-A is configured to be sealingly coupled to the front portion 602 of the cartridge body 402 around the reaction chamber 606, and the second seal 632-B is configured to be sealingly coupled to the rear portion 604 of the cartridge body 402 around the reaction chamber 606. In some embodiments, sealingly coupling the first seal 632-A to the front portion 602 of the cartridge body 402 and sealingly coupling the second seal 632-B to the rear portion 606 of the cartridge body 402 can sealably enclose the reaction chamber 606 and the filter membrane 608. In some embodiments, the closed reaction chamber 606 can define a volume, for example, the volume can be between about 10 μL and about 250 μL, between about 50 μL and about 200 μL, and / or can be about 100 μL. In some embodiments, the filter membrane 608 contained within the closed reaction chamber 606 can fill about 1 μL of the chamber volume per square millimeter of the filter membrane 608.

[0133] Reference now Figure 7 , shows a front perspective view of another embodiment of a sampling unit 400. The sampling unit includes a box body 402 defining a reaction chamber 606, wherein the reaction chamber 606 includes a filter membrane 608. The box body also includes at least one receiving capsule, specifically including a first receiving capsule 610 and a second receiving capsule 612. The sampling unit 400 also includes a box receiver 404. Figure 7 As depicted, the cartridge body 402 is partially inserted into the receptacle 630 of the cartridge receiver 404 such that the reaction chamber 606 and the filter membrane 608 are enclosed within the receptacle 630 of the cartridge receiver 404. As further depicted, a seal 632, particularly a first seal 632-A, extends through the front portion 602 of the cartridge body 402 to enclose one side of the reaction chamber 606 and one side of the filter membrane 608.

[0134] like Figure 7 As further shown in FIG. 4 , the cartridge receiver 404 may include one or more locking features 700. The locking features 700 may engage with mating portions of the cartridge body 402 to secure the cartridge body 402 within the receptacle 630 of the cartridge receiver 404. In some embodiments, the locking features 700 may include one or more flexible members configured to expand into mating features, such as recesses on the cartridge body 402, to couple the cartridge body 402 to the cartridge receiver 404. Figure 7The sampling unit 400 shown in FIG. 4 shows the unit in an analytical configuration, with the reaction chamber 606 and filter membrane 608 in a position sealed into the reaction chamber in preparation for nucleic acid amplification.

[0135] Reference now Figure 8 , shows a front perspective view of an embodiment of a sampling unit 400. The sampling unit includes a box body 402 defining a reaction chamber 606, the reaction chamber 606 including a filter membrane 608. The box body also includes at least one receiving capsule, specifically including a first receiving capsule 610 and a second receiving capsule 612. The sampling unit 400 also includes a box receiver 404. Figure 7 As depicted, the cartridge body 402 is partially removed from the receptacle 630 of the cartridge receiver 404 such that the reaction chamber 606 and the filter membrane 608 are not enclosed within the receptacle 630 of the cartridge receiver 404. Additionally, the cartridge body 402 is partially removed from the receptacle 630 of the cartridge receiver 404 such that the locking feature 700 of the cartridge receiver is not engaged with the mating feature 800 of the cartridge body 402. Figure 8 The illustrated sampling unit 400 shows the unit in a sample capture configuration, wherein the reaction chamber 606 and filter membrane 608 are not inserted into the cartridge receptacle 404 and are available to accept fluid flow, and in particular, to accept air flow through the filter membrane 608 .

[0136] Reference now Fig. 9 , a front view of an embodiment of a sampling unit 400 is shown. The sampling unit includes a box body 402 defining a reaction chamber 606, which contains a filter membrane 608. The box body also includes at least one containing capsule, and specifically includes a first containing capsule 610 and a second containing capsule 612. The sampling unit 400 also includes a box receiver 404. As further depicted, the box body 402 includes a vent 900, which is configured to release pressure during the movement of reagents from the containing capsules 610, 612. In some embodiments, the vent 900 can be connected to a chamber and / or fluid channel inside the box body 402, and the chamber or fluid channel inside the box body 402 is fluidly coupled to the reaction chamber 606 and the containing capsules 610, 612.

[0137] Reference now Fig.10 , shows a rear view of one embodiment of a sampling unit 400. The sampling unit 400 includes a cartridge body 402 defining a reaction chamber 606, the reaction chamber 606 including a filter membrane 608. The sampling unit 400 also includes a cartridge receiver 404.

[0138] As further depicted, the rear portion 604 of the cartridge body 402 includes one or more compliant piercing features 1002. In some embodiments, as will be discussed in more detail below, the piercing features can release the contents of the containment capsules 610, 612, thereby allowing the contents of the containment capsules 610, 612 to mix and / or the contents of the containment capsules 610, 612 to move to the reaction chamber 606. In some embodiments, the compliant piercing features 1002 can improve the release of the contents of one or more of the containment capsules 610, 612. Fig.10 In the embodiment shown in , the compliant puncture feature 1002 includes a pair of compliant puncture features 1002 associated with the first containment capsule 610. In some embodiments, the pair of compliant puncture features 1002 includes a first compliant puncture feature 1002-A and a second compliant puncture feature 1002-B. In some embodiments, manipulating the first compliant puncture feature 1002-A can open a portion of the first containment capsule 610 to allow the contents of the first containment capsule 610 to mix with the contents of the second containment capsule 612. In some embodiments, manipulating the second compliant puncture feature 1002-B can open a portion of the first containment capsule 610 to allow the contents of the first containment capsule 610, particularly the mixed contents of the first containment capsule 610 and the second containment capsule 612, to move to the reaction chamber 606.

[0139] Reference now Fig.11 , showing a front perspective view of the transparent box body 402. The box body 402 defines the reaction chamber 606, the first fluid channel 614, the second fluid channel 616, the exhaust hole 900, the outlet channel 1102, and the overflow chamber 1104. The overflow chamber 1104 can be configured to accommodate any excess fluid from the reaction chamber 606, and specifically can include a first overflow chamber 1104-A, a second overflow chamber 1104-B, and a third overflow chamber 1104-C. In some embodiments, and as Fig.11 As depicted, the first overflow chamber 1104 -A is fluidically closest to all overflow chambers 1104 , the third overflow chamber 1104 -C is fluidically least close to all overflow chambers 1104 , and the second overflow chamber 1104 -B is midway between the first overflow chamber 1104 -A and the third overflow chamber 1104 -C and the reaction chamber 606 .

[0140] The first overflow chamber 1104-A is fluidically connected to the reaction chamber 606 via the first outlet channel 1102-A. The second outlet channel 1102-B fluidically connects the first overflow chamber 1104-A to the second overflow chamber 1104-B, and the third outlet channel 1102-C (such as Fig.15As shown in FIG. 1 , the second overflow chamber 1104-B is fluidically connected to the third overflow chamber 1104-C. In addition, the third overflow chamber 1104-C is connected to the external environment through the exhaust hole 900.

[0141] like Fig.11 As shown, the box body 402 includes a first compliant puncture feature 1002-A, a second compliant puncture feature 1002-B and a fixed puncture feature 1106. As previously described, the first and second compliant puncture features 1002-A, 1002-B are connected to the first containment capsule 610 and / or form a part of the first containment capsule 610, and are configured to deflect to selectively release the contents of the first containment capsule 610. The fixed puncture feature 1106 is connected to the second containment capsule 612 and / or forms a part of the second containment capsule 612. The fixed puncture feature 1106 is not as flexible or compliant as the first and second compliant puncture features 1002-A, 1002-B. Therefore, the fixed puncture feature 1106 does not deflect to selectively release the contents of the second containment capsule 612, but compresses the second containment capsule 612 onto the fixed puncture feature 1106, thereby releasing the contents of the second containment capsule 612.

[0142] Each of the first and second compliant piercing features 1002-A, 1002-B and the fixed piercing feature 1106 includes at least one penetrator 1108. The penetrator 1108 may include a variety of shapes and sizes and may be configured to penetrate a film or membrane to release the contents of at least a portion of the container capsule by allowing the contents to pass through one or more holes created by the penetrator in the film or membrane. In some embodiments, the penetrator 1108 may include a pointed member, such as one or more cones. Fig.11 In the embodiment shown in , the penetrator 1108 includes a single cone for each of the first and second compliant piercing features 1002-A, 1002-B, and multiple cones for the fixed piercing feature 1106. The multiple cones of the penetrator 1108 of the fixed piercing feature 1106 are arranged around the outlet 1110 that is fluidly coupled to the first fluid channel 614.

[0143] Reference now Fig.12 , a perspective cross-sectional view of one embodiment of a box body 402 is shown. As shown, the box body 402 includes a first containment capsule 610 and a second containment capsule 612. Each of the first containment capsule 610 and the second containment capsule 612 is separated into a plurality of chambers by a foil 1202 (also referred to herein as a separator 1202). The foil 1202 can be positioned within each of the first containment capsule 610 and the second containment capsule 612 so that the foil 1202 and / or a portion of the foil 1202 can be pierced by a piercer 1108 of a piercing feature 1002-A, 1002-B, 1106 of the containment capsule.

[0144] Reference now Fig.13 , a side cross-sectional view of one embodiment of the box body 402 is shown. Fig.13 yes Fig.12 6. As shown, the foil 1202 separates each of the first and second containment capsules 610, 612 into a plurality of chambers. Specifically, the foil separates each containment capsule into a first chamber 1302 and a second chamber 1304, wherein the first chamber 1302 contains the contents of the containment capsules 610, 612, and the second chamber 1304 includes the piercing features 1002-A, 1002-B, 1106 of the containment capsules 610, 612. The piercing feature 1002-B is Fig.11 and Fig.14 Shown in.

[0145] For example, the first containment capsule 610 includes two compliant puncture features 1002-A, 1002-B, each of which is isolated from the first chamber 1302 by a piece of foil. The first chamber 1302 contains the contents of the first containment capsule 610, and specifically, the first chamber 1302 contains the dry reagent of the first containment capsule 610.

[0146] Since each compliant puncture feature 1002-A, 1002-B of the first accommodating capsule 610 is separate, the puncture foil 1202 separates the first chamber 1302 from the second chamber 1304, wherein the second chamber 1304 includes one of the compliant puncture features 1002-A, 1002-B, and only one of the compliant puncture features 1002-A, 1002-B is fluidly connected to the first chamber 1302, thereby being fluidly connected to the contents of the first chamber 1302. Specifically, the first compliant puncture feature 1002-A is manipulated to puncture the membrane separating the first chamber 1302 from the first compliant puncture feature 1002-A, the second chamber 1304 containing the first compliant puncture feature 1002-A is fluidically connected to the first chamber 1302 of the first accommodating capsule 610, and the second chamber 1304 containing the second compliant puncture feature 1002-B is not connected to the first chamber 1302 of the first accommodating capsule 610. Similarly, manipulating the second compliant puncturing feature 1002-B to puncture the membrane separating the first chamber 1302 from the second compliant puncturing feature 1002-B will fluidly connect the second chamber 1304 containing the second compliant puncturing feature 1002-B to the first chamber 1302 of the first accommodating capsule 610, and will not connect the second chamber 1304 containing the first compliant puncturing feature 1002-A to the first chamber 1302 of the first accommodating capsule 610.

[0147] Therefore, in some embodiments, the foil 1202 of the first containing capsule includes a first foil 1202-A separating the first chamber 1302 of the first containing capsule 610 from the second chamber 1304 containing the first compliant puncture feature 1002-A, and a second foil 1202-B separating the first chamber 1302 of the first containing capsule 610 from the second chamber 1304 containing the second compliant puncture feature 1002-B.

[0148] Compared to the first containment capsule 610, the second containment capsule 612 includes only a single fixed piercing feature 1106 and thus includes only a single membrane 1202 that separates the second containment capsule 612 into a first chamber 1302 and a second chamber 1304. In some embodiments, the first chamber 1302 of the second containment capsule may include a reagent, and specifically may include one or more aqueous reagents.

[0149] In some embodiments, each of the first fluid channel 614 and the second fluid channel 616 is connected to the second chamber 1304 and is fluidically coupled to the first chamber 1302 only after the foil 1202 is pierced. Specifically, the first fluid channel 614 is fluidically coupled to the second chamber 1304 of the second receiving capsule 612, and is also fluidically coupled to the second chamber 1304 containing the first compliant piercing feature 1002-A of the first receiving capsule 610. The second fluid channel 616 is fluidically coupled to the second chamber 1304 containing the second compliant piercing feature 1002-B of the first receiving capsule 610. Due to this architecture, the foil 1202 of the second receiving capsule 612 and the foil 1202-A of the first receiving capsule 610 are both pierced to allow the aqueous reagent in the second receiving capsule 612 to enter the first receiving capsule 610, so that the aqueous reagent and the dry reagent are mixed. After the reagents are mixed, the foil 1202 -B is pierced, placing the first chamber 1302 of the first containing capsule in fluid communication with the second fluid channel 616 , thereby allowing the mixed reagents to flow into the reaction chamber 606 .

