Staphylococcus aureus lipase mutants and uses thereof

By performing site-directed mutagenesis on Staphylococcus aureus lipase, a mutant with higher catalytic specificity was generated, which solved the problem of low 1,3-diacylglycerol ratio in the existing technology and achieved more efficient 1,3-diacylglycerol synthesis.

CN119410605BActive Publication Date: 2025-10-10WUHAN BIORUN BIO TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411529270.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2025-10-10
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

When existing Staphylococcus aureus lipase catalyzes the hydrolysis of triglycerides, the proportion of 1,3-diglyceride is low. The chemical production method has high production costs and produces by-products, and the biological enzyme method has the problem of insufficient catalytic specificity.

Method used

By performing site-directed mutagenesis on Staphylococcus aureus lipase, six mutants were generated, including SALP33A, SALP33L, SALY35L, SALV358E, SALV358Y, and SALV358N, to improve their catalytic specificity for 1,3-diacylglycerol.

Benefits of technology

The mutant significantly increased the ratio of 1,3-diacerol to 1,2-diacerol from 0.68 to 1.10, 1.18, 1.22, 1.07, and 0.96, enhancing the ability to synthesize 1,3-diacerol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119410605B_ABST
    Figure CN119410605B_ABST
Patent Text Reader

Abstract

The application discloses Staphylococcus aureus lipase mutants and application thereof, and relates to the technical field of diglyceride biosynthesis. V358E , SAL V358Y , SAL V358N , SAL P33A , SAL P33L , SAL Y35L . It is detected that, compared to the ratio of 1,3-DAG content to 1,2-DAG content (1,3-DAG / 1,2-DAG) of the wild-type Staphylococcus aureus lipase, the ratio of the six Staphylococcus aureus lipase mutants is increased to 1.10, 1.18, 1.22, 1.07, 1.09 and 0.96. This shows that the six Staphylococcus aureus lipase mutants provided in the application have stronger product preference than the wild type, and are more conducive to the synthesis of 1,3-DAG.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of diglyceride biosynthesis, in particular to a Staphylococcus aureus lipase mutant and application thereof. Background Art

[0002] Diacylglycerol (DAG) is a structural lipid in which one of the fatty acids in triglyceride (TAG) is replaced by a hydroxyl group. DAG is a trace component of natural plant oils and fats and is a recognized safe food ingredient. Depending on the position of the free fatty acid attached to the glycerol carbon backbone, DAG is divided into two isomers: 1,3-diacylglycerol (1,3-DAG) and 1,2-diacylglycerol (1,2-DAG). Due to its unique structure, 1,3-DAG is difficult to regenerate into TAG in the body. Therefore, it has physiological activities and functions such as reducing obesity, inhibiting the accumulation of neutral fat, alleviating diabetes, and preventing / treating hyperlipidemia and cardiovascular and cerebrovascular diseases. Hyperlipidemia and obesity are common conditions in my country, creating a huge market demand for 1,3-DAG. Consequently, research on the preparation of 1,3-DAG has garnered widespread attention in recent years.

[0003] Currently, there are two main methods for producing 1,3-DAG: chemical and enzymatic. The chemical method has high production costs and large equipment losses, and many difficult-to-remove byproducts are usually generated during the preparation process; high temperatures may also lead to a decrease in oil quality. The enzymatic method has the advantages of mild reaction conditions, high catalytic specificity, environmental protection, and high safety of the preparation process, and is widely used in the preparation of DAG. Among them, Staphylococcus aureus lipase (SAL) is a triacylglycerol esterase that can hydrolyze TAG to DAG with high catalytic efficiency, but the proportion of 1,3-DAG in the catalytic product is low. Therefore, it is necessary to develop a highly specific SAL to increase the yield of 1,3-DAG. Summary of the Invention

[0004] This invention provides Staphylococcus aureus lipase mutants and their applications. By subjecting wild-type SAL to site-directed mutagenesis, six SAL mutants were generated that significantly increase the proportion of 1,3-DAG in TAG hydrolysis products. Compared to the wild-type, these mutants exhibit a stronger product preference and are more conducive to 1,3-DAG synthesis. This is achieved using the following techniques.

[0005] In a first aspect of the present invention, a Staphylococcus aureus lipase mutant is provided, wherein the Staphylococcus aureus lipase mutant is obtained by substituting one or more of proline at position 33, tyrosine at position 35, and valine at position 358 in the amino acid sequence shown in SEQ ID NO.1.

