Aptamer for simultaneously simulating free and binding state Neu5Gc, kit and application thereof

Abstract

The invention relates to the technical field of biological medicines, in particular to an aptamer capable of simultaneously simulating free and binding Neu5Gc, a kit and application of the aptamer. The nucleotide sequence of the aptamer is as shown in SEQ ID No. 1. The aptamer provided by the invention can effectively simulate free Neu5Gc antigen epitopes in various binding states, can be combined with more types of anti-Neu5Gc antibodies compared with existing types of limited antigens, can be used as a molecular probe, can detect the content of anti-Neu5Gc antibodies in serum and related preparations to be closer to the real level, can also detect the content of Neu5Gc antigens in biological preparations through a competition principle, and has a good application prospect. And in-vivo experiments are expected to be carried out as a Neu5Gc substitute due to low immunogenicity.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an aptamer capable of simulating both free and bound Neu5Gc, a kit and applications thereof. Background Art

[0002] Most deuterostomes, i.e. mammals, fish and echinoderms, can synthesize Neu5Gc extensively. However, humans have lost a 92bp fragment in exon 6 of the CMAH hydroxylase gene, a key enzyme for Neu5Gc synthesis, during evolution, which makes the CMAH hydroxylase inactive and unable to synthesize Neu5Gc. However, they continue to ingest exogenous Neu5Gc through diet. After entering the human body, Neu5Gc in red meat can be recognized by the non-substrate-specific Neu5Ac sialic acid synthase, and is absorbed and integrated into outer membrane proteins by cells through the Neu5Ac metabolic integration pathway. As a foreign autoantigen, it continuously stimulates the body to produce anti-Neu5Gc antibodies. Antibodies attack normal tissues that have integrated Neu5Gc, which can easily cause chronic inflammation such as enteritis, arthritis and myocarditis, thereby increasing the risk of colorectal cancer, heart disease and other diseases. Studies have shown that the level of anti-Neu5Gc antibodies in serum is correlated with the degree of inflammation and tumor progression, and has detection value.

[0003] Existing detection methods mostly use Neu5Gc-BSA, Neu5Gc-polyacrylamide conjugates, or use a one-pot three-enzyme method to artificially synthesize specified types of Neu5Gc glycolipids and glycoproteins as detection antigens, and use ELISA or glycan microarray methods to detect antibody levels. However, since the types and connection methods of glycans, proteins or lipids in naturally bound Neu5Gc can also determine the antigenic epitopes, the corresponding anti-Neu5Gc antibodies are diverse and have low cross-reactivity. Existing detection methods use a single or limited type of Neu5Gc antigen, and the types of anti-Neu5Gc antibodies that can be detected are limited, making it difficult to reflect the true level of anti-Neu5Gc antibodies. Therefore, there is a need for a simulated antigen that can simultaneously simulate free and multiple bound Neu5Gc epitopes to make up for the lack of anti-Neu5Gc antibody detection direction. Summary of the invention

[0004] In order to solve the above problems, the present invention provides an aptamer, a kit and an application thereof that can simultaneously simulate free and bound Neu5Gc. The aptamer provided by the present invention can effectively simulate free and various bound Neu5Gc antigen epitopes. Compared with the existing limited types of antigens, it can bind to more types of anti-Neu5Gc antibodies. As a molecular probe, the anti-Neu5Gc antibody content in serum and related preparations detected is closer to the actual level. The Neu5Gc antigen content in biological preparations can also be detected by the competition principle, and it is expected to be used as a Neu5Gc substitute for in vivo experiments due to its low immunogenicity.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an aptamer that simulates both free and bound Neu5Gc. The nucleotide sequence of the aptamer is shown in any one of SEQ ID No. 1-6.

[0007] Preferably, the free Neu5Gc includes α-isomer free Neu5Gc.

[0008] Preferably, the bound Neu5Gc includes artificially synthesized antigens and naturally bound Neu5Gc.

[0009] Preferably, the artificially synthesized antigen includes Neu5Gc-BSA.

[0010] The present invention also provides a kit for simulating both free and bound Neu5Gc, comprising the aptamer described in the above technical solution.

[0011] The present invention also provides the use of the aptamer described in the above technical solution in the preparation and purification of anti-Neu5Gc antibody reagents.

[0012] The present invention also provides the use of the aptamer described in the above technical solution as a molecular probe in a reagent for detecting the content of anti-Neu5Gc antibodies in serum and related preparations.