[0150] In some embodiments, to achieve such manipulation of the cartridge body 402, the manipulation module 206 may include one or more actuators that can selectively manipulate the piercing features 1002-A, 1002-B, 1106 and / or their associated containment capsules 610, 612. In some embodiments, the manipulation module 206 may include: a first actuator configured to manipulate the first compliant piercing feature 1002-A to pierce the foil 1202-A; a second actuator configured to manipulate the second compliant piercing feature 1002-B to pierce the foil 1202-B; and a third actuator configured to manipulate the second containment capsule 612 to pierce the foil 1202 of the second containment capsule 612. In some embodiments, the first containment capsule 610 may be manipulated by a fourth actuator to allow the contents of the first containment capsule 610 to enter the reaction chamber 606 through the second fluid channel 616.

[0151] In some embodiments, the processor 210 can be configured to control the manipulation module 206, and specifically control the actuator to first mix the aqueous reagent and the dry reagent, and then move the mixed reagent into the reaction chamber 606 through the second fluid channel 616. In some embodiments, the processor 210 can be configured to control the actuator to mix the aqueous reagent and the dry reagent; and control the actuator engaged with the second compliant piercing feature 1002-B to pierce the membrane 1202-B and / or move the mixed reagent into the reaction chamber 606 through the second fluid channel 616.

[0152] Specifically, the processor 210 may control the first actuator to manipulate the first compliant piercing feature 1002-A to pierce the foil 1202-A, thereby fluidly coupling the first chamber 1302 of the first containment capsule 610 with the first fluid channel 614, and may control the third actuator to compress the second containment capsule 612 to pierce the foil 1202 of the second containment capsule 612, thereby fluidly coupling the first chamber 1302 of the second containment capsule 612 with the first fluid channel 614. The processor 210 may further control the third actuator to further compress the second containment capsule 612 to move the aqueous reagent from the second containment capsule 612 to mix with the dry reagent in the first chamber 1302 of the first containment capsule 610. The processor 210 may also control the second actuator to manipulate the second compliant piercing feature 1002-B to pierce the foil 1202-B, thereby fluidly coupling the first chamber 1302 of the first containment capsule 610 with the second fluid channel 616 and the reaction chamber 606. The processor 210 can also control the fourth actuator to compress the first containing capsule 610 so that the mixed reagents fill the reaction chamber 606. In some embodiments, when the fourth actuator compresses the first containing capsule 610, the third actuator can keep the second containing capsule 612 in a compressed state so that the mixed reagents from the first containing capsule 610 do not flow back into the second containing capsule 612.

[0153] Reference now Fig.14 , which is an exploded perspective view of the sampling unit 400. The sampling unit 400 includes a cartridge body 402, which includes a fluid chip 1400 and a chip laminate 1402. In some embodiments, the fluid chip 1400 may include at least a portion of the fluid channels 614, 616, 1102, the chamber 1104, the puncture features 1002-A, 1002-B, 1106, and the reaction chamber 606. The fluid chip 1400 may include polypropylene, polycarbonate, etc. The chip laminate 1402 may be coupled to the fluid chip 1400 to close the rear 604 of the cartridge body 402, and specifically close the fluid channels 614, 616, 1102 and the chamber 1104.

[0154] In some embodiments, the fluidic chip 1400 can be manufactured and one or more absorbent pads 1406 can be inserted into one or more overflow chambers 1104, and specifically can be inserted into the second overflow chamber 1104-B. In some embodiments, one or more absorbent pads 1406 can be placed in the second overflow chamber 1105-B to allow overflow into the first overflow chamber 1104-A without wicking that may occur if one or more absorbent pads 1406 are placed in the first overflow chamber 1104-A. In some embodiments, this wicking action may unnecessarily draw reagents out of the reaction chamber 606, which may inhibit and / or interfere with the nucleic acid amplification process and / or may remove target analytes from the reaction chamber 606. In some embodiments, one or more absorbent pads 1406 can prevent reagents from leaving the box body 402.

[0155] The filter membrane 608 may be positioned above the reaction chamber 606, and then the chip laminate 1402 may be adhered to the fluidic chip 1400, thereby connecting the filter membrane 608 to the cartridge body 402, enclosing one or more absorbent pads 1406 in one or more overflow chambers 1104, and closing the rear portion 604 of the cartridge body 402. The capsule 1408 may be connected to the fluidic chip 1400, thereby forming a first containment capsule 610 and a second containment capsule 612.

[0156] In some embodiments, the cartridge receptacle may be fabricated by attaching a first seal 632-A and a second seal 632-B to the body 405. Fig.14 In the embodiment shown, Figure 6 In contrast to the embodiment of the present invention, the seal 632 is coupled to the outer surface of the body 405, thereby defining the container 630. In some embodiments, the adhesive can be applied to the first seal 632-A and the second seal 632-B before or after the seals 632-A, 632-B are connected to the body 405.

[0157] refer to Fig.15 , shows a front view of an embodiment of the sampling unit 400. Fig.15In the embodiment of the present invention, the box body 402 is transparent, so that the originally hidden features are visible. As shown, the box body 402 includes a first fluid channel 614 connecting the first accommodating capsule 610 and the second accommodating capsule 612, and a second fluid channel 616 connecting the first accommodating capsule 610 and the reaction chamber 606. The box body 402 also includes an outlet channel 1102 and an overflow chamber 1104. Specifically, the box body 402 shows a first outlet channel 1102-A, a second outlet channel 1102-B, and a third outlet channel 1102-C, as well as a first overflow chamber 1104-A, a second overflow chamber 1104-B, and a third overflow chamber 1104-C. As shown, the first outlet channel 1102-A connects the first overflow chamber 1104-A to the reaction chamber 606, the second outlet channel 1102-B connects the first overflow chamber 1104-A to the second overflow chamber 1104-B, and the third outlet channel 1102-C connects the second overflow chamber 1104-B to the third overflow chamber 1104-C.

[0158] In some embodiments, one, some, or all of the fluid channels 614, 616, 1102 may include one or more features configured to directionally restrict the flow of fluid therethrough. In some embodiments, for example, one, some, or all of the fluid channels 614, 614, 1102 may include a one-way valve configured to allow fluid to flow in a desired direction and prevent fluid from flowing in an opposite direction. In some embodiments, for example, a one-way valve may be provided in the first fluid channel 614 between the first and second containment capsules 610, 612, and / or a one-way valve may be provided in the second fluid channel 616 between the first containment capsule 610 and the reaction chamber 606. In some embodiments, the one-way valve in the second fluid channel 616 may prevent fluid from moving into and / or out of the reaction chamber 606 via the second fluid channel 616 during nucleic acid amplification, particularly during thermal cycling.

[0159] The cartridge body 402 further includes a first foil 1202-A connecting the first chamber 1302 of the first containment capsule 610 to a second chamber 1304 of the first containment capsule 610, the second chamber 1304 of the first containment capsule 610 including the first compliant puncture feature 1002-A and being fluidly connected to the first fluid channel 614. The cartridge body 402 further includes a second foil 1202-B connecting the first chamber 1302 of the first containment capsule 610 to a second chamber 1304 of the first containment capsule 610, the second chamber 1304 of the first containment capsule 610 including the second compliant puncture feature 1002-B and being fluidly connected to the second fluid channel 616. The cartridge body 402 further includes a foil 1202 separating the first chamber 1302 of the second containment capsule 612 from the second chamber 1304 of the second containment capsule 612, the second chamber 1304 including the fixed puncture feature 1106 and being fluidly connected to the first fluid channel 614.

[0160] In some embodiments, the sampling unit 400 can be used in conjunction with the fluid sampling and analysis system 102, and in some embodiments, the sampling unit 400 can be used independently of the fluid sampling and analysis system 102. In some embodiments, for example, the sampling unit 400 can be configured to receive a sample on the cartridge body 402, and specifically receive a sample within the reaction chamber 606 of the cartridge body 402. In some embodiments, the sample can be received on the SCS, the SCS can include a filter membrane configured to capture the sample from a fluid passing through the filter membrane, or the SCS can be a substrate and / or feature configured to receive and / or hold the sample. In some embodiments, for example, the sample can include a drop of bodily fluid, such as a drop of blood, and the SCS and / or reaction chamber can only receive and / or hold the drop of blood. In such an embodiment, the cartridge body 402 can be received in the container 630 of the cartridge receptacle 404, the reaction chamber 606 (including the SCS 608) can be closed, and the nucleic acid amplification process can be performed on the closed reaction chamber 606 including the SCS 608. In some embodiments, the sample may include a drop of bodily fluid, such as a drop of blood, and the sample is placed or transferred directly into the reaction chamber in the absence of an SCS.

[0161] In some embodiments, the sampling unit 400 can be used to collect samples and to analyze samples from, for example, one or more humans, animals, etc. Regardless of how the sample is collected, and whether or not an SCS is used, after the sample is collected, the cartridge body 402 can be received in a container of a cartridge receptacle 404, and a nucleic acid amplification process can be performed on the reaction chamber and the SCS contained in the reaction chamber. In some embodiments, this can include positioning the reaction chamber 606 and the SCS 608 in a first position relative to the cartridge receptacle 404 to collect the sample, and positioning the reaction chamber 606 and the SCS 608 in a second position relative to the cartridge receptacle 404 to perform nucleic acid amplification on the sample and analyze the sample.

[0162] In one embodiment, a human uses, for example, a disposable mouthpiece to blow air directly into the fluid delivery module 208, so that at least some microorganisms (e.g., bacteria, viruses, etc.) entrained in the air exhaled from the human respiratory tract are captured by the SCS. In one embodiment, the sampling unit 400 measures the amount of air blown through the fluid delivery module 208 until a predetermined amount of air has passed through the SCS, at which point the fluid delivery module 208 is closed and no further air is allowed to pass. Thereafter, the sampling unit 400 continues to analyze the sample as disclosed herein. In some embodiments, the fluid delivery module 208 includes a one-way valve so that air cannot flow to the mouthpiece. In some embodiments, the disposable mouthpiece can be coupled to the fluid delivery module 208 directly at the SCS and / or coupled to the fluid delivery module 208 in such a way that before the exhaled air reaches the SCS, there is minimal or no cross-contamination between human subjects for surfaces within the fluid delivery module 208. In some embodiments, once the analysis results are obtained from the human breath sample, the communication module 214 transmits the results to the gating system / device 106 so that, based on the results, the person providing the sample can be allowed or not allowed to leave the premises or pass through a gate, such as boarding a commercial aircraft or entering a space containing other people who have been screened and allowed to pass. Alternatively, the sampling and analysis system can be placed in a room where humans enter and stay for a period of time, so that the system can be used as a non-invasive diagnostic device. Therefore, the sampling and analysis system can be used not only for human diagnostic applications, but also for veterinary and livestock applications, such as monitoring the health and disease state of individual animals or groups of animals.

[0163] Reference now Fig.16 and Fig.17, a perspective view of another embodiment of a sampling unit 400 is shown. The sampling unit 400 includes a box body 402 and a box receiver 404. The box body 402 includes an amplification chamber 1120, an SCS 608, and an overflow chamber 1104. The plunger pushes into the holding capsule 612 to transfer an aqueous wash buffer to the SCS 608 after sample capture. The buffer removes the analyte from the SCS and transfers the mixture to the channel junction. The nucleic acid amplification reagent is transferred from another holding capsule 612 to the channel junction, at which time the nucleic acid amplification reagent and the wash buffer containing the analyte are transferred to the amplification chamber 1120. In some embodiments, the amplification chamber 1120 can be transparent to allow the contents of the amplification chamber 1120 to be excited and / or the fluorescence emitted by the contents of the amplification chamber 1120 to be detected.

[0164] The sampling unit 400, and in particular the cartridge receiver 404, can define a container 630 configured to receive a portion of the cartridge body 402, and in particular configured to receive the reaction chamber 606 and / or the SCS 608. The sampling unit 400, and in particular the cartridge receiver 404, can include one or more second containment capsules 612, which in some embodiments can contain one or more aqueous reagents.

