Chitosanase BsCsn46A mutant and application thereof in preparation of chitotetraose

Abstract

The invention discloses a chitosanase BsCsn46A mutant and application of the chitosanase BsCsn46A mutant in preparation of chitotetraose, and belongs to the field of enzyme engineering. The chitosanase mutant with the chitotetraose production potential is obtained by mutating key sites of a chitosanase substrate channel. The GH46 family glucoside hydrolase chitosanase (BsCsn46A) is derived from bacillus subtilis, and the amino acid sequence of the GH46 family glucoside hydrolase chitosanase is as shown in SEQ ID NO: 1. Specifically, the 50 amino acid residue of BsCsn46A is subjected to saturation mutation, mutants with the chitotetraose producing potential are screened out, and the mutants are T50V, T50G, T50Y, T50L, T50F, T50S, T50I, T50R, T50C, T50D, T50P, T50Q, T50H and T50N, and the mutants are T50V, T50G, T50Y, T50L, T50F, T50S, T50I, T50R, T50C, T50D, T50P, T50Q, T50H and T50N. Through hydrolysis result analysis, compared with a wild type hydrolysate, the chitosanase mutant has the potential of producing chitotetraose.

Description

Technical Field

[0001] The invention relates to a chitosanase derived from Bacillus subtilis, and is used to obtain a chitotetraose-producing mutant by mutating key sites of the substrate channel of the chitosanase, and belongs to the technical field of enzyme engineering. Background Art

[0002] Chitosanase (EC3.2.1.132) is a glycoside hydrolase that produces chitosan oligosaccharides (COS) with different degrees of polymerization (DP) by hydrolyzing the β-1,4-glycosidic bonds in chitosan. COS has good biosafety, water solubility, and non-sensitization. Studies have reported that COS has anti-tumor, anti-cancer, lipid-lowering, immunity-enhancing, and antioxidant effects. It has antibacterial, anti-insect, and antiviral effects in agriculture. Therefore, it has a variety of application potentials in food and agriculture. According to the similarity of amino acid sequences, chitosanase mainly comes from seven glycoside hydrolase families, namely GH3, GH5, GH7, GH8, GH46, GH75, and GH80. According to different cleavage unit structures, chitosanase can also be divided into four types, CLASSⅠ family, CLASSⅡ family, CLASSⅢ family, and CLASSⅣ family.

[0003] Chitosan (CS) is a deacetylated product obtained by chitin deacetylase catalyzing the acetyl group in chitin. Chitosan oligosaccharide (COS) can be directly obtained by hydrolysis of chitosan or by deacetylation and hydrolysis of chitin. Studies have shown that chitosan oligosaccharide with high polymerization degree has better biological activity. Therefore, obtaining high polymerization degree COS has practical application value.

[0004] There are three methods for preparing chitosan oligosaccharides: chemical method, physical method and bio-enzyme method. The chemical method has a violent reaction, which will cause pollution and is not environmentally friendly. The physical method has a low yield. Compared with the other two methods, the enzyme method has the advantages of mild reaction conditions, controllability, high yield, good reproducibility and environmental benefits. Therefore, the bio-enzyme method is currently a research hotspot. Through the molecular modification of the enzyme, the aim is to obtain chitosanase that efficiently catalyzes chitosan to produce high-polymerization chitosan oligosaccharides. Summary of the invention

[0005] The present invention is to Bacillus subtilis ( Bacillus subtilis )The substrate channel of chitosanase BsCsn46A was analyzed to find the sites that may affect the polymerization degree of the hydrolysis product. The key sites were mutated and mutants with the potential to produce chitosan tetraose were screened out.

[0006] The inventors' previous studies have found that when the 50th threonine of Bacillus subtilis chitosanase BsCsn46A is mutated to the acidic amino acid E (glutamic acid) or the basic amino acid K (lysine), T50E hydrolyzes chitosan to produce not only chitobiose and chitotriose, but also chitotetraose (CN116590260A). Mutations to large hydrophobic side chain amino acids W or small side chain amino acids A can hydrolyze chitosan to produce chitotetraose (CN116656654A). Considering that the 50th threonine mutation may be highly correlated with the product polymer, the present invention performs a saturation mutation on the 50th position of Bacillus subtilis chitosanase BsCsn46A and in Escherichia coli. E. coli The mutants were expressed in BL21(DE3) and further screened for the potential to produce chitotetraose.