[0013] The present invention also provides the use of the aptamer described in the above technical solution as a molecular probe in detecting the Neu5Gc antigen content in a biological preparation.

[0014] Beneficial effects:

[0015] Bound Neu5Gc integrated on the surface of human tissue cells can also serve as a binding site for a variety of food pathogens, increasing the chances of food poisoning and the probability of zoonotic infectious diseases. Among them, the AB5 subserine cytotoxin secreted by Shiga toxin-producing Escherichia coli (STEC) O113:H2198NK2 strain, the B subunit (SubB) responsible for anchoring has been proven to specifically bind to α-isomeric free Neu5Gc and multiple bound Neu5Gc, and is suitable as a binding target. Through epitope simulation such as SELEX and other technologies, simulated antigens that simultaneously simulate free and multiple bound Neu5Gc are screened out. SELEX technology is a method that uses a large-capacity artificially synthesized random oligonucleotide library, combined with PCR in vitro amplification technology, to exponentially enrich oligonucleotide aptamers that specifically bind to target molecules. Oligonucleotide libraries with sufficient capacity contain all possible stereostructures, and high-affinity ligands of any type of target molecules can be screened to meet experimental needs.

[0016] Therefore, the present invention uses SELEX technology, and uses the soluble SubB protein obtained by renaturation of SubB-His outer membrane protein expression bacteria and inclusion bodies as the first six and last six rounds of screening targets, and screens out 6 positive Neu5Gc simulation aptamers in the 78nt ssDNA library containing 40nt random sequences. Through indirect and competitive ELISA identification, the aptamer provided by the present invention can effectively simulate free and multiple bound Neu5Gc antigen epitopes, and can bind to more types of anti-Neu5Gc antibodies compared with the existing limited types of antigens. As a molecular probe, the anti-Neu5Gc antibody content in serum and related preparations detected is closer to the real level, and the Neu5Gc antigen content in biological preparations can also be detected by the competition principle, and it is expected to be used as a Neu5Gc substitute for in vivo experiments due to its low immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0018] Figure 1 For the SELEX screening process;

[0019] Figure 2 for the preparation and characterization of SubB;

[0020] Figure 3 Determine the number of SELEX screening rounds;

[0021] Figure 4 Screening results for dominant aptamers;

[0022] Figure 5 Prediction of secondary structure for aptamer No. 11;

[0023] Figure 6 The results of free Neu5Gc and Neu5Gc-BSA competition ELISA;

[0024] Figure 7 Competition ELISA results for native Neu5Gc;

[0025] Figure 8 This is the affinity determination of aptamer No. 11. DETAILED DESCRIPTION

[0026] The present invention provides an aptamer that simulates both free and bound Neu5Gc, characterized in that the nucleotide sequence of the aptamer is shown in any one of SEQ ID No. 1 to 6, specifically as follows:

[0027] SEQ ID No.1:

[0028] 5'-ATGGTTGTAGGTCAGGTGGGTCGGGGCGGGTGGTGGTTCTTTTTGCTCGATCGGGGGTGCATTCCGCTTACATTCTCG-3';

[0029] SEQ ID No.2:

[0030] TTGGTTGTAGGTCAGGTGGGGTGGGTGGTGGTCCGTTATCATGTTCCCGTTGTCTGCTGCATTCCGCTTACATTCTCG;

[0031] SEQ ID No.3:

[0032] TTGGTTGTAGGTCAGGTGGGGTGGGTGGTGGTCTTCCTTTTTTCTGTCCCTGCGCGTGTCATTCCGCTTACATTCTCG;

[0033] SEQ ID No.4:

[0034] TTGGTTGTAGGTCAGGTGGGCGGCGGTGTTTTGTTTCGTCTTGTCTCGTTCGGGGTTGTCATTCCGCTTACATTCTCG;

[0035] SEQ ID No.5:

[0036] TTGGTTGTAGGTCAGGTGGGTCGGGGGGGTGGTGGTAGTGTTTTATGTCGTTGTCGGTCATTCCGCTTACATTCTCG;

[0037] SEQ ID No.6:

[0038] TTGGTTGTAGGTCAGGTGGCGCTCGATGTGGTGGTTTCTGGGTTTGGCTCTGGGACTGGCATTCCGCTTACATTCTCG.

[0039] In the present invention, the free Neu5Gc preferably includes α-isomer free Neu5Gc. In the present invention, the bound Neu5Gc preferably includes artificially synthesized antigens and naturally bound Neu5Gc. In the present invention, the artificially synthesized antigen preferably includes Neu5Gc-BSA.