[0165] Reference now Fig.18 and Fig.19 , a perspective view of a hinged embodiment of a sampling unit 400 is shown. The sampling unit 400 includes a box body 402 and a box receptacle 404. The box body 402 includes an SCS 608. The box receptacle 404 includes a first body member 405-A and a second body member 405-B, which are connected to the box body 402 by a hinge 1122. In such an embodiment, the first body member 405-A and the second body member 405-B can pivot about the hinge 1122 so that the box body 402, and in particular the SCS 608, is located between the first body member 405-A and the second body member 405-B. In such a position, the SCS 608 can be received in the container 630 of the box receptacle 606.

[0166] The sampling unit 400 and, in some embodiments, the cartridge receiver 404 may include one or more capsules that may contain one or more reagents, specifically, one or more nucleic acid amplification reagents. In some embodiments, these capsules may include one or more first capsules 610 that contain one or more dry reagents, and / or one or more second capsules 612 that contain one or more aqueous reagents. Fig.18 and Fig.19In the illustrated embodiment, the cartridge body includes a plurality of second containment capsules 612. In some embodiments, the contents of the capsules are mixed, transported through the SCS to capture analytes, and further transported to the amplification chamber 1120, where a nucleic acid amplification process and analysis can be performed.

[0167] In some embodiments, Fig.18 and Fig.19 The sampling unit 400 shown in FIG. 4 can be moved to a first position in which the SCS 608 is exposed for sample collection, and can be moved to a second position, such as Fig.19 As shown in FIG. 6 , in this second position the SCS 608 is enclosed in a container 630 by the first body member 405-A and the second body member 405-B. When the SCS 608 is enclosed in the container 630, nucleic acid amplification processes and analysis can be performed.

[0168] Reference now Fig. 20 and Fig.21 , a perspective view of another hinged embodiment of a sampling unit 400 is shown. The sampling unit 400 includes a cartridge body 402 and a cartridge receptacle 404. The cartridge body 402 includes a reaction chamber 606, which includes an SCS 608. The cartridge receptacle 404 can be connected to the cartridge body 402 by a hinge 1122. In such an embodiment, the cartridge body 402 can be moved to a first position in which the SCS 608 and / or the reaction chamber 606 are exposed for sample collection and / or for receiving a sample, and to a second position in which the SCS 608 and / or the reaction chamber 606 are contained within a container 630 of the cartridge receptacle 404.

[0169] In some embodiments, Fig. 20 The sampling unit 400 shown in FIG. 4 can be moved to a first position in which the SCS 608 is exposed for sample collection and can be moved to a second position, such as Fig.21 As shown in FIG. 6 , in this second position, the SCS 608 is enclosed within the container 630. When the SCS 608 is enclosed within the container 630, nucleic acid amplification processes and analyses may be performed using reagents contained in one or more containment capsules of the sampling unit 400.

[0170] Reference now Fig. 22, a perspective view of another embodiment of a sampling unit 400 is shown. The sampling unit 400 includes a cartridge body 402 and a cartridge receptacle 404. The cartridge body 402 includes a reaction chamber 606, which includes an SCS 608. The cartridge body 402 also includes a second containment capsule 612. In some embodiments, after sample collection, the contents of the containment capsule 612 are mixed and transferred to the reaction chamber 606 to saturate the SCS 608. The cartridge body 402 is then inserted into the cartridge receptacle 404, and a waterproof perimeter is heat-fused around the reaction chamber 608, thereby sealing the cartridge receptacle 404 to enclose the reaction chamber 608. In some embodiments, the cartridge receptacle 404 can be transparent to allow excitation of the contents of the reaction chamber 606 and / or detection of fluorescence emitted by the contents of the reaction chamber 606 during thermal cycling.

[0171] The cartridge receptacle 404 may define a receptacle 630 configured to receive a portion of the cartridge body 402, and in particular configured to receive the reaction chamber 606 and / or the SCS 606. Fig.21 In an embodiment of the present invention, the cartridge receiver 404 includes a bag configured to receive at least the reaction chamber 606 and / or the SCS 608 , thereby enclosing the reaction chamber 606 including the SCS 608 .

[0172] Reference now Fig.23 and Fig.24 , a perspective view of another embodiment of a unit sampling unit 400 is shown. The box body 402 includes a reaction chamber 606, which includes an SCS 608. The box body 402 also includes a first holding capsule 610 that holds dry reagents, and a second holding capsule 612 that holds one or more aqueous reagents. The box body 402 also includes an overflow chamber 1104. The first holding capsule 610 and the second holding capsule 612 are fluidly connected together and connected to the reaction chamber 606, so that the aqueous reagents are transferred to the first holding capsule 610, where they are mixed with the dry reagents and then transferred to the reaction chamber 606. Any excess mixed reagents can leave the reaction chamber 606 and enter the overflow chamber 1104.

[0173] The sampling unit 400 includes a cartridge body 402 that includes a movable seal 632. The seal 632 can be coupled to the cartridge body 402 such that the seal can be moved from a first position, in which the reaction chamber 606 is open to receive a sample, and from a second position, in which the reaction chamber 606 is closed. In some embodiments, the seal 632 can be moved from the first position (e.g., Fig.23 as shown) moves to a second position (as shown) Fig.24 606 ), and can be sealed around the reaction chamber 606, thereby closing the reaction chamber 606. After the reaction chamber 606 is closed and sealed, a nucleic acid amplification process can be performed in the reaction chamber 606.

[0174] Fig.25 is a description of the direct nucleic acid amplification and analysis process, or in other words, nucleic acid amplification and analysis performed on a reaction chamber 606 containing an SCS 608. Fig.25 A cartridge body 402 is depicted, comprising a reaction chamber 606 with an SCS 608, first and second containment capsules 610, 612, and an overflow chamber 1104. As seen in (A), the aqueous reagent of the second containment capsule 612 is fluidly coupled to the dry reagent of the first containment capsule 610, and as shown in (B), the reagents are mixed. The reaction chamber 606 is then filled with the mixed reagent, as shown in (C), until the reaction chamber 606 is completely filled, as shown in (D). Filling the reaction chamber 606 with the mixed reagent may immerse the SCS 608 in the reagent. In some embodiments, a certain amount of the mixed reagent may flow from the reaction chamber 606 into the overflow chamber 1104. As shown in (E), the nucleic acid amplification and analysis processes are performed directly on the reaction chamber 606 and the SCS 608.

[0175] Reference now Fig.26 , a flow chart of one embodiment of a process 2600 for collecting and analyzing samples is shown. The process can be performed by all or part of the fluid sampling and analysis system 102. The process 2600 begins at block 2602, where a new sample unit 400 is retrieved from the cassette 202. In some embodiments, retrieving a new sample unit 400 from the cassette 202 can include the processor 210 checking whether a new sample unit 400 is available in the cassette 202. If there is no new sample unit 400 available in the cassette 202, the processor 210 can generate an alarm, which can be transmitted, for example, via the communication module 214. The alarm can indicate that the cassette 202 should be refilled. The processor 210 can also transmit the current new / used sample unit count upon request and / or send an alarm according to a programmed sampling rate, informing that the new sample unit will be fully consumed at a specific time and date.

[0176] Alternatively, if it is determined that a new sample unit 400 is available in the cartridge 202, the processor 210 may direct the manipulation module to remove the sample unit 400 containing the collected sample from the fluid delivery module and retrieve the new sample unit 400 from the cartridge 202. The manipulation module 206 may execute the control signal received from the processor 210 and may retrieve the new sample unit 400 from the cartridge 202.

[0177] At block 2604, the cartridge body 402 of the sampling unit 400 may be positioned for sample collection. In some embodiments, this may include preparing the sampling unit 400, and in particular preparing the cartridge body 402, to allow fluid to pass through the reaction chamber 606 and in particular through the filter membrane 608. In some embodiments, preparing the sampling unit may include separating the cartridge body 402 from the cartridge receptacle 404 such that the reaction chamber 606 is located outside of the container 630 of the cartridge receptacle 404. In some embodiments, preparing the sampling unit 400 may include unsealing the reaction chamber 606 from a configuration in which the filter membrane 608 has not been exposed to air outside the reaction chamber 606 and / or the sampling unit since manufacture, and therefore is not contaminated by any microorganisms prior to capturing the analyte. After preparing the sampling unit, the sampling unit 400, and in particular the cartridge body 402, may be inserted into and / or coupled to the fluid delivery module 208 such that the fluid delivery module 208 may move the fluid through the reaction chamber 606 in the filter membrane 608 to capture the sample.

[0178] In some embodiments, positioning the cartridge body for sample collection may be controlled by the processor 210, which may generate control signals to cause the manipulation module 206 to prepare the sample unit for sample collection and to cause the manipulation module to position the sampling unit 400, particularly the cartridge body 402, for sample collection. The manipulation module 206 may execute the control signals received from the processor 210 and may prepare the sample unit 400 for sample collection and may position the sample unit 400 in or be coupled to the fluid delivery module 208 so that the fluid may move through the reaction chamber 606 and the filter membrane 608.

[0179] At block 2606, the fluid passes through the reaction chamber 606, specifically through the filter membrane 608 to capture the sample. In some embodiments, the fluid can be transported through the reaction chamber 606, specifically through the filter membrane 608, by the fluid transport module 208. In some embodiments, the fluid can be air, water, sewage, etc.

[0180] In some embodiments, the processor 210 can control the fluid delivery module 208 to move the fluid through the reaction chamber 606 and in particular through the filter membrane 608 to capture the sample. In some embodiments, the processor 210 can control the fluid delivery module 208 to filter the membrane 608 at a rate of about 0.1 LPM / min. 2 10 LPM / mm to filter membrane 608 2 The processor 210 may control the fluid delivery module 208 to move the fluid through the filter membrane 608 at a rate between about 1 LPM / mm and about 1 LPM / mm. 2 5LPM / mm to filter membrane 608 2In some embodiments, the processor 210 can control the fluid transport module 208 to move the fluid through the filter membrane 608 at a rate between 0.1 LPM / mm2 of the filter membrane 608 and 10 LPM / mm2 of the filter membrane 608, so that less than 50 Db is generated at a distance of 36 inches from the sampling and analysis system 102. In some embodiments, the processor 210 can control the fluid transport module 208 so that each collected sample captures the analyte from about 500 L of air passing through the filter membrane 608 to about 100,000 L of air passing through the filter membrane 608.

[0181] In some embodiments, the sampling and analysis system 102 can initiate air sampling upon receiving a signal. In some embodiments, the signal can be initiated in response to carbon dioxide levels within the building rising above a threshold level. In some embodiments, the signal can be manually initiated from a remote location. In some embodiments, the sampling and analysis system 102 performs air sampling within a predetermined number of hours corresponding to the time when human occupancy within the building exceeds a certain human density per square foot.

[0182] At block 2608, after sample collection is completed, the cartridge body 402 is removed from the fluid delivery module 208, the cartridge body 402 is coupled to the cartridge receiver 404, and the sampling unit 400 is placed in the analysis module 204. In some embodiments, the processor 210 may generate control signals to direct the manipulation module 206 to remove the cartridge body 402 from the fluid delivery module 208, couple the cartridge body 402 to the cartridge receiver 404, and place the sampling unit 400 in the analysis module 204. The manipulation module 206 may receive these control signals and may execute according to the control signals.

[0183] In some embodiments, the analysis module 204 begins thermal cycling the sample unit 400 containing the analyte while the manipulation module 206 places a new sample unit 400 into the fluid delivery module 208. In other words, the biosensor 102 is able to capture a new sample while the previously captured sample is still in the process of being analyzed by nucleic acid amplification. In some embodiments, the processor 210 receives results from the analysis module that indicate the presence of a certain microbial pattern in the sampling environment. Based on these results, the processor 210 directs the manipulation module 206 to select a certain type of new sample unit 400 from the cartridge 202. For example, if analysis of the first sample unit 400 using PCR primers that are universal for all types of coronaviruses indicates the presence of coronaviruses, the processor 200 can direct the manipulation module 206 to select a specific new sample unit 400 from the cartridge 200 that is loaded with PCR primers that can distinguish between SARS-CoV-2 (the cause of the COVID-19 pandemic), SARS-CoV (the cause of the SARS outbreak in 2002-2004), and MERS-CoV (the cause of the MERS outbreak in 2012). Having a cartridge 202 containing sample units containing different PCR reagents specific for different microorganisms, including reagents that broadly detect certain classes of pathogens, and reagents that detect specific genera, species, or strains of microorganisms within a broad class, enables the biosensor to broadly scan a fluid (e.g., air) for certain types of pathogens and then quickly determine the exact type of pathogen without human intervention. An advantage of operating the biosensor 102 in this manner is that it can avoid missing certain types of pathogens by only running PCR reagents that are specific for a particular species or strain of microorganism.

