Sri Lanka cassava mosaic virus transcription activator AC2 and application thereof

Abstract

The invention provides an application of an AC2 gene, or an AC2 gene coding protein, or a recombinant vector or host bacteria containing an AC2 gene coding region in reducing the expression level of AtSGS3, and / or reducing the expression level of MeSGS3, and / or reducing an SGS3 / RDR6 compound. Researches find that SLCMV AC2 interacts with AtSGS3 and MeSGS3, the growth ability of yeast in an SD / -Ade / -His / -Leu / -Trp auxotroph culture medium and an SD / -Ade / -His / -Leu / -Trp auxotroph culture medium added with 3-AT can be improved, expression of AtSGS3 and MeSGS3 can be down-regulated, an SGS3 / RDR6 compound can be reduced, and a research result lays a foundation for clarification of a molecular mechanism of SLCMV AC2 regulation and control of host RNA silencing.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Sri Lankan cassava mosaic virus transcription activator AC2 and an application thereof. Background Art

[0002] Cassava mosaic disease (CMD) is the most serious disease that harms cassava, seriously affecting cassava yields and posing a serious threat to global cassava production and causing economic losses. In my country, CMD caused by geminiviruses is mainly caused by infection with the Sri Lankan cassava mosaic virus (SLCMV). The virus causes symptoms such as chlorosis and yellowing of cassava leaves, curling and deformation of leaves. Severely infected plants affect normal vegetative growth and yield. SLCMV has strong virulence and a very wide host range, mainly in the Euphorbiaceae and Solanaceae families, and can even extend to Arabidopsis thaliana and Ageratum conyzoides plants.

[0003] Host post-transcriptional gene silencing (PTGS) is an important defense mechanism against foreign nucleic acid invasion based on RNA silencing. It is involved in silencing a wide range of endogenous genes in plants and is one of the important antiviral immune mechanisms. The basic process of PTGS includes the initiation phase, the effect phase and the amplification phase, and the host gene silencing suppressor (SGS3) mainly acts in the amplification phase of the PTGS pathway. It usually forms particles called SGS3 / RDR6 complexes with RNA polymerase 6 (RNA dependent RNA polymerase 6, RDR6) in the cytoplasm, allowing it to synthesize double-stranded RNAs (dsRNA) and amplify the PTGS silencing signal. However, in the long-term evolution process with the host, most viruses usually encode at least one silencing suppressor (Viral suppressors of RNA silencing, VSRs) to inhibit the host's RNA silencing. As a key factor in the PTGS pathway, SGS3 plays a key role in RNA silencing and plant antiviral defense.

[0004] Sri Lanka cassava mosaic virus ( Sri Lankan cassava mosaic virus, SLCMV) is one of the strains of cassava mosaic virus. SLCMV is a typical two-component geminivirus, whose genome consists of two circular components, DNA-A and DNA-B. The AC2 protein is a transcriptional activator encoded by the DNA-A component of SLCMV. Studies have shown that the AC2 protein encoded by SLCMV is a viral pathogenic factor. It is still unclear whether AC2 plays the role of VSR by targeting SGS3 to inhibit the host PTGS defense function. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and to provide a Sri Lankan cassava mosaic virus transcription activator AC2 and an application thereof in order to study the mechanism of action of SLCMV AC2 in inhibiting host PTGS.

[0006] The first aspect of the present invention is to provide an application of the AC2 gene, or a protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in reducing the expression level of AtSGS3, and / or reducing the expression level of MeSGS3, and / or reducing the SGS3 / RDR6 complex, wherein the interaction between AC2 and AtSGS3 leads to a reduction in the expression level of AtSGS3, and / or a reduction in the SGS3 / RDR6 complex, and the interaction between AC2 and MeSGS3 leads to a reduction in the expression level of MeSGS3; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO: 2; The nucleotide sequence of the gene corresponding to MeSGS3 is shown in SEQ ID NO: 3; The nucleotide sequence of the gene corresponding to AtRDR6 is shown in SEQ ID NO:4; The SGS3 / RDR6 complex is formed by the interaction of the proteins AtSGS3 and AtRDR6.

[0007] The second aspect of the present invention is to provide an application of the AC2 gene, or a protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in interaction with AtSGS3 or MeSGS3, wherein the interaction between AC2 and AtSGS3 or the interaction between AC2 and MeSGS3 improves the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO: 2; The nucleotide sequence of the gene corresponding to MeSGS3 is shown in SEQ ID NO:3.