[0007] The chitosanase mutant of the invention is prepared by subjecting the 50th amino acid sequence of the chitosanase BsCsn46A of Bacillus subtilis to saturation mutation, and screening out a chitotetraose-producing mutant. Threonine is mutated to valine, marked as T50V; Threonine is mutated to glycine, marked as T50G; Threonine is mutated to tyrosine, marked as T50Y; Threonine is mutated to leucine, marked as T50L; Threonine is mutated to phenylalanine, marked as T50F; Threonine is mutated to serine, marked as T50S; Threonine is mutated to isoleucine, marked as T50I; Threonine is mutated to arginine, marked as T50R; Threonine is mutated to cysteine, marked as T50C; Threonine is mutated to aspartic acid, marked as T50D; Threonine is mutated to proline, marked as T50P; Threonine is mutated to glutamine, marked as T50Q; Threonine is mutated to histidine, marked as T50H; Threonine is mutated to asparagine, marked as T50N.The amino acid sequence of Bacillus subtilis chitosanase BsCsn46A is SEQ ID NO: 1, and the nucleotide sequence is SEQ ID NO: 2; the amino acid sequence of the chitosanase mutant T50V is SEQ ID NO: 3, and the nucleotide sequence is SEQ ID NO: 4; the amino acid sequence of the chitosanase mutant T50G is SEQ ID NO: 5, and the nucleotide sequence is SEQ ID NO: 6; the amino acid sequence of the chitosanase mutant T50Y is SEQ ID NO: 7, and the nucleotide sequence is SEQ ID NO: 8; the amino acid sequence of the chitosanase mutant T50L is SEQ ID NO: 9, and the nucleotide sequence is SEQ ID NO: 10; the amino acid sequence of the chitosanase mutant T50F is SEQ ID NO: 11, and the nucleotide sequence is SEQ ID NO: 12; the amino acid sequence of the chitosanase mutant T50S is SEQ ID NO: 13, and the nucleotide sequence is SEQ ID NO: 14; the amino acid sequence of the chitosanase mutant T50I is SEQ ID NO: 15, and the nucleotide sequence is SEQ ID NO:16; the amino acid sequence of the chitosanase mutant T50R is SEQ ID NO:17, and the nucleotide sequence is SEQ ID NO:18; the amino acid sequence of the chitosanase mutant T50C is SEQ ID NO:19, and the nucleotide sequence is SEQ ID NO:20; the amino acid sequence of the chitosanase mutant T50D is SEQ ID NO:21, and the nucleotide sequence is SEQ ID NO:22; the amino acid sequence of the chitosanase mutant T50P is SEQ ID NO:23, and the nucleotide sequence is SEQ ID NO:24; the amino acid sequence of the chitosanase mutant T50Q is SEQ ID NO:25, and the nucleotide sequence is SEQ ID NO:26; the amino acid sequence of the chitosanase mutant T50H is SEQ ID NO:27, and the nucleotide sequence is SEQ ID NO:28; the amino acid sequence of the chitosanase mutant T50N is SEQ ID NO:29, and the nucleotide sequence is SEQ ID NO:30.

[0008] The invention provides a recombinant vector carrying the gene encoding the chitosanase mutant and a recombinant bacterium for transforming / transfecting the recombinant vector.

[0009] The specific mutation steps are as follows: Step 1: clone the gene sequence SEQ ID NO: 2 into plasmid pET-28a to construct a recombinant plasmid pET-BsCsn46A; The two primers were the upstream primer CGGGATCCGCGGGACTGAATAAAGATC and the downstream primer CCCAAGCTTTTAAGGGATTACAAAATTACC.

[0010] Step 2: Use Swiss-Model online software to simulate chitosanase (BsCsn46A) to obtain the spatial structure of chitosanase.

[0011] Step 3: Find the key site (T50) related to the hydrolysis substrate through substrate channel simulation and molecular docking, and perform saturation mutation.

[0012] Step 4: Design site-directed mutagenesis primers, obtain the mutant chitosanase gene by PCR technology, clone the amplified target gene into the expression vector pET-28a, and construct a recombinant plasmid.

[0013] Step 5: Transform the recombinant vector from step 4 into Escherichia coli E. coli BL21 (DE3) was induced and cultured, the bacteria were collected after centrifugation, the cells were broken by ultrasound, and the mutant chitosanase was obtained by protein purification using a Ni-NTA affinity chromatography column.

[0014] The chitosanase mutant provided by the present invention can be used in industry to produce not only chitobiose and chitotriose, but also chitotetraose.