[0184] In some embodiments, after the cartridge body 402 is removed from the fluid delivery module 208, a new cartridge body 402 can be retrieved from the cassette 202 and positioned to collect a sample (if additional samples are needed). Thus, in some embodiments, a new sampling unit 400 can be retrieved from the cassette 202 and positioned to collect a new sample by passing fluid through the reaction chamber 606 and filter membrane 608 of the cartridge body 402 of the new sampling unit 400.

[0185] In some embodiments, coupling of the cartridge body 402 and the cartridge receptacle 404 can include inserting the cartridge body 402 into the receptacle 630 of the cartridge receptacle 404. In some embodiments, the cartridge body 402 can be inserted into the receptacle 630 of the cartridge receptacle 404 until the reaction chamber 606 of the cartridge body 402 is fully enclosed within the cartridge receptacle 404, and specifically, fully enclosed within the receptacle 630 of the cartridge receptacle 404. In some embodiments, when the cartridge body 402 is fully inserted into the receptacle 630 of the cartridge receptacle 404, one or more locking features 700 of one of the cartridge body 402 and the cartridge receptacle 404 can engage with one or more meeting features 800 of the other of the cartridge body 402 and the cartridge receptacle 404, thereby securing the cartridge body 402 to the cartridge receptacle 404.

[0186] At block 2610, the reaction chamber 606 is closed. In some embodiments, closing the reaction chamber also closes the filter membrane 608 within the reaction chamber 606. In some embodiments, inserting the cartridge body 402 into the receptacle 630 of the cartridge receptacle 404 can close the reaction chamber 606 of the cartridge body 402. In some embodiments, the reaction chamber 606 is closed by the sealer 306, which seals the seal 632 of the cartridge receptacle 404 to the cartridge body 402. In some embodiments, the first seal 632-A can seal to the front 602 of the cartridge body 402 around the perimeter of the reaction chamber 606. Likewise, in some embodiments, the second seal 632-B can seal to the rear 604 of the cartridge body 402 around the perimeter of the reaction chamber 606. In some embodiments, the sealer 306 can seal the seal 632 to the cartridge body, for example, by an adhesive, welding, heat welding, pressure welding, laser welding, ultrasonic welding, friction welding, solid state welding, heat fusion welding, and the like.

[0187] In some embodiments, the processor 210 can control the closure of the reaction chamber 606 by generating and sending a control signal to the manipulation module 206 to at least partially insert the cartridge body 402 into the cartridge receptacle 404, and sending a control signal to the sealer 306 to seal the first and second seals 632-A, 632-B to the cartridge body 402 around the perimeter of the reaction chamber 606. In some embodiments, sealing the first and second seals 632-A, 632-B to the cartridge body 402 around the perimeter of the reaction chamber 606 can include sealing the first seal 632-A to the front 604 of the cartridge body 402 and sealing the second seal 632-B to the rear 604 of the cartridge body 402.

[0188] At block 2612, a nucleic acid amplification process is performed on the contents of the closed reaction chamber 606, including the contents on the filter membrane 608 contained in the closed reaction chamber 606. In some embodiments, the nucleic acid amplification process can be performed directly on the reaction chamber 606 and / or directly on the filter membrane 608. In some embodiments, performing the nucleic acid amplification reaction directly on the reaction chamber 606 and on the filter membrane can include filling the reaction chamber 606 with a nucleic acid amplification reagent and thermally cycling the reaction chamber 606 and the filter membrane 608 contained in the reaction chamber 606. In some embodiments, filling the reaction chamber 606 with a nucleic acid amplification reagent can include mixing an aqueous nucleic acid amplification reagent with a dry nucleic acid amplification reagent and filling the mixed nucleic acid amplification reagent into the reaction chamber 606.

[0189] In some embodiments, performing a nucleic acid amplification process can include, for example, sealing the second fluid channel 616 and / or fluid channel 1102-A after filling the reaction chamber 606 with reagents and prior to thermal cycling. In some embodiments, the second fluid channel 616 and / or fluid channel 1102-A can be sealed to prevent reagents from leaving and / or entering the reaction chamber 606 during the nucleic acid amplification process (particularly during thermal cycling).

[0190] In some embodiments, the nucleic acid amplification process may include an isothermal nucleic acid amplification process or a non-isothermal nucleic acid amplification process. In some embodiments, the nucleic acid amplification process may include a PCR process. In some embodiments, the nucleic acid amplification process may be performed according to control signals generated by the processor 210 through the manipulation module 206 (particularly the fluid actuator 308) and the analysis module 204 (particularly the thermal cycler 302).

[0191] At block 2614, fluorescence is collected from the enclosed reaction chamber 606 and analyzed. In some embodiments, the collection and analysis of fluorescence from the enclosed reaction chamber 606 may include measurement of fluorescence from the enclosed reaction chamber 606. In some embodiments, the fluorescence may be collected and / or analyzed by the analysis module 204 and specifically by the optical device 304. In some embodiments, the collection and analysis of fluorescence may include applying excitation energy to the reaction chamber, and capturing fluorescence emitted by the reaction chamber 606 and the contents of the reaction chamber including the filter membrane 608. In some embodiments, the collection and analysis of fluorescence from the enclosed reaction chamber 606 may be performed according to one or more control signals generated by the processor 210.

[0192] In some embodiments, after completing the collection and analysis of the fluorescence from the closed reaction chamber 606, the cartridge body 402 containing the analyzed sample can be ejected from the analysis module 204 and can be disposed of. In some embodiments, this can include placing the used sampling unit 400 in the portion of the cartridge 202 containing the used sampling unit 400.

[0193] At block 2616, the presence and / or absence of at least one target analyte is determined based on the fluorescence collected from the closed reaction chamber 606. In some embodiments, this may include detecting the presence and / or absence of one or more airborne pathogens based on the fluorescence signal collected and analyzed in block 2614. In some embodiments, the presence or absence of at least one target analyte may be determined by the analysis module 204 and / or the processor 210.

[0194] At block 2618, the results are transmitted to another system. In some embodiments, the results may be transmitted electronically to another system, for example, via the communication module 214. In some embodiments, electronically transmitting the results to another system may include transmitting the results to another system, such as the control system 104 and / or one or more additional systems / devices 106, by wire or wirelessly. In some embodiments, the other system may be at least one of a building ventilation system, an alarm, a notification system, and the like.

[0195] In some embodiments, the results may include an indication of the presence or absence of at least one target analyte. The target may be one or more pathogens, and specifically may be one or more airborne pathogens. Thus, in some embodiments, the results may indicate the presence, absence, and / or concentration of one or more airborne pathogens detected in the sample.

[0196] Process 2600 can be performed once or multiple times in a time period. For example, in some embodiments, process 2600 can be performed continuously so that samples are collected while analyzing previously collected samples. In some embodiments, this execution of process 2600 can include making air pass through filter membrane 608 to capture 48 analyte samples in one day. Each of these 48 samples can be analyzed after collecting the sample. In some embodiments, each of these 48 samples can include closing the filter membrane 608 in the reaction chamber 606 after collecting the sample, directly performing nucleic acid amplification reaction on reaction chamber 606 and filter membrane 608, and measuring the fluorescent signal from reaction chamber 606 and filter membrane 608. In some embodiments, the result of each sample can be transmitted to another system by, for example, wired or wireless communication.

[0197] refer to Fig. 27, a flow chart of one embodiment of a process 2700 for performing a nucleic acid amplification process is shown. In some embodiments, the nucleic acid amplification process can include at least one of: qPCR, PCR, RT-PCR, RT-qPCR, digital PCR, isothermal amplification process, immuno-PCR, proximity ligation PCR, etc.

[0198] The process may be performed as part of the steps of block 2612 of process 2600 or in place of the steps of block 2612 of process 2600. Process 2700 may be performed by all or part of the fluid sampling and analysis system 102. Process 2700 begins at block 2702, where a foil 1202 in a second containment capsule 612 is pierced. In some embodiments, the foil 1202 in the second containment capsule 612 is pierced by the processor 210, which generates a control signal to control an actuator in the manipulation module 206 to compress the second containment capsule 612 so that the foil is forced onto at least one penetrator 1108 of the fixed penetration feature 1106. In some embodiments, piercing the foil 1202 of the second containment capsule 612 may fluidly connect the contents of the second containment capsule 612 to the first fluid channel 614.

[0199] At block 2704, the foil 1202-A separating the first chamber 1302 of the first containment capsule 610 from the first fluid channel 614 and / or the first compliant piercing feature 1002-A may be pierced. In some embodiments, the foil 1202-A is pierced by the processor 210, which generates a control signal to control an actuator in the manipulation module 206 to compress the first compliant piercing feature 1002-A to move toward the foil 1202-A until at least one penetrator 1108 of the compliant piercing feature 1002-A pierces the foil 1202-A. In some embodiments, piercing the foil 1202-A separates the first chamber 1302 of the first containment capsule 610 from the first fluid channel 614 and / or the first compliant piercing feature 1002-A, and the contents of the first chamber 1302 of the first containment capsule 610 may be fluidly connected with the contents of the second containment capsule 612.

[0200] At block 2706, the contents of the first containment capsule 610 and the second containment capsule 612 are mixed. In some embodiments, this may include the processor 210 controlling the actuator to compress the second containment capsule 612 so that the contents of the second containment capsule 612 enter the first chamber 1302 of the first containment capsule 610 through the first fluid channel 614. In some embodiments, the contents of the second containment capsule 12 may include one or more aqueous reagents, and the contents of the first containment capsule 610 may include one or more dry reagents. Mixing the contents of the first containment capsule 610 and the second containment capsule 612 may activate the dry reagents and may produce a homogenous solution that is capable of detecting one or more analytes when a nucleic acid amplification reaction (e.g., thermal cycling) is performed in the presence of SCS.

[0201] At block 2708, the foil 1202-B separating the first chamber 1302 of the first containment capsule 610 from the second fluid channel 616 and / or the second compliant piercing feature 1002-B may be pierced. In some embodiments, the foil 1202-B is pierced by the processor 210, which generates a control signal to control an actuator in the manipulation module 206 to compress the second compliant piercing feature 1002-B to move it toward the foil 1202-B until the at least one penetrator 1108 of the second compliant piercing feature 1002-B pierces the foil 1202-B. In some embodiments, piercing the foil 1202-B separating the first chamber 1302 of the first containment capsule 610 from the second fluid channel 616 and / or the second compliant piercing feature 1002-B may fluidly connect the mixed contents of the first chamber 1302 of the first containment capsule 610 with the reaction chamber 606.

[0202] At block 2710, the mixed contents are advanced from the first chamber 1302 of the first containment capsule 610 and through the second fluid channel 616 to the reaction chamber 606. In some embodiments, the mixed contents may advance to the reaction chamber 606 until the reaction chamber is filled with the mixed reagent from the first chamber 1302 of the first containment capsule 610, which may include a nucleic acid amplification reagent. In some embodiments, this may include the processor 210 controlling the actuator to compress the first containment capsule 610 so that the mixed reagent of the first containment capsule 610 advances through the second fluid channel 616 and enters the reaction chamber 606. In some embodiments, the reaction chamber 606 is filled with the mixed reagent to immerse the filter membrane 608 in the mixed reagent. In some embodiments, excess mixed reagent pushed into the reaction chamber may leave the reaction chamber 606 through the outlet channel 1102 and may sense and / or partially fill the overflow chamber 1104. In some embodiments, for example, excess reagent may be absorbed by one or more absorbent pads 1406, which may be inserted into one or more overflow chambers 1104. In some embodiments, the sampling unit 400 is held in a vertical position such that the reaction chamber 606 is located at the bottom ( Fig.15 ), while the second accommodating capsule 612 is located at the top ( Fig.15 ), thereby allowing fluid channel 616 to fill reaction chamber 606 from the lowest point, thereby filling the reaction chamber from the bottom up and pushing any bubbles out the top through fluid channel 1102-A.