[0006] Furthermore, the Staphylococcus aureus lipase mutant is SAL P33A 、SAL P33L 、SAL Y35L 、SAL V358E 、SAL V358Y or SAL V358N ;

[0007] The Staphylococcus aureus lipase mutant SAL P33A , and SAL P33L They are obtained by replacing the proline at position 33 of the amino acid sequence shown in SEQ ID NO.1 with alanine or leucine;

[0008] The Staphylococcus aureus lipase mutant SAL Y35L It is obtained by replacing the tyrosine at position 35 of the amino acid sequence shown in SEQ ID NO.1 with leucine;

[0009] Alternatively, the Staphylococcus aureus lipase mutant SAL V358E 、SAL V358Y 、SAL V358N They are obtained by replacing the valine at position 358 of the amino acid sequence shown in SEQ ID NO.1 with glutamic acid, tyrosine and aspartic acid respectively.

[0010] Furthermore, the encoding of the Staphylococcus aureus lipase mutant SAL P33A 、SAL P33L 、SAL Y35L 、SAL V358E 、SAL V358Y 、SAL V358N The nucleotide sequences are shown in SEQ ID NO. 2-7 respectively.

[0011] The present invention provides the above-mentioned 6 different Staphylococcus aureus lipase mutants. The ratio of 1,3-DAG content to 1,2-DAG content produced by these 6 Staphylococcus aureus lipase mutants is significantly improved compared with the wild-type Staphylococcus aureus lipase shown in SEQ ID NO.1.

[0012] The second aspect of the present invention provides a biomaterial, wherein the biomaterial is any one of the following:

[0013] (1) A nucleic acid molecule encoding any one of the above-mentioned Staphylococcus aureus lipase mutants;

[0014] (2) a recombinant expression vector containing the nucleic acid molecule;

[0015] (3) A recombinant engineering strain into which the recombinant expression vector is transferred.

[0016] Based on the amino acid sequences and codon conventions of the six Staphylococcus aureus lipase mutants provided herein, those skilled in the art can obtain the nucleotide sequences of nucleic acid molecules encoding the aforementioned Staphylococcus aureus lipase mutants. Due to codon degeneracy, the nucleotide sequences of nucleic acid molecules are not unique; however, all nucleic acid molecules capable of encoding the six Staphylococcus aureus lipase mutants are within the scope of protection of the present invention.

[0017] Similarly, various forms of recombinant expression vectors (such as plasmid vectors, lentiviral vectors, etc.) constructed using various genetic technologies in the art, as well as various engineered strains obtained by transferring recombinant expression vectors into various strains commonly used in genetic engineering / microbial fermentation technology, all fall within the scope of protection of the present invention.

[0018] The third aspect of the present invention provides a Staphylococcus aureus lipase mutant as described above, or use of any of the above biomaterials in oil preparation.

[0019] Furthermore, the oil is 1,3-diglyceride.

[0020] The fourth aspect of the present invention provides a method for preparing oil in vitro, which is prepared using any one of the Staphylococcus aureus lipase mutants described above.

[0021] Furthermore, the oil contains 1,3-diaceryl.

[0022] Compared with the prior art, the present invention is beneficial in that: the present invention provides six different Staphylococcus aureus lipase mutants SAL based on the same technical concept. V358E 、SAL V358Y 、SAL V358N 、SAL P33A 、SAL P33L 、SAL Y35LTesting revealed that the ratio of 1,3-DAG content to 1,2-DAG content (1,3-DAG / 1,2-DAG) for the six S. aureus lipase mutants was increased to 1.10, 1.18, 1.22, 1.07, 1.09, and 0.96, respectively, compared to the wild-type S. aureus lipase ratio of 0.68. This indicates that the six S. aureus lipase mutants provided herein have a stronger product preference than the wild-type and are more conducive to the synthesis of 1,3-DAG. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The figure shows the SDS-PAGE detection results of the expressed and purified SAL-V358N protein.

[0024] Figure 2 The TLC test results of SAL wild type and its 358-position mutant are shown.

[0025] Figure 3 Comparison of the 1,3-DAG / 1,2-DAG ratios of SAL mutants with significantly increased 1,3-DAG / 1,2-DAG ratios screened in a specific embodiment of the present invention with those produced by wild-type SAL. WT represents the wild type, and the remaining six represent six different SAL point mutants. DETAILED DESCRIPTION

[0026] The technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0027] The terms involved in this invention are as follows:

[0028] Mutant: refers to a polypeptide having SAL activity that contains an alteration (i.e., substitution, insertion, and / or deletion) at one or more (e.g., several) positions. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

[0029] Coding sequence: refers to the polynucleotide that directly specifies the amino acid sequence of SAL. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0030] Expression: The term "expression" includes any step involving the production of a SAL or a SAL mutant, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0031] Example 1: SAL V358N Construction of the vector of the mutant

[0032] This example uses pET30a-SAL plasmid as a template; pET30a as empty load, and constructs the site-directed mutant plasmid pET30a-SAL-V358N by homologous recombination.

