Mutation improvement method and application of feed bacillus velezensis protease

Abstract

The invention discloses a bacillus velezensis serine protease variant and an application thereof. The serine protease variant is serine protease which is obtained by sequentially mutating a plurality of amino acid residues in an amino acid sequence of parental serine protease and still keeps the capability of hydrolyzing peptide bonds of the parental serine protease; the homology of the amino acid sequences of the two reaches 95% or above. The serine protease variant provided by the invention has higher catalytic activity after heat preservation for 4 hours under the acidic condition of pH 2-5 and heat preservation for 12 hours under the acidic condition of pH 2.2. According to the serine protease mutant provided by the invention, the in-vitro piglet feed enzymolysis effect is superior to that of original protease under the conditions that the pH is 2.2, the temperature is 40 DEG C, the enzyme addition amount is different, the enzymolysis time is different and the solid-to-liquid ratio is different. The serine protease mutant provided by the invention has good acid resistance, thermal stability and excellent feed enzymolysis effect. And when the enzyme adding amount is 400U, the enzymolysis time is 4 hours and the solid-liquid ratio is 0.7 g / mL, the enzymolysis benefit of the mutant enzyme is higher than that of other groups at the moment.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering and relates to serine protease variants. Background Art

[0002] Serine protease is a common protease in animal feed. It is a family of proteases that break peptide bonds in macromolecular proteins to make them small molecule proteins. In mammals, serine proteases play an important role, especially in digestion, coagulation and complement systems. Its activation is achieved through changes in a group of amino acid residues in the active center, one of which must be serine.

[0003] There are two types of serine proteases used in feed: bacterial serine proteases and fungal serine proteases. Bacterial serine proteases are mainly derived from Bacillus subtilis and Bacillus licheniformis, and are mainly neutral and alkaline serine proteases, with an optimal pH between 6.0 and 11.0. Fungal serine proteases are mainly produced by fermentation of Aspergillus oryzae and Aspergillus niger, with an optimal pH between 2.5 and 4.5, and are acidic serine proteases.

[0004] In the present invention, in order to meet the needs of the development of the feed industry, we used B. velezensis serine protease as a template to construct a series of new serine protease mutants, which improved the application efficiency of the enzyme and the efficiency of in vitro enzymatic hydrolysis of piglet feed. Summary of the invention

[0005] The purpose of the present invention is to provide a B. velezensis serine protease variant, which can improve the acid resistance of the protease and can be used in the feed industry, especially under the condition of pH 2.5 to 2.8.

[0006] The object of the present invention is to provide a gene encoding the serine protease variant. Another object of the present invention is to provide a production method and application of the serine protease variant.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A serine protease variant is obtained by sequentially mutating positions 228 and 431 of the serine protease protein sequence of B. velezensis, respectively from glycine to tryptophan and from arginine to cysteine.

[0009] The full-length gene sequence encoding the serine protease of B. velezensis is shown in SEQ ID NO.1; the corresponding amino acid sequence is shown in SEQ ID NO.2.

[0010] The amino acid sequence of the serine protease variant is shown in SEQ ID NO.4 in the sequence listing.

[0011] The nucleotide coding sequence of the serine protease variant is preferably as shown in SEQ ID NO.3.

[0012] The expression vector for expressing the serine protease variant of the present invention contains the gene encoding the serine protease variant of the present invention.

[0013] A method for producing a serine protease variant of the present invention comprises culturing a recombinant containing a gene sequence encoding the serine protease variant under conditions suitable for the expression of the serine protease variant, and obtaining the serine protease variant from the recombinant or its culture supernatant.

[0014] The serine protease variant of the present invention is used in hydrolyzing peptide bonds of macromolecular proteins; preferably in hydrolyzing peptide bonds of macromolecular proteins under high temperature and / or low pH conditions; the high temperature is preferably 40°C to 90°C; the low pH is preferably 2.0 to 6.0.

[0015] Beneficial Effects

[0016] The present invention provides a novel serine protease variant, which has a high catalytic activity under acidic conditions of pH 2.0-6.0 and high temperature conditions above 70°C. The serine protease variants provided by the present invention are superior to the original protease in in vitro enzymatic hydrolysis of piglet feed. These serine protease variants have good acid resistance, thermal stability, and excellent feed enzymatic hydrolysis effect, and can be used in the animal feed industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The pET-32a vector includes an ampicillin resistance gene (AmpR) that can tolerate 100 μg / mL ampicillin in E. coli. Ampicillin is used to select recombinant host cells containing the nucleotide sequence encoding the serine protease variant.