[0203] At block 2712, the temperature of reaction chamber 606 is controlled according to the particular nucleic acid amplification process being performed. In some embodiments, this may include heating reaction chamber 606 and the contents of reaction chamber 606 including filter membrane 608 to a first temperature to enable reverse transcription, and then cycling heating and cooling reaction chamber 606 and the contents of reaction chamber 606 including filter membrane 608 to perform a PCR reaction after the reverse transcription step is complete.

[0204] In some embodiments, the nucleic acid amplification process does not include a traditional lysis or extraction step. Instead, the lysis of the analyte occurs during sample capture and during the reverse transcription phase. Therefore, in some embodiments, the target nucleic acid may be exposed to a reagent during sample capture and during the reverse transcription phase. Advantageously, this lysis occurs at a temperature that prevents the inactivation of the reverse transcriptase. Conventional analytical methods use extraction and / or rinsing steps, such as PCR tests of nasal swabs, in which the swabs are rinsed and discarded. The design and operation of the device disclosed herein are based on the following insights: since microorganisms may be relatively diluted in the air compared to the high concentrations found on the inner surface of the human nasal cavity, for example, it is critical to achieve high sensitivity in a shorter sampling time. This is achieved in part by constructing a nucleic acid amplification reaction chamber around the SCS immediately after sampling is completed and performing nucleic acid amplification directly on the SCS instead of rinsing / extracting the SCS and transferring the analyte (which results in a loss of yield). Constructing a nucleic acid amplification reaction chamber around the SCS, wherein the SCS occupies more than 40%, 50%, 60%, 70%, 80% or 90% of the total volume of the reaction chamber, increases sensitivity while reducing the amount of reagents and thereby reducing costs. The sampling and analysis system 102 can be placed indoors or outdoors, including in building lobbies or other public areas, airport boarding gates, bathrooms, etc., attached to the HVAC return air duct so that air from the duct enters the fluid delivery module 208, within HVAC systems, within offices, within transportation vehicles such as ships, airplanes, trains, subways and submarines, within doctors' offices, within hospitals, etc.

[0205] Example 1

[0206] Air samples were collected from the homes of people known to be infected with SARS CoV-2. Nasal swab samples were also collected. Both types of samples were collected at 24-hour intervals and showed that air samples captured on the SCS showed the same reduction in the amount of virus detected in nasal swabs from infected individuals, where the SCS containing the analyte was directly amplified in an RT-qPCR reaction without the need for extraction or rinse steps. Therefore, air sampling using the methods and compositions disclosed herein can be used to accurately detect infected humans in indoor environments with similar sensitivity as nasal swabs, but without the need for individual human testing, human consent, or even knowledge. Fig.28Two graphs are shown, each depicting a SARS-CoV-2 qPCR curve. Each of these graphs depicts Delta Rn (y-axis) versus cycle number (Cycle #) (x-axis). Graph (A) shows SARS-CoV-2 qPCR curves for nasal swab samples collected every 24 hours. To generate this data, human nasal swab samples were collected in TRIS-EDTA buffer containing SDS, and 5uL was added directly to a 20uL qPCR reaction using Fast-Virus MasterMix with added Tween. Swabs were collected at 0 hours, 24 hours, 48 ​​hours, and 72 hours. As shown in graph (A), the ratio of delta Rn to cycle number decreases over time. Therefore, the ratio of delta Rn to cycle number is higher at 0 hours than at 24 hours, higher than at 48 hours, or higher than at 72 hours.

[0207] Graph (B) shows the SARS-CoV-2 qPCR curves for bioaerosol sampling over the same time frame. The first of these time windows is 0-23 hours, the second is 24-47 hours, and the third is 48-71 hours. To generate these data, bioaerosols were captured on SCS and a 3.0 mm punch from each SCS was placed directly into a 50uL PCR reaction. As shown in graph (B), the ratio of delta Rn to cycle number decreases over time. Therefore, in the first time interval between 0-23 hours, the difference between delta Rn and cycle number is higher than in the second or third time windows. RT-qPCR conditions were as follows: SC2FWD primer (5'-3') CTGCAGATTTGGATGATTTCTCC (800 nM); SC2REV primer CCTTGTGTGGTCTGCATG AGTTTAG (800 nM); SC2probe / 6FAM / ATTGCAACA / ZEN / ATC CATGAGCAGTGCTGACTC / 3IBFQ / (800 nM). PCR program: 50°C reverse transcription for 10 min, 95°C initial denaturation for 20 s, (95°C denaturation for 3 s, 60°C extension for 30 s) × 40 cycles.

[0208] Example 2

[0209] Candidate SCS materials were evaluated for compatibility with direct amplification in RT-qPCR reactions. Fig.29A graph depicting RT-qPCR curves for a positive control, an electrostatically charged material (electrostatic KX polypropylene), and a non-electrostatically charged material (non-electrostatically charged meltblown polypropylene) is shown. The graph depicts Delta Rn (y-axis) versus cycle number (Cycle #) (x-axis). The graph includes two curves for each material, one of which shows a curve of approximately 7 mm 2 50 μL RT-qPCR reaction of the material, another curve shows about 85 mm 2 The optimal SCS area is 50-200 mm 2 As can be seen, as the amount of electrostatically charged material increases, the electrostatically charged material significantly inhibits the RT-qPCR reaction. Therefore, in some embodiments, the electrostatically charged material may not be as suitable for SCS as the non-electrostatically charged material.

[0210] Example 3

[0211] The efficiency of candidate SCS materials in capturing aerosolized virus particles was evaluated. Fig.30 Graphs depicting RT-qPCR curves for a positive control, negative control, polycarbonate (a commonly used air filtration material), and meltblown polypropylene are shown. The OC43 coronavirus was aerosolized and then captured by pulling air through the SCS material at 50L / min. A 3mm punch of SCS material was placed into a 50uL RT-pPCR reaction for amplification. The results suggest that not all materials used for air filtration and particle capture are effective as SCS.

[0212] Example 4

[0213] Example 4 shows the capture and RT-qPCR amplification of aerosolized OC43 coronavirus using a cartridge body comprising a reaction chamber to which a non-statically charged meltblown polypropylene SCS is attached. 6 Genome copies / uL of OC43 virus culture (Zeptometrics) was diluted 10 in phosphate buffered saline. 7 , and atomized in a glove box. The resulting aerosol is captured on the SCS attached to the box at a flow rate of 50L of air per minute for 15 minutes. The SCS is then sealed in the reaction chamber using a seal. The RT-qPCR reagents are added to the box and transferred to the reaction chamber through the fluid channel in the box. The box is then processed in a thermal cycler and optical devices in a thermal cycle breadboard, and fluorescent images are taken at the end of each extension step. The resulting image is processed by measuring pixel intensity using imaging (imageJ) software. The initial average pixel intensity is subtracted from the subsequent cycle value to calculate the Delta Rn value. This end-to-end run shows the ability to capture viruses, amplify and detect nucleic acids directly from the SCS in the reaction chamber of the integrated consumable box.

[0214] In the foregoing description, the present invention is described with reference to its specific embodiments, but those skilled in the art will recognize that the present invention is not limited thereto. The various features and aspects of the above invention can be used alone or in combination. In addition, the present invention can be used in any number of environments and applications other than those described herein without departing from the broader spirit and scope of this specification. Therefore, the description and drawings should be regarded as illustrative rather than restrictive. It will be recognized that the terms "including", "comprising" and "having" used herein are specifically intended to be understood as open terms.

Claims

1. An air sampling and analysis system, comprising: a processor configured to execute stored computer instructions to control the air sampling and analysis system; a consumable cartridge comprising a cartridge body and a sample capture substrate (SCS); an air handler configured to move air through the SCS; a thermal cycler configured to bring the air sampling reaction chamber to one or more desired temperatures to perform nucleic acid amplification directly on the SCS; and An optical device is configured to measure a fluorescent signal from the air sampling reaction chamber.

2. The system according to claim 1, further comprising: A communications module for electronically transmitting data to another system and optionally for receiving operational instructions.

3. The system according to claim 1, further comprising: A cartridge receptacle defines a container configured to receive the SCS and at least a portion of the cartridge body, and wherein the SCS extends through an air sampling reaction chamber defined by the cartridge body.

4. The system of claim 3, wherein the cartridge receptacle comprises at least one seal capable of sealingly coupling to the cartridge body around the air sampling reaction chamber, thereby enclosing the air sampling reaction chamber and the SCS.

5. The system of claim 4, wherein the volume of the closed air sampling reaction chamber is between 50 μL and 200 μL.

6. The system of claim 5, wherein the volume of the closed air sampling reaction chamber is approximately 100 μL.

7. The system of claim 4, wherein the cartridge body comprises a front portion and a rear portion, wherein the seal comprises a first seal and a second seal, wherein the first seal is configured to be sealingly coupled to the front portion of the cartridge body around the air sampling reaction chamber, and wherein the second seal is configured to be sealingly coupled to the rear portion of the cartridge body around the air sampling reaction chamber.

8. The system of claim 7, wherein the first seal is sealingly coupled to the front of the cartridge body and the second seal is sealingly coupled to the rear of the cartridge body to enclose the air sampling reaction chamber and the SCS.

9. A system according to claim 8, wherein the first seal is transparent, and wherein the box receiver is positioned relative to the optical device to expose the SCS to the optical device through the first seal.

10. The system of claim 9, further comprising an adhesive configured to sealingly couple the seal to the cartridge body around the air sampling reaction chamber.

11. The system of claim 10, wherein the adhesive is heat activated.

12. The system of claim 10, wherein the adhesive extends around a perimeter of the seal.

13. The system of claim 8, further comprising a sealer configured to seal the seal to the cartridge body.

14. The system of claim 13, further comprising: a mechanism for ejecting a used cartridge body and positioning a new cartridge body for sample capture and analysis; and a magazine including a plurality of new cartridge bodies and cartridge receivers.

15. The system of claim 14, wherein the cartridge body comprises a first containing capsule containing a dry reagent and a second containing capsule containing an aqueous reagent.

16. The system of claim 1, wherein the consumable cartridge comprises one or more containment capsules containing nucleic acid amplification primers specific for at least one of: Clostridium botulinum, Listeria monocytogenes, Campylobacter, trichinosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Bacillus anthracis, Acinetobacter baumannii including multidrug-resistant Acinetobacter baumannii, Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli including fluoroquinolone-resistant Escherichia coli and Escherichia coli O157:H7, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B and C), coronaviruses (including SARS CoV, SARS CoV-2 (including Alpha (Bl1.7 and Q lineages), Beta (B.1.351 and descendant lineages), Gamma (Pl and descendant lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1 and 1.617.3), Mu (B.1.621, B.1.621.1), Zeta (P.2), Delta (B.1.617.2 and AY lineages) and Omicron (B.1.1.529 and BA lineages)) as well as MERS, adenovirus, influenza virus (including type A and type B); parainfluenza virus; respiratory syncytial virus (including type A and type B); enterovirus; norovirus (including genogroups GI, GII, GIII, GIV, GV, GVI and GVII); rotavirus viruses that cause measles, rubella, varicella / shingles, roseola, smallpox, and fifth disease, chikungunya, hepatitis (including A, B, C, D, and E), herpes simplex virus, papillomavirus; molluscum contagiosum; polio virus; rabies virus; viruses that cause viral meningitis and encephalitis, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, H10N8, H11N2, H11N9, H17N10, H18N11, HPIV-1, HPIV-2, HPIV-3, HPIV-4, HAdV-B, HAdV-C, 229E, OC43,NL63, HUK1, Sin Nombre Hantavirus, Black Creek Canal Hantavirus, Puumala virus, Tailand virus, HRV-A1, HRV-A2, HRV-A7-13, HRV-A15, HRV-A16, HRV-A18-25, HRV-A28-34, HRV-A36, HRV-A38-41, HRV-A43-47, HRV-A49-51, HRV-A53-68, HRV-A71, HRV-A73-78, HRV-A80-82, HRV-A85, HRV-A88-90, HRV-A94-96, HRV-A98, HRV-A100-103, HRV-B3-6, HRV-B14, HR V-B17, HRV-B26, HRV-B27, HRV-B35, HRV-B37, HRV-B42, HRV-B48, HRV-B52, HRV-B69, HRV-B70, HRV-B72, HRV-B79, HRV-B83, HRV-B84, HRV-B86, HRV-B91-93, HRV-B97, HRV-B99 and HRV-C1-51, human-associated microorganisms such as Actinomycetes, Aeromonas, Akkermansia, Asteraceae, Deinococcus, Anaerobic Cocci, Anaerobic Bacteria, Bacteroides, Bambusia, Bifidobacterium, Blautia, Butyrivibrio, Chlamydia, Clostridium, Corynebacterium, Propionibacterium Bacillus (formerly Propionibacterium), Bacillus microti, Bichromococcus, Enterobacter, Enterococcus, Escherichia coli, Faecalibacterium, Fusobacterium, Gardnerella, Bacillus, Haemophilus, Klebsiella, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, Mobiluncus, Moraxella, Mycobacterium, Mycoplasma, Neisseria, Oxalicobacter, Papilloma, Parabacteroides, Micromonas, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Roseburia, Ruminococcus, Snailia, Spirochete, Staphylococcus, Streptococcus, Villous, Alternaria, Aspergillus, Candida, Cladosporium, Curvularia, Ebeliella, Fusarium, Penicillium, Saccharomyces, Stachybotrys, Thermophilus Fungi, Trichophyton, Malassezia and Rhodotorula, human RNAse-P, allergenic molds including Alternaria, Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium, Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium filutanum, Echinococcus and Penicillium viride), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum and Fusarium moniliforme), Pumilax, Phoma, Smut, Rhizopus and Mucor, and pollen, including pollen from plants and trees, including ragweed, mountain cedar, ryegrass,Maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper, oak, pecan, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, timothy, plantain, pigweed, red amaranth, sagebrush, and tumbleweed (Russian thistle).