[0040] The present invention provides a kit for simulating both free and bound Neu5Gc, comprising the aptamer described in the above technical solution. The present invention does not specifically limit the types and contents of other reagents in the kit, and those skilled in the art can use conventional methods.

[0041] The present invention also provides the use of the aptamer described in the above technical solution in the preparation and purification of anti-Neu5Gc antibody reagents.

[0042] The present invention also provides the use of the aptamer described in the above technical solution as a molecular probe in a reagent for detecting the content of anti-Neu5Gc antibodies in serum and related preparations.

[0043] The present invention also provides the use of the aptamer described in the above technical solution as a molecular probe in detecting the Neu5Gc antigen content in a biological preparation.

[0044] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] 1. Materials and methods

[0047] 1.1 Materials

[0048] Cmah- / - knockout C57 mice were prepared by Cyagen using CRISPR / Cas9 technology; human anti-Neu5Gc antibody positive serum was obtained by preliminary screening of Cmah- / - knockout and wild mouse serum by differential qualitative ELISA. In order to cover antibodies against different Neu5Gc antigens as much as possible, human antibody positive serum from 10 donors was mixed and purified by affinity chromatography; SubB protein gene sequence was obtained from NCBI Reference Sequence: NZ_VEOI01000025.1; TE buffer, 20mM Tris, 1mM EDTA, pH 8.5; washing buffer I, 20mM Tris, 1mM EDTA, 1% TritonX-100, pH8.5; washing buffer II, 20mMTris, 1mM EDTA, 1% TritonX-100, 2M Urea, pH8.5; denaturation buffer, 20mM Tris, 10mM EDTA, 8M Urea, pH 9.5; refolding buffer, 2 mM GSH, 0.2 mM GSSG, 20 mM Tris, 6, 4, 2, 0 M Urea were added in arithmetic progression, and the pH was 9.5; exonuclease was purchased from Biotime Biotechnology Co., Ltd.

[0049] 1.2Expression of SubB-His outer membrane protein and preparation of soluble protein

[0050] The signal peptide of the SubB protein gene sequence was removed, and a his tag was added to the 3' end. The gene was connected to the pET-30a(+) plasmid from the Nde I / Xhol I cloning site, synthesized by Shanghai Shenggong Biotechnology Co., Ltd., and transformed into Rosetta (DE3) competent cells. The expression was induced by 0.5mM IPTG to obtain the SubB-His outer membrane protein expression bacteria.

[0051] The expression strain was washed three times with 0.01M PBS, resuspended in TE buffer and ultrasonically disrupted; centrifuged at 12000rpm for 15min, the precipitate was washed with wash buffer I for two rounds, and then washed with wash buffer II for one round, stirring at room temperature for 2h each round; the precipitate was stirred in denaturing buffer at room temperature overnight, centrifuged and the supernatant was placed in a 3kDa dialysis bag, gradually renatured in renaturation buffer, and the next urea concentration gradient was replaced every 12h, and finally dialyzed in 0.01M PBS for 6h, centrifuged and the supernatant was concentrated to 0.6mg / mL through a 3kDa ultrafiltration tube, and stored at 4℃.

[0052] 1.3 Random library design

[0053] The 78nt random ssDNA library consists of 19nt fixed sequences at both ends and 40nt random oligonucleotide sequences in the middle. A total of 26 pairs of primers were designed, and 8 pairs of high-quality primers were screened based on Tm and Gc content and reference to Nucleotide BLAST results. After verification by blank template PCR, the optimal primers without primer dimers were selected, and three pairs of primer combinations were designed, namely, the 5' end of the upstream primer was modified with biotin, and the 5' end of the downstream primer was phosphorylated; the upstream primer was not labeled, and the 5' end of the downstream primer was phosphorylated; and both the upstream and downstream primers were not labeled. The above primers and library design sequences are shown in Table 1, all of which were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0054] Table 1 Random library design

[0055]

[0056] 1.4 Dual-target SELEX screening

[0057] SubB-His outer membrane protein expression bacteria and soluble SubB protein were used as the first 6 rounds and the last 6 rounds of screening targets, respectively. The screening process is shown in Figure 1 The information on expression bacteria, protein, ssDNA dosage, incubation time and washing times required for each round of screening is shown in Table 2. The induced expression strain and the uninduced strain were washed three times with 0.01 M PBS and resuspended to 10 9CFU / mL, stored at 4℃ for later use. Resuspend ssDNA in 0.01M PBS, place in 95℃ metal bath for 5min, then immediately place in ice bath for 10min, gently mix with unexpressed strain, incubate at 37℃; centrifuge at 12000rpm for 2min, take supernatant and gently mix with expressed strain, incubate at 37℃; wash by centrifugation in 0.01M PBS, and precipitate with 100μL ddH 2 O, place in a 95°C metal bath for 5 min, then immediately place in an ice bath for 2 min, centrifuge, take the supernatant, dilute 10-fold as a PCR template, and store at -20°C.