[0018] Figure 2 Schematic diagram of pET-32a-sprd1 vector

[0019] Figure 3 Expression of protease in BL21(DE3) expression strain and SDS-PAGE image after purification

[0020] Figure 4 Comparison of protease activity at different pH conditions at 40°C for two hours

[0021] Figure 5Comparison of protease activity at pH 2.2 and 40°C for different incubation times

[0022] Figure 6 Comparison of protease activity at different temperatures at pH 6.0 for two hours

[0023] Figure 7 Comparison of in vitro enzymatic hydrolysis of piglet feed at different enzyme addition amounts, feed addition amounts, and enzymatic hydrolysis times at pH 2.2, 40°C, and a shaker speed of 180 rpm.

[0024] Detailed description of the invention

[0025] In the present invention, serine protease refers to an enzyme that can hydrolyze the peptide bonds of macromolecular proteins. For example, serine protease can hydrolyze casein into amino acids containing phenolic groups.

[0026] In the present invention, the parent serine protease refers to a natural serine protease. The natural serine protease is a bacterial serine protease, and its sources include but are not limited to Bacillus subtilis, B. licheniformis, B. amyloliquefaciens, G. stearothermophilus and Bacillus cereus.

[0027] According to the innovation of the present invention, the natural serine protease is derived from B. velezensis (isolated from corn kernels in our laboratory), the full-length coding sequence is shown in SEQ ID NO.1; the corresponding amino acid sequence is shown in SEQ ID NO.2.

[0028] In the present invention, the term "serine protease variant" refers to a non-naturally occurring serine protease in which one or more amino acid residues are added, deleted and / or substituted at an effective position in the amino acid sequence of the parent serine protease, while still retaining the parent's ability to hydrolyze peptide bonds.

[0029] In the present invention, "hydrolysis" generally refers to the process of breaking down macromolecular proteins into small molecular amino acids. When serine protease or serine protease variant is added, "hydrolysis" specifically refers to hydrolyzing the peptide bonds of macromolecular proteins.

[0030] In the present invention, "peptide bond" refers to a chemical bond formed by dehydration condensation of the amino group and the carboxyl group between amino acid molecules. Since the condensation product is called a peptide, it is named peptide bond.

[0031] The present invention relates to a "serine protease variant" obtained by sequence modification of a parent serine protease. The parent serine protease is a natural serine protease, particularly a natural serine protease derived from bacteria. According to an embodiment of the present invention, the serine protease variant is a variant in which one or more amino acid residues are mutated, added or deleted at an effective position of the amino acid sequence of the parent serine protease.

[0032] The present invention includes a series of serine protease variants. According to an embodiment of the present invention, the homology of the amino acid sequence of this series of serine protease variants reaches at least 95%. As an illustrative and non-restrictive example of the present invention, the serine protease variant is a mutation of the 228th and 431st positions of the parent serine protease protein sequence of B. velezensis, which are respectively mutated from glycine to tryptophan and arginine to cysteine, see SEQ ID NO.4.

[0033] The serine protease variants of the present invention retain the ability to hydrolyze peptide bonds. In addition, the performance of these serine proteases meets the requirements of industrial production, such as the improvement of hydrolysis efficiency and the stability of catalytic activity under acidic pH or high temperature conditions. According to an embodiment of the present invention, a serine protease variant has stable catalytic activity under acidic conditions below pH 6.0 or under conditions where the temperature is higher than 70°C. These improved properties of serine protease variants are more suitable for the feed industry. Because in the feed industry, the gastric environment is a low pH, high temperature environment.

[0034] All serine protease variants of the present invention can be used for hydrolysis reactions. In a preferred embodiment, the serine protease variant is derived from a parent serine protease, which refers to a serine protease derived from a B. velezensis parent.

[0035] According to the present invention, any macromolecular protein containing peptide bonds can be used for the hydrolysis reaction. Macromolecular proteins containing one or more peptide bonds include but are not limited to casein, glycinin, β-conglycinin and trypsin inhibitor.

[0036] The present invention provides a method for hydrolyzing peptide bonds of serine protease variants under any temperature and pH conditions suitable for industrial production. According to the present invention, the hydrolysis reaction can be carried out at a high temperature of 70°C to 90°C, such as 70°C, 80°C, 90°C.