17. The system of claim 15, wherein the cartridge body further comprises: a first fluid channel coupling the first accommodating capsule and the second accommodating capsule; and a second fluid channel coupling the first containing capsule and the air sampling reaction chamber.

18. The system of claim 17, wherein each of the first and second housing capsules is separated into a first chamber and a second chamber by a membrane.

19. The system of claim 18, wherein the first chamber of the first containing capsule contains the dry reagent, wherein the first chamber of the second containing capsule contains the aqueous reagent, and wherein the second chamber of each of the first containing capsule and the second containing capsule contains at least one piercing feature configured to pierce the membrane and release the contents of the first chamber.

20. The system of claim 19, wherein the first fluid channel and the second fluid channel are coupled to the second chamber of the first housing capsule, and wherein the first fluid channel is coupled to the second chamber of the second housing capsule.

21. The system of claim 20, further comprising: a first actuator configured to pierce a membrane of the first sealed capsule; a second actuator configured to compress the second sealed capsule to pierce the membrane; and a third actuator for compressing the first sealed capsule to move the contents of the first sealed capsule into the air sampling reaction chamber.

22. The system of claim 21, wherein the processor is configured to: control the first actuator and the second actuator to mix the aqueous reagent and the dry reagent; and control the third actuator to move the mixed reagent into the air sampling reaction chamber through the second fluid channel.

23. The system of claim 1, wherein the optical device is configured to measure fluorescence signals of at least four channels.

24. The system of claim 1, wherein the processor is configured to control the air handler to move air through the SCS at a desired flow rate.

25. The system of claim 24, wherein the flow rate is between 0.1 LPM / mm of the SCS. 2 To 10 LPM / mm of the SCS 2 between.

26. The system of claim 25, wherein the system is configured to collect and analyze 10 to 80 air samples per day, and wherein: At least some of these air samples were collected by passing approximately 500 L of air through the SCS and 100,000 L of air through the SCS.

27. The system of claim 25, wherein the system is configured to provide a 0.1 LPM / mm 2 Up to 10LPM / mm 2 At flow rates between 20 and 30 °C, less than 50 dB of noise is generated at a distance of 36 inches from the system.

28. The system of claim 24, wherein the flow rate is approximately 100 LPM.

29. The system of claim 28, wherein the area of ​​the SCS is 0.5 mm 2 Up to 2,000mm 2 between.

30. The system of claim 28, wherein the SCS has a thickness between approximately 0.02 mm and 0.5 mm.

31. The system of claim 28, wherein the air handler and SCS are configured to achieve a pressure drop between approximately 1 kPA and 30 kPA.

32. The system of claim 28, wherein the SCS has a weight of about 5 g / m 2 Up to 60g / m 2 between.

33. The system of claim 28, wherein the SCS has at least one of the following: an area of ​​approximately 115 mm 2 ; Width or diameter is approximately 12mm.

34. The system of claim 33, wherein the system is capable of collecting and analyzing up to about 32 air samples per day, and wherein at least some of the air samples are collected by moving about 3,000 L of air through the SCS.

35. The system of claim 1, wherein the thermal cycler is configured to maintain the reaction chamber at a temperature between 20°C-60°C during a reverse transcription phase prior to a nucleic acid amplification phase.

36. The system of claim 35, wherein cleavage of the analyte occurs during the sample capture and reverse transcription stages.

37. The system of claim 36, wherein the target nucleic acid is available for exposure to reagents during the sample capture and reverse transcription stages.

38. The system of claim 1, wherein the system performs RT-qPCR.

39. The air sampling and analysis system of claim 1, wherein: The SCS is electrostatically free.

40. An automated air sampling and analysis method, the method comprising: passing air through a sample capture substrate (SCS) to capture the analyte; Enclosing the SCS in a reaction chamber; performing a nucleic acid amplification reaction directly on the SCS within the reaction chamber; as well as Fluorescence signals from the reaction chamber and the SCS are measured, wherein the method is performed within a single instrument without manual intervention.

41. The method of claim 40, further comprising: The presence of one or more airborne pathogens is detected based on the measured fluorescent signal.

42. The method of claim 41 further comprising: Transfer the results to another system.

43. The method of claim 42, wherein the result indicates the presence of the one or more airborne pathogens is detected.

44. The method of claim 40, further comprising: The absence of one or more airborne pathogens is detected based on the measured fluorescent signal.

45. The method of claim 44, further comprising: Transfer the results to another system.

46. ​​The method of claim 40, wherein air is at about 0.1 LPM / mm of the SCS. 2 To about 10 LPM / mm of the SCS 2 The speed between passes through the SCS.

47. The method of claim 40, wherein air is at about 1 LPM / mm of the SCS. 2 and 5LPM / mm of the SCS 2 The speed between passes through the SCS.

48. The method of claim 47, further comprising: At a distance of 36 inches, the SCS is 0.1 LPM / mm 2 and 10LPM / mm of the SCS 2 The flow rate between them is less than 50Db.

49. The method of claim 40, wherein the SCS is connected to a box body that defines the reaction chamber.

50. The method of claim 49, wherein the reaction chamber defined by the cartridge body has a diameter between approximately 1 mm and 50 mm.

51. The method of claim 50, wherein the SCS has a thickness between approximately 0.02 mm and 0.5 mm.

52. The method of claim 51, wherein the SCS has a viscosity of about 1 g / m 2 Up to 100g / m 2 The weight between.

53. The method of claim 52, wherein enclosing the SCS within the reaction chamber comprises: inserting the cartridge body at least partially into a cartridge receptacle including a first seal and a second seal; and sealing the seal around a periphery of the reaction chamber defined by the cartridge body.

54. The method of claim 53, wherein the volume of the closed reaction chamber is between about 50 μl and about 200 μl.

55. The method of claim 53, wherein the volume of the closed reaction chamber is about 100 μl.

56. The method of claim 53, wherein the SCS fills approximately 1 μL of chamber volume / mm2 of the SCS.

57. The method of claim 53, wherein the cartridge body comprises a front portion and a rear portion, wherein the seal comprises a first seal and a second seal, and wherein sealing the seal around a perimeter of the reaction chamber defined by the cartridge body comprises: sealing the first seal to the front portion of the box body; as well as The second seal is sealed to the rear portion of the box body.

58. The method of claim 53, wherein performing the nucleic acid amplification reaction directly on the reaction chamber and the SCS comprises: filling the reaction chamber with nucleic acid amplification reagents; as well as The reaction chamber and the SCS are thermally cycled.

59. The method of claim 58, wherein filling the reaction chamber with nucleic acid amplification reagents comprises: mixing an aqueous nucleic acid amplification reagent with a dry nucleic acid amplification reagent; as well as The mixed nucleic acid amplification reagents are filled into the reaction chamber.

60. The method of claim 40, wherein the nucleic acid amplification reaction amplifies at least one of the following: Clostridium botulinum, Listeria, Campylobacter, trichinosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Bacillus anthracis, Bacillus spp. including multidrug-resistant Baumannia, Acinetobacter baumannii, including Acinetobacter spp., Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli, including fluoroquinolone-resistant Escherichia coli and Escherichia coli O157:H7, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever, and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B, and C), coronaviruses (including SARS CoV, SARS CoV-2 (including Alpha (Bl1.7 and Q lineages), Beta (B.1.351 and descendant lineages), Gamma (Pl and descendant lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1 and 1.617.3), Mu (B.1.621, B.1.621.1), Zeta (P.2), Delta (B.1.617.2 and AY lineages) and Omicron (B.1.1.529,BA1, BA1.1 and BA2 lineages) as well as MERS, adenovirus, influenza virus (including type A and type B); parainfluenza virus; respiratory syncytial virus (including type A and type B); enterovirus; norovirus (including genogroups GI, GII, GIII, GIV, GV, GVI and GVII); rotavirus, astrovirus, viruses causing measles, rubella, varicella / zoster, roseola, smallpox and fifth disease, chikungunya virus, hepatitis (including type A, B, C, D and E), herpes virus, papillomavirus; molluscum contagiosum; polio virus; rabies virus, viruses causing viral meningitis and encephalitis Inflammatory viruses, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, H10N8, H11N2, H11N9, H17N10, H18N11, HPIV-1, HPIV-2, HPIV-3, HPIV-4, HAdV-B, HAdV-C, 229E, OC43, NL63, HUK1, Sin Nombre Hantavirus, Black Creek Canal positive Hanta virus, Puumala virus, Tailand virus, HRV-A1, HRV-A2, HRV-A7-13, HRV-A15, HRV-A16, HRV-A18-25, HRV-A28-34, HRV-A36, HRV-A38-41, HRV-A43-47, HRV-A49-51, HRV-A53-68, HRV-A71, HRV-A73-78, HRV-A80-82, HRV-A85, HRV-A88-90, HRV-A94-96, HRV- A98, HRV-A100-103, HRV-B3-6, HRV-B14, HRV-B17, HRV-B26, HRV-B27, HRV-B35, HRV-B37, HRV-B42, HRV-B48, HRV-B52, HRV-B69, HRV-B70, HRV-B72, HRV-B79, HRV-B83, HRV-B84, HRV-B86, HRV-B91-93, HRV-B97, HRV-B99 and HRV-C1-51, microorganisms associated with humans,For example, Actinomycetes, Aerococci, Akkermansia, Astera, Deinococcus, Anaerobic cocci, Anaerobic bacteria, Mirabilis, Bacteroides, Bambusia, Bifidobacterium, Blautia, Butyrivibrio, Chlamydia, Clostridium, Corynebacterium, Propionibacterium (formerly known as Propionibacterium), Bacillus, Bichromococcus, Enterobacter, Enterococcus, Escherichia coli, Faecalibacterium, Fusobacterium, Gardnerella, Bacillus, Haemophilus, Klebsiella, Lactobacillus, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, Mobiluncus, Moraxella, Separate Mycobacterium, Mycoplasma, Neisseria, Oxalobacter, Papilloma, Parabacteroides, Micromonas, Peptotrophil, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Roseburia, Ruminococcus, Snailia, Spirochetes, Staphylococcus, Streptococcus, Villous, Alternaria, Aspergillus, Candida, Cladosporium, Curvularia, Ebeliella, Fusarium, Penicillium, Saccharomyces, Stachybotrys, Thermophilic fungi, Trichophyton, Malassezia and Rhodotorula, Human RNAse-P, Allergic molds including Alternaria , Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium, Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium firutanensis, Echinococcus and Penicillium virens), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum and Fusarium moniliforme), Short-stalked mold, Stem spot mold, Smut, Rhizopus and Mucor, as well as pollen, including Pollen from plants and trees including ragweed, mountain cedar, ryegrass, maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper, oak, hickory, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, timothy, plantain, pigweed, red amaranth, sagebrush, and tumbleweed (Russian thistle).

61. A method according to claim 59, wherein the dry nucleic acid amplification reagent is contained in a first containing capsule, wherein the aqueous nucleic acid amplification reagent is contained in a second containing capsule, wherein the first containing capsule and the second containing capsule are connected via a first fluid channel, and wherein the first containing capsule and the reaction chamber are connected via a second fluid channel.