[0058] Table 2 SELEX screening conditions

[0059]

[0060] 1 μg / mL SubB protein was mixed with 4×10 7 CFU / mL of uninduced strain, 100μL / well were added to 96-well ELISA plates, and coated at 4℃ overnight; 0.01M PBS was taken to resuspend ssDNA, and it was immediately placed on ice for 10 minutes after being placed in a metal bath at 95℃ for 5 minutes, and then added to the wells coated with uninduced strains. After incubation at 37℃, the supernatant was added to the SubB protein-coated wells and incubated at 37℃; the supernatant was discarded, and the wells were washed with 0.01M PBS by shaking. 100μL ddH2O was added, and it was immediately placed on ice for 2 minutes after being placed in a metal bath at 95℃ for 5 minutes. The supernatant was diluted 10 times as a PCR template and stored at -20℃.

[0061] The PCR system is shown in Table 3. The PCR program is 94℃ pre-denaturation for 30s, 94℃ denaturation for 6s, 57℃ annealing for 4s, 72℃ extension for 4s, 3 cycles, 62℃ annealing for 22 cycles, and 72℃ extension for 30s. The PCR product phosphate-labeled dsDNA was cleaved off the antisense strand by phosphate exonuclease. The enzyme digestion system is 250μL PCR dsDNA product, 18μL phosphate exonuclease, 90μL buffer, 540μL ddH2O, incubated at 37℃ for 20min, 75℃ metal bath for 10min, and then immediately ice bathed for 5min. The ssDNA obtained by enzyme digestion was purified by ethanol precipitation, resuspended in 0.01M PBS and stored at -20℃. Non-biotin-labeled ssDNA was used for the next round of screening, and biotin-labeled ssDNA was used for ELISA identification.

[0062] Table 3 PCR system

[0063] Reagents No biotin added system (μL) Biotin labeling addition system (μL) PCRMix enzyme 12 8 Upstream primer 2 2 Downstream primer 2 2 template 5 5 ddH2O 4 8 Total volume 25 25

[0064] The double-stranded product of the last round of biotin-free and phosphate-free PCR was taken, connected to the pMD 19-T vector and transformed into JM109 competent cells, evenly spread on Amp-resistant agar plates, incubated overnight at 37°C, picked monoclonal colonies for overnight shaking culture, and the bacterial solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing and identification. After Snapgene multiple sequence alignment analysis, the 6 oligonucleotide sequences with the highest repetitiveness were selected, and biotin-labeled aptamers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. for ELISA screening.

[0065] 1.5 Determination of the number of SELEX screening rounds

[0066] Take the 1-12 rounds of purified biotin-labeled ssDNA, dilute 1:25, add 100 μL / well to the SubB protein-coated wells, incubate at 37°C for 1 hour; wash with PBST, add avidin-HRP at 100 μL / well, incubate at 37°C for 1 hour; wash with PBST, add TMB substrate at 100 μL / well, incubate at 37°C for 10 minutes, add stop solution at 50 μL / well, and read the OD 450nm Absorbance value.

[0067] 1.6 Aptamer sequence screening

[0068] Take human anti-Neu5Gc positive antibody, 14 μg / mL, add 100 μL / well to 96-well ELISA plate, and coat at 4°C overnight; resuspend the biotin-labeled aptamer from 0.01M PBS to 0.4 μM, put in 95°C metal bath for 5 minutes, then immediately put in ice bath for 10 minutes, add 100 μL / well to SubB protein coated wells and human positive antibody coated wells, incubate at 37°C for 1 hour, wash with PBST, add avidin-HRP at 100 μL / well, incubate at 37°C for 1 hour; wash with PBST, add TMB substrate at 100 μL / well, incubate at 37°C for 10 minutes, add stop solution at 50 μL / well, and read OD 450nm Absorbance value.