[0037] According to an embodiment of the present invention, the hydrolysis reaction catalyzed by the serine protease variant has stable catalytic activity under acidic pH and temperature conditions above 70° C. At pH 2.2 and 40° C., the in vitro enzymatic hydrolysis of piglet feed is better than the control group.

[0038] According to an embodiment of the present invention, recombinant host cells can be genetically engineered to comprise the nucleotide sequence expressed by one or more serine protease variant genes. Any technology can be used for genetically engineered host cells to comprise the nucleotide sequence synthesized by one or more serine protease variant encodings of the present invention, for example, chromosomal integration. A vector containing a temperature-sensitive origin and a resistance screening marker can be used for the integration step. These vectors are integrated with the specific region of the genome by the Campbell mechanism, and recombinant bacteria are obtained by resistance screening, and the recombinant bacteria remove the resistance screening marker by homologous recombination in subsequent culture.

[0039] The present invention provides a method for producing a serine protease variant. According to an embodiment of the present invention, the method comprises culturing a recombinant host cell containing a nucleotide sequence encoding a serine protease variant under conditions suitable for expressing the serine protease variant, and obtaining the serine protease variant from the recombinant host cell or its supernatant.

[0040] All recombinant host cells of the present invention are capable of producing serine protease variants. The recombinant host cells contain at least one copy of a nucleotide sequence encoding a serine protease variant. These nucleotide sequences encoding serine protease variants can express serine protease variants under suitable conditions. The serine protease variants secreted from the recombinant host cells can be collected from the recombinant or supernatant. The collection method includes but is not limited to filtration, centrifugation, etc.

[0041] The following examples of the present invention further illustrate the essence of the present invention. It should be understood that the following examples do not limit the present invention, and the scope of the present invention is determined by the appended claims. DETAILED DESCRIPTION

[0042] Example 1: Construction of pET-32a plasmid

[0043] The pET-32a vector carries an N-terminal His / Thrombin / TrXA protein tag and an optional C-terminal His tag. The single multiple cloning site of the pET-32a vector is shown in the circular plasmid map above. Note: The vector sequence is encoded according to the coding convention of the pBR322 plasmid, so the T7 protein expression region is in reverse on the plasmid map. The cloning and expression regions initiated by the T7 RNA polymerase are also marked on the plasmid map. The F1 replicon of the plasmid is directional, so under the action of the T7 phage polymerase, viral particles containing the protein coding sequence can be produced and protein expression can be initiated. At the same time, protein expression will be terminated by the action of the T7 terminator sequence (Cat.No.69337-3) and selected with ampicillin.

[0044] The construction process of Pet32a plasmid is as follows: plasmid pet32a (stored in this laboratory) is double-digested with EcoRI and XhoI, the 5.3k fragment is recovered and purified, and stored at -20°C for future use.

[0045] In the present invention, in order to obtain the serine protease gene (1353 bp), it was cloned and amplified from the total genomic DNA of B. velezensis D1.

[0046] The primers used for PCR reaction were synthesized by Tsingke Company. The primer sequences are as follows:

[0047] Pro1353s:ATCCGAATTCATGATGGATAACTATCGTGATGAAAAT

[0048] Pro1353anti: GGTGCTCGAGAGAAGATGTTTCTTCTTTTTGAGTCAG The PCR amplification system is 50ul, and the reaction procedure is as follows:

[0049] (1) Pre-denaturation of Bacillus velezensis genomic DNA at 95°C for 5 minutes;

[0050] (2) 95°C, 30 seconds;

[0051] (3) 50°C, 30 seconds;

[0052] (4) 72°C, 90 seconds; repeat steps 2-4 30-35 times;

[0053] (5) Final extension at 72°C for 2 minutes.

[0054] (6) 1% agarose gel running, gel recovery using Genstar kit

[0055] (7) Double digestion with EcoRI and XhoI, recover and purify the fragment of about 1.3k, and store it at -20℃ for future use.

[0056] The linear plasmid and protease gene fragment after gel recovery were connected with T4 DNA ligase (Mona Bio), and after the connection was completed, they were transformed with DH5α Escherichia coli competent cells, cultured overnight on LB solid medium containing 50ug / ml ampicillin, and positive clones were picked for colony PCR identification and sent to Universal Company for sequencing to obtain transformant T1353. Transformant T1353 was used to transform BL21 (DE3) Escherichia coli competent cells, cultured overnight on LB solid medium containing 50ug / ml ampicillin, and positive clones were picked for colony PCR identification and sent to Universal Company for sequencing to obtain the protease expression strain GAMIO-pro.