62. The method of claim 61, wherein mixing the aqueous nucleic acid amplification reagent with the dry nucleic acid amplification reagent comprises: The second containing capsule is compressed to move at least some of the aqueous nucleic acid amplification reagent to the first containing capsule to mix with the dry nucleic acid amplification reagent, and wherein filling the mixed nucleic acid amplification reagent into the reaction chamber includes: compressing the first containing capsule to move at least some of the mixed nucleic acid amplification reagent from the first containing capsule to the reaction chamber via the second fluid channel.

63. The method of claim 62, further comprising: ejecting the cartridge body after completing measuring the fluorescent signals from the reaction chamber and the SCS; Retrieving a new cartridge body from a magazine containing a plurality of unused cartridge bodies; as well as The new cartridge body is positioned so that air passes through the SCS of the new cartridge body.

64. The method of claim 40, wherein the total autofluorescence of the SCS is less than 50% of the baseline fluorescence.

65. The method of claim 40, wherein the nucleic acid amplification reaction comprises at least one of: qPCR, PCR, RT-PCR, RT-qPCR, digital PCR, an isothermal amplification process, immuno-PCR, and proximity ligation PCR.

66. The method of claim 40, further comprising: passing air through the SCS to capture 6 to 48 analyte samples in a day; and analyzing each of 6 to 48 samples after collecting the sample, wherein analyzing each of the 6 to 48 samples after collecting the sample includes: enclosing the SCS in the reaction chamber, performing the nucleic acid amplification reaction directly on the reaction chamber and the SCS, and measuring the fluorescence signal from the reaction chamber and the SCS.

67. The method of claim 66, wherein each collected sample captures analytes from about 500 L of air passing through the SCS to about 5,000 L of air passing through the SCS.

68. The method of claim 40, wherein air sampling is initiated upon receipt of a signal from another system that is initiated in response to carbon dioxide levels within a building in which the system is located rising above a threshold level.

69. The method of claim 72, wherein air sampling is performed within a predetermined number of hours corresponding to human occupancy times above a certain human density per square foot.

70. The method of claim 40, wherein the SCS is electrostatically non-charged.

71. A system for air sampling, the system comprising: A consumable cartridge, the consumable cartridge comprising: a cartridge body defining an air sampling reaction chamber; and a sample capture substrate coupled to the cartridge body and extending through the air sampling reaction chamber; and A box receiver defines a container configured to receive the sample capture substrate, wherein the box receiver includes a first seal and a second seal, and the first seal and the second seal are capable of being sealingly coupled to the box body around the air sampling reaction chamber to thereby enclose the air sampling reaction chamber, wherein the sample capture substrate is enclosed within the air sampling reaction chamber.

72. The system of claim 71, wherein the air sampling reaction chamber is integrated into the cartridge body.

73. The system of claim 72, wherein the sample capture substrate is coupled to the cartridge body around a perimeter of the air sampling reaction chamber.

74. The system of claim 71, wherein the sample capture substrate is configured to capture airborne microorganisms.

75. The system of claim 74, wherein the sample capture substrate comprises at least one of: polypropylene; polytetrafluoroethylene (PTFE); and polycarbonate.

76. The system of claim 75, wherein the sample capture substrate comprises meltblown polypropylene.

77. The system of claim 74, wherein the sample capture substrate exhibits no autofluorescence or exhibits autofluorescence at a level that does not interfere with nucleic acid amplification analysis using fluorescent probes for target identification.

78. The system of claim 77, wherein the sample capture substrate produces less than 5% of the total system fluorescence.

79. The system of claim 77, wherein the sample capture substrate exhibits autofluorescence that is less than 50% of baseline fluorescence.

80. The system of claim 71, wherein the sample capture substrate does not inhibit nucleic acid amplification reactions.

81. The system of claim 80, wherein the sample capture substrate is stable at temperatures between 4°C and 100°C.

82. The system of claim 71 , wherein at least one seal is transparent.

83. The system of claim 82, wherein the at least one seal comprises at least one of: polycarbonate, polyester, polyethylene terephthalate, glass, and polypropylene.

84. The system of claim 82, wherein at least one seal comprises an extruded membrane.

85. The system of claim 82, wherein the at least one seal has a thickness of less than about 200 μm.

86. The system of claim 82, wherein the at least one seal has a thickness between about 50 μm and about 500 μm.

87. The system of claim 71, further comprising an adhesive configured to sealingly couple the seal to the cartridge body around the air sampling reaction chamber.

88. The system of claim 87, wherein the adhesive is heat activated.

89. The system of claim 87, wherein the adhesive extends to a periphery of the seal.

90. The system of claim 71, wherein the cartridge body comprises a first containment capsule comprising a dry reagent and a second containment capsule comprising an aqueous reagent.

91. The system of claim 90, wherein the cartridge body further comprises: A first fluid channel is coupled to the first receiving capsule and the second receiving capsule, and a second fluid channel is coupled to the first receiving capsule and the air sampling reaction chamber.

92. The system of claim 90, wherein each of the first and second containment capsules is separated into a first chamber and a second chamber by a membrane.

93. The system of claim 92, wherein the first chamber of the first containing capsule contains the dry reagent, wherein the first chamber of the second containing capsule contains the aqueous reagent, and wherein the second chamber of each of the first containing capsule and the second containing capsule contains at least one piercing feature configured to pierce the membrane and allow the contents of the first chamber to enter the second chamber.

94. The system of claim 92, wherein the first fluid channel and the second fluid channel are coupled to the second chamber of the first housing capsule, and wherein the first fluid channel is coupled to the second chamber of the second housing capsule.

95. The system of claim 92, wherein the dry reagent comprises a lyophilized nucleic acid amplification reagent, and wherein the aqueous reagent comprises an aqueous nucleic acid amplification reagent.

96. The system of claim 90, wherein at least one of the reagents comprises a surfactant.

97. The system of claim 96, wherein the surfactant comprises at least one of: Tween; NP40; and Triton X-100.

98. The system of claim 71, wherein the width of the air sampling reaction chamber is between 1 mm and 50 mm.

99. The system of claim 71, wherein the air sampling reaction chamber is circular and has a diameter between 1 mm and 50 mm.

100. The system of claim 71, wherein the volume of the air sampling reaction chamber when closed by the first seal and the second seal is between 10 μL and 250 μL.

101. The system of claim 100, wherein the volume of the closed air sampling reaction chamber is approximately 100 μL.

102. The system of claim 71, wherein the system performs RT-qPCR.

103. The system of claim 71, wherein the cartridge body comprises one or more containment capsules containing nucleic acid amplification primers specific for at least one of: Clostridium botulinum, Listeria monocytogenes, Campylobacter, trichinosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Charcoal Bacillus anthracis, Acinetobacter baumannii including multidrug-resistant Acinetobacter baumannii, Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli including fluoroquinolone-resistant Escherichia coli and Escherichia coli O157:H7, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B and C), coronaviruses (including SARS CoV, SARSCoV-2 (including Alpha (Bl1.7 and Q lineages), Beta (B.1.351 and descendant lineages), Gamma (Pl and descendant lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1 and 1.617.3), Mu (B.1.621, B.1.621.1), Zeta (P.2), Delta (B.1.617.2 and AY lineages) and Omicron (B.1.1.529,BA1 and BA2 lineages) as well as MERS, adenovirus, influenza virus (including type A and type B); parainfluenza virus; respiratory syncytial virus (including type A and type B); enterovirus; norovirus (including genogroups GI, GII, GIII, GIV, GV, GVI and GVII); rotavirus, astrovirus, viruses causing measles, rubella, varicella / zoster, roseola, smallpox and fifth disease, chikungunya virus, hepatitis (including type A, B, C, D and E), herpes virus, papillomavirus; molluscum contagiosum; polio virus; rabies virus, viruses causing viral meningitis and encephalitis Virus, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, H10N8, H11N2, H11N9, H17N10, H18N11, HPIV-1, HPIV-2, HPIV-3, HPIV-4, HAdV-B, HAdV-C, 229E, OC43, NL63, HUK1, Sin Nombre Hantavirus, Black CreekCanal Hantavirus, Puumala virus, Tailand virus, HRV-A1, HRV-A2, HRV-A7-13, HRV-A15, HRV-A16, HRV-A18-25, HRV-A28-34, HRV-A36, HRV-A38-41, HRV-A43-47, HRV-A49-51, HRV-A53-68, HRV-A71, HRV-A73-78, HRV-A80-82, HRV-A85, HRV-A88-90, HRV-A94-96, HRV-A97-98, HRV-A99-100, HRV-A91-101, HRV-A92-102, HRV-A93-103, HRV-A94-104, HRV-A95-105, HRV-A96-106, HRV-A97-107, HRV-A98-108, HRV-A99-109, HRV-A91-109, HRV-A91-101, HRV-A92-103, HRV-A93-104, HRV-A94-105, HRV-A96-106, HRV-A97-108, HRV-A98-109, HRV-A99-109, HRV-A99-101, HRV-A99-103, HRV-A99-104, HRV-A99-105 RV-A98, HRV-A100-103, HRV-B3-6, HRV-B14, HRV-B17, HRV-B26, HRV-B27, HRV-B35, HRV-B37, HRV-B42, HRV-B48, HRV-B52, HRV-B69, HRV-B70, HRV-B72, HRV-B79, HRV-B83, HRV-B84, HRV-B86, HRV-B91-93, HRV-B97, HRV-B99, and HRV-C1-51, microorganisms associated with humans,For example, Actinomycetes, Aerococci, Akkermansia, Astera, Deinococcus, Anaerobic cocci, Anaerobic bacteria, Mirabilis, Bacteroides, Bambusia, Bifidobacterium, Blautia, Butyrivibrio, Chlamydia, Clostridium, Corynebacterium, Propionibacterium (formerly known as Propionibacterium), Bacillus, Bichromococcus, Enterobacter, Enterococcus, Escherichia coli, Faecalibacterium, Fusobacterium, Gardnerella, Bacillus, Haemophilus, Klebsiella, Lactobacillus, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, Mobiluncus, Moraxella, Separate Mycobacterium, Mycoplasma, Neisseria, Oxalobacter, Papilloma, Parabacteroides, Micromonas, Peptotrophil, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Roseburia, Ruminococcus, Snailia, Spirochetes, Staphylococcus, Streptococcus, Villous, Alternaria, Aspergillus, Candida, Cladosporium, Curvularia, Ebeliella, Fusarium, Penicillium, Saccharomyces, Stachybotrys, Thermophilic fungi, Trichophyton, Malassezia and Rhodotorula, Human RNAse-P, Allergic molds including Alternaria , Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium, Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium firutanensis, Echinococcus and Penicillium virens), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum and Fusarium moniliforme), Short-stalked mold, Stem spot mold, Smut, Rhizopus and Mucor, as well as pollen, including Pollen from plants and trees including ragweed, mountain cedar, ryegrass, maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper, oak, hickory, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, timothy, plantain, pigweed, red amaranth, sagebrush, and tumbleweed (Russian thistle).

104. The system of claim 71, wherein the SCS is electrostatically non-charged.

105. Consumable sampling unit, including: a first portion defining a sample capture substrate (SCS); a second portion defining a container configured to receive the SCS and enclose it within a reaction chamber, wherein the SCS is enclosed within the reaction chamber; as well as At least one containing capsule, the at least one containing capsule containing at least one nucleic acid amplification reagent, wherein the at least one containing capsule is capable of being coupled to the reaction chamber and the SCS fluid.

106. The consumable sampling unit of claim 105, wherein the at least one containing capsule comprises: at least one first containing capsule containing dry nucleic acid amplification reagents; and at least one second containing capsule containing aqueous nucleic acid amplification reagents.

107. The consumable sampling unit according to claim 106, wherein said at least one containing capsule is located on said first portion.

108. The consumable sampling unit according to claim 106, wherein the at least one receiving capsule is located on the second part.

109. The consumable sampling unit of claim 106, wherein the at least one first containing capsule is located on one of the first portion and the second portion, and wherein the at least one second containing capsule is located on the other of the first portion and the second portion.

110. The consumable sampling unit of claim 106, wherein the at least one first containing capsule is fluidly connected to the at least one second containing capsule and the reaction chamber.

111. The consumable sampling unit of claim 105, wherein the first portion and the second portion are connected by a pivot.