[0015] In a specific embodiment of the present invention, 450 μL of 1% colloidal chitosan solution, 20 U of purified enzyme solution, 500 μL of pH 6.6 phosphate buffer and 9 μL of 100 mM Mn 2+ The hydrolysis system was formed and placed at 37 °C and shaken at 160 rpm for full reaction. TLC analysis of the hydrolysis time of the mutant enzyme producing tetrasaccharide showed that the mutants T50V and T50G did not produce tetrasaccharide after 9 h of hydrolysis; T50Y and T50L did not produce chitosan after 7 h of hydrolysis; T50F, T50S, T50I, T50R, T50C, and T50D did not produce tetrasaccharide after 5 h of hydrolysis; and the other T50P, T50Q, T50H, and T50N did not produce chitosan after 3 h of hydrolysis. Compared with the wild type, the mutants obtained above all have a longer time for producing chitosan and have the potential to produce chitosan.

[0016] Studies have shown that chitosan oligosaccharides with a degree of polymerization of 3-7 have better biological activity. The present invention obtains a saturated mutant library based on key sites of the substrate channel, and the screened mutants have the ability to produce chitotetraose, which has obvious advantages in preparing active oligosaccharides. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Thin layer chromatograms of chitosan degradation products of wild-type chitosanase and mutant T50D.

[0018] Figure 2Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50R and T50H.

[0019] Figure 3 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50N and T50Y.

[0020] Figure 4 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50C and T50Q.

[0021] Figure 5 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50G and T50M.

[0022] Figure 6 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50S and T50I.

[0023] Figure 7 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50V and T50P.

[0024] Figure 8 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50L and T50F. DETAILED DESCRIPTION

[0025] The inventors found in their previous studies that the 50th position of the chitosanase BsCsn46A of Bacillus subtilis is the key site of the enzyme, and disclosed the ability of T50E, T50K, T50A, and T50W to hydrolyze and produce chitotetraose (CN116590260A, CN116656654A). The present invention performs a saturation mutation on the 50th amino acid of the enzyme (except for the disclosed amino acid mutations) to screen out mutants that produce chitotetraose.

[0026] The saturation primer sequences were designed by online software PrimerX as follows, and the chitosanase BsCsn46A gene SEQ ID NO: 2 was used as a template to obtain the mutant chitosanase gene by genetic engineering.

[0027] Table 1. Primer sequences of mutant library

[0028]

[0029] Table 2. Inverse PCR system Reagent name Volume (μL) template 2 PCR Buffer 5 dNTPs (10 mM) 1 Upstream / downstream primers (100 mM) 0.3 each PfuDNA polymerase 1.5 <![CDATA[ddH2O]]> 40 Total volume 50 Reverse PCR amplification conditions: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 s, annealing at 65 °C for 1 min, extension at 68 °C for 10 min, 15 cycles; insulation at 4 °C.

[0030] The amplified PCR product was digested with 0.7 μL DpnI for 1.5 h to remove the plasmid template. E. coli DH5α was placed in an ice bath and 10 μL of the above reaction mixture was added to form a transformation system to complete the transformation. The obtained recombinant bacteria were sent to Shanghai Bioengineering Co., Ltd. for sequencing. The plasmids of the recombinant bacteria with correct sequencing were extracted and then transformed into Escherichia coli E. coli BL21 and stored at -80°C.

[0031] The preserved strain was inoculated into 10 mL of liquid LB medium at a one thousandth inoculation volume for activation, then transferred to 50 mL of liquid LB medium for expansion culture, and then the inducer IPTG (isopropyl-β-D-thiogalactopyranoside) was added to induce the production of the target protein.

[0032] Protein purification operation: The bacterial solution of the above-mentioned induced expression strain was divided into centrifuge tubes and balanced, and centrifuged with a refrigerated centrifuge to remove the supernatant, retain the bacteria, and absorb an appropriate amount of M0 (20 mM Tris-HCl, 0.5 M NaCl, 10% glycerol, pH8.0) to resuspend the bacteria, centrifuge to remove the supernatant, resuspend with M0 for the second time, and carefully blow and aspirate evenly with a gun. The above-mentioned bacterial solution was broken into cells with an ultrasonic cell disruptor to break out the protein, and then centrifuged to collect the supernatant (containing protein) and store it on ice. Take the Ni-IDA column out of the 4 ℃ refrigerator, turn it upside down to make the agarose filler in the column fluffy, wash the column with M0 and pure water (Wahaha purified water), then pass the supernatant through the column twice, wash away the impurities with 0.02 M imidazole eluent (0.02 M Tris-HCl, pH 8.0, 0.5 M NaCl, 0.02 M imidazole and 10% glycerol) solution, then elute the target protein with 0.08 M imidazole eluent (20 mM Tris-HCl, 0.5 M NaCl, 0.08 M imidazole, 10% glycerol, pH8.0), collect the eluted protein solution, and store it in the refrigerator.