[0033] 1. SAL V358N Cloning

[0034] The selected SAL V358N The amplification primers (5'-3') are as follows:

[0035] SAL-F: ggtggtgctcgagtgcggccagaagccttaagttgagttcccttagactc, as shown in SEQ ID NO. 9.

[0036] SAL-V358N-R: cttaaaatcaagaaaatcatttccaataaaatcaac, as shown in SEQ ID NO. 10.

[0037] SAL-V358N-F: gttgattttattggaaatgattttcttgattttaag, as shown in SEQ ID NO. 11.

[0038] SAL-F: ggtggtgctcgagtgcggccagaagccttaagttgagttcccttagactc, as shown in SEQ ID NO. 12.

[0039] The PCR system and procedure are shown in Table 1 and Table 2 below.

[0040] Table 1

[0041] Element volume Nuclease-free Water 20 μl Biorun Pfu PCR Mix 25 μl Primer(+)(10μM) 2 μl Primer(-)(10μM) 2 μl Template 1 μl Total volume 50 μl

[0042] Table 2

[0043]

[0044] Run electrophoresis on a 1% agarose gel at 5 V / cm for 20 minutes. Excise the target size band under UV light and place it in a gel recovery system. Refer to the manufacturer's kit instructions for recovery procedures. Dissolve the recovered DNA in a total volume of 40 μL of water. Once confirmed, reconstitute it with the vector.

[0045] 2. Vector digestion

[0046] The enzyme digestion and ligation system and reaction conditions are shown in Table 3 below.

[0047] Table 3

[0048]

[0049] The vector enzyme digest was purified using a PCR purification kit (the purified product was labeled pet30a(D)) and used for the recombination reaction.

[0050] 3. Recombination reaction

[0051] The recombination reaction system is shown in Table 4 below.

[0052] Table 4

[0053]

[0054]

[0055] Incubate at 37°C for 30 min and transform competent cells with the ligation product.

[0056] 4. Conversion

[0057] 5-10 μL of the ligation product was transformed into competent E. coli, transformed into a Cannabinoid-resistant plate, cultured at 37°C for 12 h, and identified by plaque PCR.

[0058] 5. Plaque PCR Identification

[0059] Pick 10 plaques and simultaneously inoculate with 1.5 mL EP tube and perform PCR identification. The identification primers (5'-3') are:

[0060] pet30a-F: cggataacaattcccctctag, as shown in SEQ ID NO. 13;

[0061] D11086(597C): ccactgagtaagtccaagatcaatatt, as shown in SEQ ID NO.14.

[0062] PCR system: Ten 25 μL PCR reactions were performed. The PCR reaction system and reaction procedure are shown in Tables 5 and 6 below.

[0063] Table 5

[0064] Element volume Nuclease-free Water 9.5 μL Biorun Magic PCR Mix 12.5μL pet30a-F (10 μM) 1 μL D11086(597C)(10μM) 1 μL Template 1 μL Total volume 25 μL

[0065] Table 6

[0066]

[0067] Take 100 μL of the bacterial suspension corresponding to 1-3 positive bands and send it for sequencing. Inoculate the remaining 400 μL of the bacterial suspension into 5-10 mL of LB containing kanamycin. Shake the tubes. After sequencing results are available, extract the plasmid from the tube that was sequenced correctly (plasmid named: pET30a-SAL-V358N, sequence information is shown in SEQ ID No. 8).

[0068] Example 2: SAL V358N Prokaryotic expression of mutants in Escherichia coli

[0069] 1. Protein small-scale expression test

[0070] The plasmid was transferred into the expression strain BL21 (DE3) and colony PCR was performed; the colonies with the correct band size were expanded and cultured, and the bacterial solution was preserved with glycerol at a final concentration of 20%; then inoculated into 8 mL of LB medium and cultured until the OD 600 At around 0.4-0.6. At this time, collect 1 mL of bacterial solution for later use (marked as before induction), add 0.2 mM IPTG to the His-V358N culture, and induce expression at 18°C ​​and 37°C for 16 hours; collect the bacteria by centrifugation, and add appropriate volumes of Lysis buffer and Binding buffer to resuspend the bacteria (add Lysis buffer and Binding buffer according to the amount of bacteria, and try to ensure that the amount of bacteria used before and after induction is consistent); prepare the sample, add SDS Sample Buffer, boil at 100°C for 10 minutes, load the sample, and perform SDS-PAGE detection or WB detection.