112. The consumable sampling unit of claim 105, wherein the first portion and the second portion are coupled.

113. The consumable sampling unit of claim 105, wherein the first portion and the second portion are not connected.

114. The consumable sampling unit of claim 105, wherein the SCS is electrostatically non-charged.

115. The consumable sampling unit of claim 105, wherein the sampling unit is configured to collect a sample from air.

116. The consumable sampling unit of claim 105, wherein the sampling unit is configured to collect a sample from a liquid.

117. The consumable sampling unit of claim 105, wherein the nucleic acid amplification reagent comprises a nucleic acid amplification primer specific for at least one of: Clostridium botulinum, Listeria monocytogenes, Campylobacter, trichinosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Bacillus anthracis baumannii, including multidrug-resistant Acinetobacter baumannii, Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli including fluoroquinolone-resistant Escherichia coli and Escherichia coli O157:H7, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B and C), coronaviruses (including SARS CoV, SARS CoV-2 (including Alpha (Bl1.7 and Q lineages), Beta (B.1.351 and descendant lineages), Gamma (Pl and descendant lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1 and 1.617.3), Mu (B.1.621, B.1.621.1), Zeta (P.2), Delta (B.1.617.2 and AY lineages) and Omicron (B.1.1.529,BA1 and BA2 lineages) as well as MERS, adenovirus, influenza virus (including type A and type B); parainfluenza virus; respiratory syncytial virus (including type A and type B); enterovirus; norovirus (including genogroups GI, GII, GIII, GIV, GV, GVI and GVII); rotavirus, astrovirus, viruses causing measles, rubella, varicella / zoster, roseola, smallpox and fifth disease, chikungunya virus, hepatitis (including type A, B, C, D and E), herpes virus, papillomavirus; molluscum contagiosum; polio virus; rabies virus, viruses causing viral meningitis and encephalitis Virus, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, H10N8, H11N2, H11N9, H17N10, H18N11, HPIV-1, HPIV-2, HPIV-3, HPIV-4, HAdV-B, HAdV-C, 229E, OC43, NL63, HUK1, Sin Nombre Hantavirus, Black Creek Canal positive Hanta virus, Puumala virus, Tailand virus, HRV-A1, HRV-A2, HRV-A7-13, HRV-A15, HRV-A16, HRV-A18-25, HRV-A28-34, HRV-A36, HRV-A38-41, HRV-A43-47, HRV-A49-51, HRV-A53-68, HRV-A71, HRV-A73-78, HRV-A80-82, HRV-A85, HRV-A88-90, HRV-A94-96, HRV- A98, HRV-A100-103, HRV-B3-6, HRV-B14, HRV-B17, HRV-B26, HRV-B27, HRV-B35, HRV-B37, HRV-B42, HRV-B48, HRV-B52, HRV-B69, HRV-B70, HRV-B72, HRV-B79, HRV-B83, HRV-B84, HRV-B86, HRV-B91-93, HRV-B97, HRV-B99 and HRV-C1-51, microorganisms associated with humans,For example, Actinomycetes, Aerococci, Akkermansia, Astera, Deinococcus, Anaerobic cocci, Anaerobic bacteria, Mirabilis, Bacteroides, Bambusia, Bifidobacterium, Blautia, Butyrivibrio, Chlamydia, Clostridium, Corynebacterium, Propionibacterium (formerly known as Propionibacterium), Bacillus, Bichromococcus, Enterobacter, Enterococcus, Escherichia coli, Faecalibacterium, Fusobacterium, Gardnerella, Bacillus, Haemophilus, Klebsiella, Lactobacillus, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, Mobiluncus, Moraxella, Separate Mycobacterium, Mycoplasma, Neisseria, Oxalobacter, Papilloma, Parabacteroides, Micromonas, Peptotrophil, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Roseburia, Ruminococcus, Snailia, Spirochetes, Staphylococcus, Streptococcus, Villous, Alternaria, Aspergillus, Candida, Cladosporium, Curvularia, Ebeliella, Fusarium, Penicillium, Saccharomyces, Stachybotrys, Thermophilic fungi, Trichophyton, Malassezia and Rhodotorula, Human RNAse-P, Allergic molds including Alternaria , Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium, Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium firutanensis, Echinococcus and Penicillium virens), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum and Fusarium moniliforme), Short-stalked mold, Stem spot mold, Smut, Rhizopus and Mucor, as well as pollen, including Pollen from plants and trees including ragweed, mountain cedar, ryegrass, maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper, oak, hickory, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, timothy, plantain, pigweed, red amaranth, sagebrush, and tumbleweed (Russian thistle).

118. Consumable sampling unit, including: Sample capture substrate (SCS); a first portion defining a chamber configured to house the SCS, wherein the SCS is capable of being enclosed within the chamber; as well as At least one containing capsule, the at least one containing capsule containing at least one nucleic acid amplification reagent, wherein the at least one containing capsule is capable of being coupled to the chamber and the SCS fluid.

119. A consumable sampling unit according to claim 118, wherein the SCS comprises at least one of: a membrane; a swab; a brush; and a spoon.

120. The consumable sampling unit of claim 119, wherein the chamber comprises a reaction chamber.

121. The consumable sampling unit of claim 120, further comprising a second portion defining a container.

122. A consumable sampling unit according to claim 121, wherein the container is configured to enclose the chamber of the first part.

123. A consumable sampling unit according to claim 122, wherein the container is configured to receive at least the chamber and the SCS.

124. A consumable sampling unit according to claim 123, wherein said at least one containing capsule is located on said first portion.

125. The consumable sampling unit according to claim 123, wherein the at least one receiving capsule is located on the second part.

126. The consumable sampling unit according to claim 118, wherein the at least one containing capsule comprises a first containing capsule containing a dry reagent and a second containing capsule containing an aqueous reagent.

127. The consumable sampling unit of claim 126, further comprising a first fluid channel coupling the first containing capsule and the second containing capsule, and a second fluid channel coupling the first containing capsule and the air sampling reaction chamber.

128. The consumable sampling unit according to claim 126, wherein each of the first and second containing capsules is separated into a first chamber and a second chamber by a membrane.

129. A consumable sampling unit according to claim 128, wherein the first chamber of the first containing capsule contains the dry reagent, wherein the first chamber of the second containing capsule contains the aqueous reagent, and wherein the second chamber of each of the first containing capsule and the second containing capsule contains at least one puncture feature configured to puncture the membrane and allow the contents of the first chamber to enter the second chamber.

130. The consumable sampling unit of claim 128, wherein the first fluid channel and the second fluid channel are coupled to the second chamber of the first containing capsule, and wherein the first fluid channel is coupled to the second chamber of the second containing capsule.

131. The consumable sampling unit of claim 128, wherein the dry reagent comprises a lyophilized nucleic acid amplification reagent, and wherein the aqueous reagent comprises an aqueous nucleic acid amplification reagent.

132. The consumable sampling unit of claim 126, wherein at least one of the reagents comprises a surfactant.

133. The consumable sampling unit of claim 132, wherein the surfactant comprises at least one of: Tween; NP40; and Triton X-100.

134. The consumable sampling unit of claim 118, wherein the nucleic acid amplification reagent comprises a nucleic acid amplification primer specific for at least one of: Clostridium botulinum, Listeria monocytogenes, Campylobacter, trichinosis, Staphylococcus aureus including methicillin- and vancomycin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Enterococci including vancomycin-resistant Enterococci, Salmonella including fluoroquinolone-resistant Salmonella, Bacillus anthracis baumannii, including multidrug-resistant Acinetobacter baumannii, Streptococcus pneumoniae, Candida albicans, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Escherichia coli including fluoroquinolone-resistant Escherichia coli and Escherichia coli O157:H7, Legionella pneumophila, Streptococcus pyogenes, Ebola virus, dengue virus, Nova virus, viruses causing Lassa fever, yellow fever, Marburg hemorrhagic fever and Crimean-Congo hemorrhagic fever, rhinoviruses (including types A, B and C), coronaviruses (including SARS CoV, SARS CoV-2 (including Alpha (Bl1.7 and Q lineages), Beta (B.1.351 and descendant lineages), Gamma (Pl and descendant lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1 and 1.617.3), Mu (B.1.621, B.1.621.1), Zeta (P.2), Delta (B.1.617.2 and AY lineages) and Omicron (B.1.1.529,BA1, BA1.1 and BA2 lineages) as well as MERS, adenovirus, influenza virus (including type A and type B); parainfluenza virus; respiratory syncytial virus (including type A and type B); enterovirus; norovirus (including genogroups GI, GII, GIII, GIV, GV, GVI and GVII); rotavirus, astrovirus, viruses causing measles, rubella, varicella / zoster, roseola, smallpox and fifth disease, chikungunya virus, hepatitis (including type A, B, C, D and E), herpes virus, papillomavirus; molluscum contagiosum; polio virus; rabies virus, viruses causing viral meningitis and encephalitis Inflammatory viruses, H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, H10N8, H11N2, H11N9, H17N10, H18N11, HPIV-1, HPIV-2, HPIV-3, HPIV-4, HAdV-B, HAdV-C, 229E, OC43, NL63, HUK1, Sin Nombre Hantavirus, Black Creek Canal positive Hanta virus, Puumala virus, Tailand virus, HRV-A1, HRV-A2, HRV-A7-13, HRV-A15, HRV-A16, HRV-A18-25, HRV-A28-34, HRV-A36, HRV-A38-41, HRV-A43-47, HRV-A49-51, HRV-A53-68, HRV-A71, HRV-A73-78, HRV-A80-82, HRV-A85, HRV-A88-90, HRV-A94-96, HRV- A98, HRV-A100-103, HRV-B3-6, HRV-B14, HRV-B17, HRV-B26, HRV-B27, HRV-B35, HRV-B37, HRV-B42, HRV-B48, HRV-B52, HRV-B69, HRV-B70, HRV-B72, HRV-B79, HRV-B83, HRV-B84, HRV-B86, HRV-B91-93, HRV-B97, HRV-B99 and HRV-C1-51, microorganisms associated with humans,For example, Actinomycetes, Aerococci, Akkermansia, Astera, Deinococcus, Anaerobic cocci, Anaerobic bacteria, Mirabilis, Bacteroides, Bambusia, Bifidobacterium, Blautia, Butyrivibrio, Chlamydia, Clostridium, Corynebacterium, Propionibacterium (formerly known as Propionibacterium), Bacillus, Bichromococcus, Enterobacter, Enterococcus, Escherichia coli, Faecalibacterium, Fusobacterium, Gardnerella, Bacillus, Haemophilus, Klebsiella, Lactobacillus, Lactobacillus, Lactococcus, Megacoccus, Methanobacterium, Micrococcus, Mobiluncus, Moraxella, Separate Mycobacterium, Mycoplasma, Neisseria, Oxalobacter, Papilloma, Parabacteroides, Micromonas, Peptotrophil, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Roseburia, Ruminococcus, Snailia, Spirochetes, Staphylococcus, Streptococcus, Villous, Alternaria, Aspergillus, Candida, Cladosporium, Curvularia, Ebeliella, Fusarium, Penicillium, Saccharomyces, Stachybotrys, Thermophilic fungi, Trichophyton, Malassezia and Rhodotorula, Human RNAse-P, Allergic molds including Alternaria , Aspergillus (including Aspergillus fumigatus, Aspergillus versicolor and Aspergillus flavus), Cladosporium, Cryptococcus (including Cryptococcus neoformans), Histoplasma capsulatum, Stachybotrys (including Stachybotrys paper), Penicillium (including Penicillium breviscompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium coryniformis, Penicillium cyclophila, Penicillium expansum, Penicillium firutanensis, Echinococcus and Penicillium virens), Helminthosporium, Epicococcus, Fusarium (including Fusarium solani, Fusarium oxysporum and Fusarium moniliforme), Short-stalked mold, Stem spot mold, Smut, Rhizopus and Mucor, as well as pollen, including Pollen from plants and trees including ragweed, mountain cedar, ryegrass, maple, elm, mulberry, hickory, oak, pigweed / tumbleweed, Arizona cypress, alder, ash, beech, birch, maple, cedar, cottonwood, date palm, elm, mulberry, hickory, juniper, oak, hickory, palm, red maple, silver maple, sycamore, walnut, willow, Bermuda grass, Johnson grass, Kentucky bluegrass, orchard grass, ryegrass, sweet spring grass, timothy, plantain, pigweed, red amaranth, sagebrush, and tumbleweed (Russian thistle).

135. The consumable sampling unit of claim 118, wherein the SCS is electrostatically non-charged.

Images