[0069] 1.7 Aptamer specificity identification

[0070] To prove that the aptamer can effectively compete with free Neu5Gc and Neu5Gc-BSA conjugate, the biotin-labeled aptamer was resuspended in 0.01M PBS to 0.8μM, incubated at 95℃ for 5min, and then immediately incubated on ice for 10min. Then, it was gently mixed with equal volumes of 20μg / mL Neu5Gc-BSA and 20μg / mL Neu5Gc standards, and 100μL / well was added to the human positive antibody-coated wells and incubated at 37℃ for 1h. The aptamer bound to the human positive antibody was captured using avidin-HRP, and the OD was read. 450nm Absorbance value.

[0071] To prove that the aptamer can effectively compete with the naturally bound Neu5Gc, the knockout and wild mouse sera were diluted 1:500, 100 μL / well was added to a 96-well ELISA plate, and coated at 4°C overnight; the biotin-labeled aptamer was resuspended in 0.01M PBS to 0.8 μM, and immediately placed in an ice bath at 95°C for 10 min after a 5-min metal bath. It was gently mixed with an equal volume of 14 μg / mL human positive antibody, and 100 μL / well was added to the knockout and wild mouse serum-coated wells, respectively, and incubated at 37°C for 1 h; the bound human positive antibody was captured using anti-human secondary antibody-HRP, and the OD was read. 450nm Absorbance value.

[0072] 1.8 Aptamer affinity identification

[0073] Human anti-Neu5Gc positive antibody, 28 μg / mL, 100 μL / well were added to 96-well ELISA plates and coated at 4°C overnight; biotin-labeled aptamers were diluted in 0.01M PBS to 50, 25, 12.5, 6.25, 3.125, 1.56, 0.78 nM, in a 95°C metal bath for 5 min, then immediately ice-bathed for 10 min, 100 μL / well were added to the coated wells, and incubated at 37°C for 1 h; avidin-HRP was used to capture the aptamers bound to the human positive antibody, and the OD was read. 450nm Absorbance value.

[0074] 2. Results and Discussion

[0075] 2.1Expression of SubB-His Outer Membrane Protein and Preparation of Soluble Protein

[0076] PCR was performed using the SubB-His outer membrane protein expression bacteria as a template, and the SubB-His gene fragment was successfully amplified, indicating that the SubB-pET-30a(+) plasmid was successfully constructed and successfully transformed into Rosetta (DE3) competent cells. Using 0.5mMIPTG, expression was induced at 20℃ and 37℃, respectively. The supernatant and precipitate were separated by ultrasonic centrifugation. After SDS-PAGE and Western-Blot identification, the SubB protein was successfully expressed. Among them, 37℃ could induce a large amount of inclusion body expression, which was used for inclusion body renaturation purification. The solutions of each step of renaturation purification were identified by SDS-PAGE, and some high-content impurities were washed away, realizing the soluble preparation and preliminary purification of SubB protein.

[0077] 2.2 Determination of the number of SELEX screening rounds

[0078] Indirect ELISA was used to measure the affinity of the purified biotin-labeled ssDNA obtained in each round of screening with the SubB protein. A dot-line graph was drawn with the number of screening rounds as the horizontal axis and the OD value as the vertical axis. The optimal number of screening rounds was determined based on the OD value. As the amount of ssDNA input in each round decreased, the concentration of ssDNA obtained in each round of purification also decreased accordingly. Figure 3 It can be seen that the overall trend of the OD value is still rising. The OD value of the first round is 0.2645, and the OD values ​​of the 11th and 12th rounds are both around 1.5, and the OD value trend is stable. Therefore, after 12 rounds of screening, a high-purity targeted ssDNA has been obtained.

[0079] The OD value of the fifth round was 1.35, which was much higher than the OD value of 0.53 in the fourth round, indicating that this round of screening had a good effect. However, the OD value of the sixth round dropped to 0.74, indicating that the sixth round of screening may not have completely retained the dominant ssDNA in the fifth round, but it still had a significant enrichment effect relative to the OD value of the fourth round. The OD value of the tenth round dropped to 0.169, presumably because this round further reduced the amount of ssDNA input and performed a reverse screening step, resulting in a lower concentration of ssDNA used as a PCR template in the positive screening, and therefore a lower OD value. However, from the OD value of 1.541 in the eleventh round, it can be seen that the tenth round of screening still retained high-affinity ssDNA, which was enriched to a higher concentration after the eleventh round.