[0071] 2. Large-scale protein purification

[0072] The results of small-scale induction showed that the expression of V358N supernatant was higher at 18°C. The above-stored bacterial solution was activated and inoculated into 400 mL of LB medium for cultivation. The culture was continued until the OD 600At about 0.4-0.6, 0.2 mM IPTG was added to induce expression for 16 h, and the bacterial cells were collected by centrifugation. After adding lysis buffer (5 mL lysis buffer was added to 1 g bacterial cells) to the collected bacterial cells, the bacterial cells were broken by ultrasonic wave, and the cell lysate was collected and filtered. The filtered cell lysate was incubated with the corresponding beads at 4°C for 3 h, and the beads were collected (at this time, the supernatant can be stored first), and wash buffer was added to the beads for washing. The washing liquid was detected by Bradford each time. If the Bradford detection liquid changed color and became blue, the number of washings should be appropriately increased until the Bradford detection liquid had no color change. Finally, a gradient concentration of imidazole eluent was used for elution, and the eluate was collected. The collected sample was added to SDS Sample Buffer and boiled for 10 min, and then was loaded after centrifugation. SDS-PAGE detection was performed.

[0073] 3. SDS-PAGE detection

[0074] (1) Preparation of SDS-PAGE gel

[0075] According to the molecular weight, expression position and sample number of the target protein shown in Tables 7-9, the concentration of the separation gel, the thickness of the gel and the number of gels were determined.

[0076] Table 7

[0077] Protein molecular weight kd Separation gel concentration transfer buffer Transfer conditions 1~10 15% tricine electrophoresis 25% methanol 60mA, 30min 10~30 15% 25% methanol 100mA, 45min 30~100 12% 10% methanol 200mA, 60min 100~300 6% 5% methanol + 0.05% SDS 360mA, 120min

[0078] Table 8

[0079] 15mL separation gel PAGE (30%) <![CDATA[H2O]]> TRIS 8.8 10% SDS 10% APS TEMED 15% 7.5mL 3.45mL 3.75mL 0.15mL 0.15mL 7.5 μL 12% 6mL 4.95mL 3.75mL 0.15mL 0.15mL 7.5 μL 6% 3mL 7.95mL 3.75mL 0.15mL 0.15mL 7.5 μL

[0080] Table 9

[0081] 5mL stacking gel PAGE (30%) H2O TRIS 6.8 10% SDS 10% APS TEMED 5% 0.83mL 3.445mL 0.625mL 50μL 50μL 5μL

[0082] ① After the glass plate was cleaned and dried, it was aligned and fixed on the gel maker.

[0083] ② The required separation gel was prepared according to the above table, 7 mL of the mixed separation gel was injected into the middle of the glass plate, 1 mL of isopropyl alcohol was immediately injected to press the liquid surface flat, and the room temperature was kept for 30 min.

[0084] ③ The isopropyl alcohol was poured out, and the residual liquid was absorbed with filter paper.

[0085] ④ The concentrated gel was prepared according to the above table, 2 mL of the mixed concentrated gel was injected, a clean comb was quickly inserted, and the room temperature was kept for 30 min.

[0086] (2) Sample loading and electrophoresis

[0087] Gently pull the comb upright from the gel, remove the base, and place the comb with the gel into the electrophoresis tank. Pour an appropriate amount of running buffer and equilibrate the gel for 5 minutes. Add samples to the comb wells in the set loading order. After adding, close the lid and turn on the power supply: 80V for 30 minutes for the stacking gel and 120V for 60 minutes for the separating gel. The electrophoresis time can be adjusted as appropriate.

[0088] (3) Dyeing

[0089] ① After electrophoresis is completed, remove the gel from the glass plate, remove the stacking gel, and place it in the staining solution and incubate at room temperature for 10 minutes;

[0090] ②After staining is completed, remove the staining solution, add decolorizing solution, wash at room temperature for 30 minutes, then change the decolorizing solution and continue washing for 30 minutes;

[0091] ③After the decolorization is completed, take a photo and save it. The result is as follows Figure 1 shown.

[0092] Example 3: SAL V358N In vitro responses of mutants and SAL V358N TLC detection of mutant reaction solution

[0093] Buffer: 2.5 mM PBS (2.0 mM CaCl2), pH 7.0. Substrate: 99% triolein. Protein: All proteins were diluted to the same concentration. Negative control: Inactivate the corresponding protein solution by boiling at 97°C for 7 minutes. Incubate at 37°C for 2 hours, then add an equal volume of n-hexane. Remove 100 μL of the upper layer, evaporate, and dissolve the oil in a 2:1 ratio of chloroform to methanol.