[0057] Colony PCR identification procedure:

[0058] The primers used for PCR reaction were synthesized by Tsingke Company. The primer sequences are as follows:

[0059] T7:TAATACGACTCACTATAGGG

[0060] T7ter: TGCTAGTTATTGCTCAGCGG

[0061] The PCR amplification system is 15ul, and the reaction procedure is as follows:

[0062] (1) Single colony culture medium was pre-denatured at 95°C for 5 minutes;

[0063] (2) 95°C, 30 seconds;

[0064] (3) 52°C, 30 seconds;

[0065] (4) 72°C, 90 seconds; repeat steps 2-4 30-35 times;

[0066] (5) Final extension at 72°C for 2 minutes.

[0067] Example 2: First site-directed mutagenesis of pet32a-pro

[0068] The plasmid pet32a-pro of transformant T1353 was extracted and site-directed mutagenesis was performed step by step.

[0069] The primers used for PCR reaction were synthesized by Tsingke Company. The primer sequences are as follows:

[0070] 228s:CAAGTTTCTGGAGCTCATCCGCTCTCAGAACG

[0071] 228anti: TGAGCTCCAGAAACTTGCTGTTTTTGTCACGTG The PCR amplification system is 50ul, and the reaction procedure is as follows:

[0072] (1) Plasmid pET32a-pro was pre-denatured at 95°C for 5 minutes;

[0073] (2) 95°C, 15 seconds;

[0074] (3) 65°C, 15 seconds;

[0075] (4) 72°C, 4 minutes; repeat steps 2-4 25-30 times;

[0076] (5) Final extension at 72°C for 2 minutes.

[0077] The PCR product was digested with dpnI and directly transformed into DH5α competent E. coli. It was cultured overnight on LB solid medium containing 50ug / ml ampicillin. The positive clones were picked for colony PCR identification and sent to Universal Company for sequencing to obtain the transformant MTF1353.

[0078] Example 3: Second site-directed mutagenesis of pet32a-pro

[0079] The plasmid of transformant MTF1353 was extracted and the second site-directed mutagenesis was performed by PCR.

[0080] The primers used for PCR reaction were synthesized by Tsingke Company. The primer sequences are as follows:

[0081] 431s: GATTATCTGCAACGGCAAGGAAATGACGAAAA

[0082] 431anti: TGCCGTTGCAGATAATCTTCACGTCAACGGTGC The PCR amplification system is 50ul, and the reaction procedure is as follows:

[0083] (1) Plasmid pre-denaturation at 95°C for 5 minutes;

[0084] (2) 95°C, 15 seconds;

[0085] (3) 65°C, 15 seconds;

[0086] (4) 72°C, 4 minutes; repeat steps 2-4 25-30 times;

[0087] (5) Final extension at 72°C for 2 minutes.

[0088] The PCR product was digested with dpnI and directly transformed into DH5α competent E. coli. It was cultured overnight on LB solid medium containing 50ug / ml ampicillin. The positive clones were picked for colony PCR identification and sent to Universal Company for sequencing to obtain the transformant MTS1353.

[0089] Example 4: Plasmid transformation

[0090] The plasmid of transformant MTS1353 was extracted and transformed into BL21 (DE3) competent Escherichia coli, cultured overnight on LB solid medium containing 50ug / ml ampicillin, and positive clones were taken for colony PCR identification and sent to Universal Company for sequencing to obtain the protease expression strain GAMIM-pro.

[0091] Colony PCR identification procedure:

[0092] The primers used for PCR reaction were synthesized by Tsingke Company. The primer sequences are as follows:

[0093] T7:TAATACGACTCACTATAGGG

[0094] T7ter: TGCTAGTTATTGCTCAGCGG

[0095] The PCR amplification system is 15ul, and the reaction procedure is as follows:

[0096] (1) Single colony culture medium was pre-denatured at 95°C for 5 minutes;

[0097] (2) 95°C, 30 seconds;

[0098] (3) 52°C, 30 seconds;

[0099] (4) 72°C, 90 seconds; repeat steps 2-4 30-35 times;

[0100] (5) Final extension at 72°C for 2 minutes.