[0033] The purified enzyme was tested for enzyme activity by DNS method. The reaction system consisted of 1475 μL pH buffer, 18 μL 100 mM Mn 2+, 500 μL 1% colloidal chitosan solution, add 25 μL purified enzyme solution, water bath at 55 °C for 5 min, add 1.5 mL DNS solution to terminate the reaction, boil with boiling water for 5 min, and finally dilute to 25 mL with distilled water, cool and stand for 1 h. No enzyme was added to the blank group. The absorbance value of the sample was measured at a wavelength of 520 nm using a UV-visible spectrophotometer. The reducing end content of the product released by the catalytic reaction was calculated according to the standard curve, and the chitosanase activity was defined as: the amount of enzyme used to generate 1 μmol reducing end per minute was 1 U (1 μmol / mL·min). The protein content in the enzyme solution can be determined by a protein quantitative reagent, and the kit was purchased from Nanjing Novizan Biotechnology Co., Ltd. (Bradford Reagent: E211-01). The activity data of the relevant mutant enzymes are shown in the table below.

[0034] Table 3. Enzyme activities of mutant enzymes Mutant enzyme Optimum pH Optimum temperature / ℃ Specific enzyme activity (U / mg) WT 6.0 50 15620.46 T50H 6.0 55 6081.16 T50M 6.0 60 1089.34 T50S 6.0 55 3038.05 T50I 6.0 55 607.42 T50L 6.0 45 1012.22 T50Y 6.0 55 593.29 T50V 6.0 55 565.28 T50P 6.0 50 1637.34 T50D 6.2 50 771.60 T50Q 6.2 50 2517.83 T50G 6.2 55 454.96 T50F 6.2 55 1006.73 T50C 6.4 60 2334.78 T50R 6.8 50 585.52 T50N 6.8 50 5627.88 Hydrolysis reaction. 450 μL 1% colloidal chitosan solution, 20 U purified enzyme solution, 500 μL pH 6.6 phosphate buffer and 9 μL 100 mM Mn 2+ The hydrolysis system was formed and placed on a shaker at 37 °C and 160 rpm for full reaction. The hydrolysis system was centrifuged at 5 min, 30 min, 1 h, 3 h, 5 h, 7 h, 9 h, and 11 h, respectively, and 20 μL of the supernatant was taken and boiled for 10 min and retained.

[0035] TLC analysis. The operation method of thin layer chromatography is as follows: draw a thin line 1 cm away from one end of the high-efficiency silica gel plate, mark the position to be spotted next, use a pipette or capillary to absorb the hydrolyzate samples at different times and spot them several times in small amounts, and use the mixed solution of GlcN2-5 standard and D-glucosamine hydrochloride as a control. After the spotted silica gel plate is fully dried, put it into the chromatography cylinder for development. The chromatographic solution should not exceed the position of the drawn thin line. Wait for the developer to climb to the top of the silica gel for about 1 hour, take out the silica gel plate and blow it dry with a hair dryer until there is no ammonia smell, spray the color developer (0.5% ninhydrin-ethanol solution) evenly, and place it in a 110 ℃ oven after drying until clear purple-red spots appear.

[0036] Combined with TLC analysis of the hydrolysis time of the mutant enzyme producing tetrasaccharide, it was found that the mutants T50V and T50G did not produce tetrasaccharide after 9 h of hydrolysis; T50Y and T50L did not produce chitosan after 7 h of hydrolysis; T50F, T50S, T50I, T50R, T50C, and T50D did not produce tetrasaccharide after 5 h of hydrolysis; and the other T50P, T50Q, T50H, and T50N did not produce chitosan after 3 h of hydrolysis. Compared with the wild type, the mutants obtained above are all mutants with longer hydrolysis time to produce chitosan and the potential to produce chitosan. Studies have shown that chitosan oligosaccharides with a degree of polymerization of 3-7 have better biological activity. The saturated mutant library obtained by the present invention based on the key sites of the substrate channel has the ability to produce chitosan, which has obvious advantages in preparing active oligosaccharides.