[0094] The developing solvent is n-hexane: ether: acetic acid = 60:10:1. First, equilibrate for half an hour, then place the thin layer chromatography plate in the developing tank and develop for 40 minutes. After taking it out and drying it, place it in the developing tank again and develop it. Repeat three times. Take it out and dry it, then bake it with 50% sulfuric acid at 105℃ for 10 minutes, carbonize it and take a picture. The results are as follows Figure 2 The reagents, consumables, and instruments used are shown in Tables 10 and 11 below.

[0095] Table 10

[0096]

[0097]

[0098] Table 11

[0099] name model Manufacturer Gene Amplifier A48141 Eppendorf Gel imaging analysis system ZF-5 Thermo Fisher Portable UV analyzer A48141 Thermo Fisher Universal electrophoresis power supply JY300C Thermo Fisher Constant temperature water bath W14M-2 American SHELLAB centrifuge Thermo Sorvall ST16R Thermo Fisher Pipette (0.5-10uL) 3120 000.224 Eppendorf Constant temperature incubator NRY-2102C Thermo Scientific Ultra-micro UV-visible spectrophotometer Q6000 Nano drop Clean bench BCM-1300-A Suzhou Antai Air Technology Co., Ltd. electrophoresis apparatus 1658001 Bio-rad transfer apparatus 1703930 Bio-rad Decolorization shaker BETS-010 Kylin-Bell Mini Metal Bath GT20701 Monad High-speed refrigerated centrifuge 10020 sigma Ultra-low temperature refrigerator DW-862-3383 Haier vortex mixer VORTEX-KB3 Kylin-Bell

[0100] The gray scale calculation method was used to calculate the gray scale values of the bands corresponding to 1,3-DAG and 1,2-DAG in the TLC detection results by using ImageJ software. Graphpad Prism 9.5 was used for statistical analysis and calculation of the ratio of 1,3-DAG content to 1,2-DAG content (i.e. 1,3-DAG / 1,2-DAG). The results are shown in Figure 3 It can be seen that the above ratio of wild-type S. aureus lipase is 0.68, and the above ratios of the six different S. aureus lipase mutants SAL V358E , SAL V358Y , SAL V358N , SAL P33A , SAL P33L , and SAL Y35L are 1.10, 1.18, 1.22, 1.07, 1.09, and 0.96, respectively. This shows that the six S. aureus lipase mutants provided by the present application have more excellent product specificity and can prepare more 1,3-DAG.

[0101] The above specific embodiments describe the implementation of the present application, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, various simple modifications and changes can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. A Staphylococcus aureus lipase mutant, characterized in that: The Staphylococcus aureus lipase mutant is SAL P33A 、SAL P33L 、SAL Y35L 、SAL V358E 、SAL V358Y or SAL V358N ; The Staphylococcus aureus lipase mutant SAL P33A , and SAL P33L They are obtained by replacing the proline at position 33 of the amino acid sequence shown in SEQ ID NO.1 with alanine or leucine; The Staphylococcus aureus lipase mutant SAL Y35L It is obtained by replacing the tyrosine at position 35 of the amino acid sequence shown in SEQ ID NO.1 with leucine; Alternatively, the Staphylococcus aureus lipase mutant SAL V358E 、SAL V358Y 、SAL V358N They are obtained by replacing the valine at position 358 of the amino acid sequence shown in SEQ ID NO.1 with glutamic acid, tyrosine and asparagine respectively.

2. The Staphylococcus aureus lipase mutant according to claim 1, characterized in that Encoding the Staphylococcus aureus lipase mutant SAL P33A 、SAL P33L 、SAL Y35L 、SAL V358E 、SAL V358Y 、SAL V358N The nucleotide sequences are shown in SEQ ID NO. 2-7 respectively.

3. A biomaterial, characterized in that The biological material is any one of the following: (1) A nucleic acid molecule encoding the Staphylococcus aureus lipase mutant according to any one of claims 1 to 2; (2) a recombinant expression vector containing the nucleic acid molecule; (3) A recombinant engineering strain into which the recombinant expression vector is transferred.

4. Use of the Staphylococcus aureus lipase mutant according to any one of claims 1 to 2, or the biomaterial according to claim 3 in oil preparation, characterized in that: The oil is 1,3-diglyceride.

5. A method for preparing fat in vitro, characterized in that: The lipase is prepared by using the Staphylococcus aureus lipase mutant according to any one of claims 1-2, wherein the oil is 1,3-diacerol.

Citation Information

Patent Citations

  • Glyceride lipase mutant and application thereof

    CN112592910A

  • Mutant lipase and use thereof

    WO2010074209A1