[0101] The BL21(DE3) engineered strain producing the serine protease variants was stored at -80°C.

[0102] Example 5: Liquid Culture for Production of Serine Protease Variants

[0103] Take an activated bacterial monoclone (containing the serine protease variant expression frame), inoculate it into 20 ml liquid culture medium (LB liquid culture medium and 0.25% ampicillin, LB liquid culture medium formula: peptone 1%, yeast extract 0.5%, NaCl 1%), culture at 37°C until the OD value is between 0.4 and 0.6, add IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.8 mmol / L, and culture at 25°C in a reciprocating shaker at 180 rpm for 12 hours. Ultrasonication was performed on an ultrasonic disruptor with a power of 300w for 30 minutes, and the supernatant was taken for SDS-PAGE analysis by frozen centrifugation. The results showed that the molecular weight of the serine protease variant plus the solubilizing tag was about 70 kD.

[0104] Example 6: Purification of protease

[0105] 1. The supernatant in the example was transferred in batches to a 12 mL affinity chromatography column containing 2 mL ProteinIso Ni-NTA Resin. Each time, it was incubated on ice for 1 hour, and mixed by inversion every 10 minutes until the supernatant was completely affinity-bound by Ni-NTA Resin. The effluent was collected and named as the flow-through.

[0106] 2. Rinse the Ni column in batches with imidazole solutions of different concentrations.

[0107] 3. Incubate the Ni column with 1.5 mL of 500 mM imidazole solution on ice for 20 min, shake and mix every 2 min, and collect the eluate.

[0108] 4. Take 20uL of each of the above samples, add 4uL 6xSDS-PAGE Loading Buffer, boil for 6 minutes, and then perform SDS-PAGE gel electrophoresis.

[0109] 5. After electrophoresis, stain with Coomassie Brilliant Blue solution for 3 hours and then destain with destaining solution until clear protein bands are seen.

[0110] 6. Select a protein solution without impurities and add it to the dialysis bag. Place the dialysis bag in the dialysis solution and stir and dialyze at 4°C for 8 hours.

[0111] Example 7: Protease activity assay

[0112] Definition of protease activity unit: Under the conditions of pH 7.4 and 37°C, the amount of enzyme that hydrolyzes casein to produce 1 μmol tyrosine in 1 minute is defined as one enzyme activity unit (U / mL).

[0113] The enzyme activity determination is as follows: absorb the purified protease, and then dilute it with the corresponding buffer to a certain concentration, the recommended concentration range is 10U / mL-15U / mL; preheat the casein solution in a 40℃±0.2℃ constant temperature water bath for 5 minutes, take a clean test tube and add 1mL of the diluted enzyme solution, and bathe it in a 40℃±0.2℃ water bath for 2 minutes; add 2mL of trichloroacetic acid to the blank group and shake it well and place it in a 40℃±0.2℃ constant temperature water bath for 10 minutes to terminate the reaction, and at the same time, add 1mL of casein solution to the experimental group and shake it well and place it in a 40℃±0.2℃ constant temperature water bath for 10 minutes to react; add 1mL of casein to the blank group and 2mL of trichloroacetic acid to the experimental group, shake them well and let them stand for 10 minutes, and filter them with slow qualitative filter paper; absorb 1mL of the filtrate, add 5mL of sodium carbonate solution and 1mL of Folin solution, shake them well and place them in a 40℃±0.2℃ constant temperature water bath for 20 minutes to develop color. Measure the absorbance at a wavelength of 680mm.

[0114] Example 8: Enzymatic properties of proteases

[0115] First, we determined the acid resistance of the protease and the activity of the protease under different pH conditions. The hydrolysis reaction conditions were the same as above, with pH values ​​of 2.0, 3.0, 4.0 and 5.0, respectively, and the amount of enzyme added was 50ul. GAMIO-pro was used as a control. The results are shown in Tables 1 and Figure 4 Under the condition of pH 2.0, the serine protease variant of the present invention can still be hydrolyzed normally, indicating that the serine protease variant of the present invention has a strong tolerance to low pH, while the original protease GAMIO-pro has a weaker ability to tolerate low pH.