Claims

1. A chitosanase mutant producing chitotetraose, characterized in that: The chitosanase mutant is obtained by replacing the 50th threonine of the amino acid sequence of chitosanase BsCsn46A from Bacillus subtilis as shown in SEQ ID NO: 1 with an amino acid; the chitosanase mutant producing chitotetraose is any one of the following: (1) mutated to valine, denoted as T50V, and its amino acid sequence is shown in SEQ ID NO: 3; (2) mutated to glycine, denoted as T50G, whose amino acid sequence is shown in SEQ ID NO:5; (3) mutated to tyrosine, denoted as T50Y, and its amino acid sequence is shown in SEQ ID NO:7; (4) mutated to leucine, denoted as T50L, whose amino acid sequence is shown in SEQ ID NO:9; (5) mutated to phenylalanine, denoted as T50F, whose amino acid sequence is shown in SEQ ID NO:11; (6) mutated to serine, denoted as T50S, whose amino acid sequence is shown in SEQ ID NO:13; (7) mutated to isoleucine, denoted as T50I, whose amino acid sequence is shown in SEQ ID NO:15; (8) mutated to arginine, denoted as T50R, and its amino acid sequence is shown in SEQ ID NO:17; (9) mutated to cysteine, denoted as T50C, whose amino acid sequence is shown in SEQ ID NO: 19; (10) mutated to aspartic acid, denoted as T50D, whose amino acid sequence is shown in SEQ ID NO:21; (11) mutated to proline, denoted as T50P, and its amino acid sequence is shown in SEQ ID NO:23; (12) mutated to glutamine, denoted as T50Q, and its amino acid sequence is shown in SEQ ID NO:25; (13) mutated to histidine, denoted as T50H, whose amino acid sequence is shown in SEQ ID NO:27; (14) mutated to asparagine, denoted as T50N, and its amino acid sequence is shown in SEQ ID NO:

29.

2. A gene encoding the chitosanase mutant producing chitotetraose according to claim 1, characterized in that: The nucleotide sequence encoding T50V is shown in SEQ ID NO:4; the nucleotide sequence encoding T50G is shown in SEQ ID NO:6; the nucleotide sequence encoding T50Y is shown in SEQ ID NO:8; the nucleotide sequence encoding T50L is shown in SEQ ID NO:10; the nucleotide sequence encoding T50F is shown in SEQ ID NO:12; the nucleotide sequence encoding T50S is shown in SEQ ID NO:14; the nucleotide sequence encoding T50I is shown in SEQ ID NO:16; the nucleotide sequence encoding T50R is shown in SEQ ID NO:18; the nucleotide sequence encoding T50C is shown in SEQ ID NO:20; the nucleotide sequence encoding T50D is shown in SEQ ID NO:22; the nucleotide sequence encoding T50P is shown in SEQ ID NO:24; the nucleotide sequence encoding T50Q is shown in SEQ ID NO:26; the nucleotide sequence encoding T50H is shown in SEQ ID NO:28; and the nucleotide sequence encoding T50N is shown in SEQ ID NO:

30.

3. A recombinant vector, characterized in that: Comprising the chitosanase mutant according to claim 1 or the gene according to claim 2.

4. A recombinant strain, characterized in that: The host bacteria comprises the chitosanase mutant according to claim 1, the gene according to claim 2, or the recombinant vector according to claim 3.

5. The use of the chitosan mutant according to claim 1, characterized in that: The chitosanase mutant is used in catalyzing the hydrolysis of chitosan to produce chitooligosaccharides.

6. The use according to claim 5, characterized in that: The chitosanase mutant produces chitotetraose in the hydrolysis reaction of catalyzing chitosan.

7. The use according to claim 6, characterized in that: In the hydrolysis reaction system, the mass fraction of the substrate is 0.45-0.5%, the amount of the chitosanase mutant is 20U, and the reaction temperature is 37°C.

8. The use according to claim 7, characterized in that: The hydrolysis reaction time of the chitosanase mutants in catalyzing chitosan to produce chitotetraose was controlled. Among them, the hydrolysis reaction time of T50P, T50Q, T50H, and T50N was within 3 h, the hydrolysis reaction time of T50F, T50S, T50I, T50R, T50C, and T50D was within 5 h, the hydrolysis reaction time of T50Y and T50L was within 7 h, and the hydrolysis time of T50V and T50G was within 9 h.

Images