[0080] 2.3 Screening of superior aptamers

[0081] The six oligonucleotide sequences with the highest repetitiveness (Table 1) were selected for indirect ELISA screening. Figure 4 , aptamers 1, 8, and 11 bind well to SubB protein, but only aptamer 11 (SEQ ID No. 1) 5'-ATGGTTGTAGGTCAGGTGGGTCGGGGCGGGTGGTGGTTCTTTTTGCTCG ATCGGGGGTGCATTCCGCTTACATTCTCG-3' also binds well to human positive antibody. According to the minimum free energy principle, the secondary structure prediction was performed using snapgene software, and aptamer 11 formed a neck loop structure ( Figure 5 ), with two QGRS regions, G-scores of 20 and 6, and good stability, which can be used for subsequent identification.

[0082] Table 1 Aptamer sequences

[0083]

[0084] 2.4 Aptamer specificity and affinity determination

[0085] Competitive ELISA and differential competitive ELISA verified that aptamer No. 11 can effectively compete with free Neu5Gc, Neu5Gc-BSA, and naturally bound Neu5Gc. When coated with human positive antibodies, the aptamer had extremely significant competitive effects with free Neu5Gc and Neu5Gc-BSA (p<0.001)( Figure 6 ), indicating that the aptamer can effectively simulate the free and Neu5Gc-BSA antigen epitopes, and the competitive inhibition rate is about 25%. It is speculated that the inhibition rate is related to the proportion of antibodies corresponding to the free Neu5Gc and Neu5Gc-BSA antigen epitopes. When coated with wild-type and knockout mouse serum, the aptamer competition effect is extremely significant (p<0.001), and the competitive inhibition rate is 80%, and the OD of the wild-type and knockout serum coated groups is 1. 450nm The difference in values ​​decreased from extremely significant (p<0.001) to significant (p<0.05) ( Figure 7 ). Although the OD of wild-type mouse serum-coated group increased after aptamer competition 450nm The value is close to that of the knockout mouse serum coating group, but there is still a significant difference between the two (p<0.05), indicating that aptamer 11 can simulate most of the naturally binding Neu5Gc antigen epitopes, but there are still a few naturally binding Neu5Gc antigen epitopes that have not been successfully simulated. Therefore, it is possible to consider the combined use of multiple aptamers to cover the vast majority of naturally binding Neu5Gc antigen epitopes.

[0086] GraphPad software was used to perform nonlinear fitting on the indirect ELISA experimental results. Figure 8 The dissociation constant (K d ) is 0.8498nM, and the corresponding affinity constant (K a ) is 1.17×10 9 L / mol, goodness of fit (R 2 ) is 0.9972, indicating that aptamer No. 11 has high affinity and is suitable for use as a sensitive molecular probe in the field of detection and diagnosis.

[0087] It can be concluded from the above examples that the present invention uses SELEX technology, takes SubB-His outer membrane protein expressing bacteria and soluble SubB protein as screening targets, and screens out aptamer No. 11 in the ssDNA library that can effectively simulate free and multiple bound states of Neu5Gc. Compared with the existing limited types of antigens, this aptamer can bind to more types of anti-Neu5Gc antibodies. As a molecular probe, the anti-Neu5Gc antibody content in serum and related preparations detected is closer to the real level. It can also detect the Neu5Gc antigen content in biological preparations through the competition principle, and is expected to be used as a Neu5Gc substitute for in vivo experiments due to its low immunogenicity.

[0088] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An aptamer that simultaneously simulates free and bound Neu5Gc, characterized in that: The nucleotide sequence of the aptamer is shown in any one of SEQ ID No. 1-6.

2. The aptamer according to claim 1, characterized in that The free Neu5Gc includes α-isomer free Neu5Gc.

3. The aptamer according to claim 1, characterized in that The bound Neu5Gc includes artificially synthesized antigens and naturally bound Neu5Gc.

4. The aptamer according to claim 3, characterized in that The artificially synthesized antigen includes Neu5Gc-BSA.

5. A kit for simulating both free and bound Neu5Gc, characterized in that: Comprising the aptamer according to claim 1.

6. Use of the aptamer according to claim 1 in the preparation and purification of anti-Neu5Gc antibody reagents.

7. Use of the aptamer according to claim 1 as a molecular probe in detecting the content of anti-Neu5Gc antibodies in serum and related preparations.

8. Use of the aptamer according to claim 1 as a molecular probe in detecting the Neu5Gc antigen content in biological preparations.

Images