[0116] Table 1: Comparison of protease activity at different pH values, 40°C for 2 hours

[0117]

[0118] Secondly, the activity of the two proteases at different incubation times at pH 2.2 was also measured, at 4, 8, 12, 16, and 20 hours. The results are shown in Tables 2 and Figure 5 After 8 hours of incubation, the enzyme activity of the original protease GAMIO-pro was seriously reduced; after 12 hours of incubation, the enzyme activity of the composite mutant enzyme GAMIM-pro was 36kU / mL, and it still had a certain protease activity, which was higher than that of the original protease GAMIO-pro.

[0119] Table 2: Comparison of protease activity after incubation at pH 2.2 at different times

[0120]

[0121] We then measured the thermal stability of the two proteases. At pH 6.0, the samples were incubated at 70°C, 80°C, 85°C and 90°C for 2 hours. The results are shown in Table 3 and Figure 6 The protease mutant GAMIM-pro still has a certain enzyme activity, while the original protease GAMIO-pro can not tolerate high temperatures above 80℃.

[0122] Table 3: Comparison of protease activity at different temperatures for 2 hours at pH 6.0

[0123]

[0124] Example 9: Application of protease in feed

[0125] The piglet feed was enzymatically hydrolyzed by protease before and after mutation, and the feed formula was as shown in Table 4.

[0126] Compare the release of amino acids in enzymatic feed. Set up two groups of experiments, both of which are 3-factor 3-level orthogonal experiments, and the other group is a mutant protease experimental group, preferably at 40°C, pH 2.0-2.5, more preferably pH 2.2, and a rotation speed of 180 rpm.

[0127] Table 4: Piglet feed formula

[0128]

[0129] Different masses of piglet feed were dissolved in 20 ml of simulated gastric fluid and adjusted to a specific pH with 2 mol / L hydrochloric acid. The enzymatic hydrolysis effects (release of amino acids in the supernatant) were compared under different enzyme addition amounts (100 U, 200 U, 400 U), different enzymatic hydrolysis times (4 h, 5 h, 6 h) and solid-liquid ratios (solid: crushed piglet feed; liquid: simulated gastric fluid) (0.3 g / ml, 0.5 g / ml, 0.7 g / ml). The results are shown in Table 5 and Figure 7 The results showed that the enzymatic efficiency of mutant proteasomes was higher than that of original proteasomes. Moreover, when the enzyme dosage was 400U, the solid-liquid ratio was 0.7g / ml, and the enzymatic time was 4 hours, the enzymatic efficiency was higher than that of other groups.

[0130] In summary, according to the experimental results of the present invention, this series of protease variants have good heat resistance, acid resistance, good feed enzymatic hydrolysis effect, and can be applied to the feed industry.

[0131] Table 5: In vitro feed enzymolysis effect

[0132]

[0133] In addition to applying the technical methods in the art, the embodiments of the present invention are also inseparable from the guidance of the main purpose of the invention. Therefore, the present invention is not limited to the specific embodiments disclosed, but also covers the revised clauses within the spirit and scope of the present invention, see the claims for details.

Claims

1. A feed Bacillus Velez serine protease variant, characterized in that The serine protease variant is prepared by sequentially mutating positions 228 and 431 of the serine protease protein sequence of Bacillus velezensis D1 (Bacillus velezensis, from the China Type Culture Collection of Wuhan University, with a collection number of CCTCCNO: M2023632), respectively from glycine to tryptophan and from arginine to cysteine, and the serine protease variant still retains the ability of the parent serine protease to hydrolyze peptide bonds.

2. The serine protease variant according to claim 1, characterized in that The amino acid sequence of the serine protease variant is shown in SEQ ID NO.4 in the sequence listing.

3. A gene encoding the serine protease variant according to claim 1.

4. The gene according to claim 3, characterized in that The nucleotide sequence of the serine protease variant is shown in SEQ ID NO.3 in the sequence listing.

5. A recombinant for expressing the serine protease variant according to claim 1, characterized in that A gene encoding a serine protease variant according to claim 4.

6. A method for producing the serine protease variant according to claim 1, characterized in that The method comprises culturing a recombinant containing a gene sequence encoding a serine protease variant under conditions suitable for expressing the serine protease variant, and obtaining the serine protease variant from the recombinant or its culture supernatant.

7. Use of the serine protease variant according to claim 1 in hydrolyzing peptide bonds of macromolecular proteins.

8. The use according to claim 7, characterized in that The serine protease variant is used in hydrolyzing peptide bonds of macromolecular proteins under high temperature and low pH conditions, wherein the high temperature is 40-70° C. and the low pH is 2.0-6.0.

Images