[0008] The third aspect of the present invention is to provide an application of the AC2 gene, or a protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in interaction with AtSGS3 or MeSGS3, wherein the interaction between AC2 and AtSGS3 or the interaction between AC2 and MeSGS3 improves the growth ability of yeast in a SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium supplemented with 3-AT; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO: 2; The nucleotide sequence of the gene corresponding to MeSGS3 is shown in SEQ ID NO:3.

[0009] The present invention finds that there is interaction between SLCMV AC2 and AtSGS3 and MeSGS3, which can downregulate the expression of AtSGS3 and MeSGS3, and can combine with AtSGS3 to reduce the SGS3 / RDR6 complex, thereby improving the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium and SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium supplemented with 3-AT. The research results will lay a foundation for clarifying the molecular mechanism of SLCMV AC2 regulating host RNA silencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 The yeast interactions are pGBKT7-AC2 and pGADT7-AtSGS3, and pGBKT7-AC2 and pGADT7-MeSGS3. BD-AC2 + AD-AtSGS3, BD-AC2 + AD-MeSGS3, and BD-AC2 + AD-PARN represent the yeast co-transformation combinations of pGBKT7-AC2 + pGADT7-AtSGS3, pGBKT7-AC2 + pGADT7-MeSGS3, and pGBKT7-AC2 + pGADT7-PARN, respectively. SD-LW: SD-LW / -Leu / -Trp medium; SD-LWHA: SD-LWHA / -Ade / -His / -Leu / -Trp medium; SD-LWHA+5mM 3AT: SD-LWHA / -Ade / -His / -Leu / -Trp medium + 5mM 3AT.

[0011] Figure 2BiFC was used to verify the interaction between SLCMV AC2 protein and AtSGS3 protein in tobacco. A: YC-AtSGS3 and YN-AC2 were co-injected into tobacco; B: YC-SGS3 and p1300-YN1 were co-injected into tobacco. Merged: GFP, RFP and white field fluorescence; GFP: GFP fluorescence; RFP: RFP fluorescence.

[0012] Figure 3 BiFC was used to verify the interaction between SLCMV AC2 protein and MeSGS3 protein in tobacco. A: YC-MeSGS3 and YN-AC2 were co-injected into tobacco; B: YC-MeSGS3 and p1300-YN1 were co-injected into tobacco. Merged: GFP, RFP and white field fluorescence; GFP: GFP fluorescence; RFP: RFP fluorescence.

[0013] Figure 4 Subcellular localization of AC2-GFP and AtSGS3-GFP. A: AC2-GFP and red light nuclear localization marker HDZF-RFP were co-injected into tobacco; B: AtSGS3-GFP and red light cytoplasmic localization marker prSSU were co-injected into tobacco. Merged: GFP, RFP and white field fluorescence; GFP: GFP fluorescence; RFP: RFP fluorescence.

[0014] Figure 5 Subcellular colocalization of AC2-RFP and AtSGS3-GFP. GFP: GFP fluorescence; RFP: RFP fluorescence; Merged: GFP, RFP and white field fluorescence.

[0015] Figure 6 Confocal analysis of the effect of AC2 on the YN-RDR6 and YC-SGS3 complex in N. benthamiana. A: Confocal microscopy observation of GFP fluorescence after infiltration of N. benthamiana leaves 5 dpi, GFP: GFP fluorescence; Merged: GFP and white field fluorescence; EV: blank vector P1300-FYC; B: The relative number of complexes formed by YN-RDR6 and YC-SGS3.

[0016] Figure 7Analysis of the effect of AC2-GFP on the expression of AtSGS3-Flag protein and RNA levels. A: Western Blot detection of the accumulation levels of AtSGS3 and AC2 proteins after 5 dpi of infiltration of AtSGS3-Flag with buffer, AC2-GFP and blank vector in N. benthamiana leaves; B: qRT-PCR detection of the relative expression levels of AtSGS3 mRNA in each infection combination in A; EV: blank vector PG1300; the numbers indicate the relative content of AtSGS3 protein.

[0017] Figure 8 Analysis of the effect of AC2-GFP on the expression of MeSGS3-Flag protein and RNA levels. A: Western Blot detection of MeSGS3 and AC2 protein accumulation levels in N. benthamiana leaves after 5 dpi of infection with MeSGS3-Flag, buffer, AC2-GFP and blank vector, B: qRT-PCR detection of the relative expression level of MeSGS3 mRNA in each infection combination in A; EV: blank vector pG1300; numbers indicate the relative content of MeSGS3 protein. DETAILED DESCRIPTION

[0018] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0019] 1 Plant material Wild-type Nicotiana benthamiana ( N. benthamiana ).

[0020] 2 Experimental methods and results

[0021] 2.1 Yeast two-hybrid analysis to identify the interaction between AC2 and MeSGS3 For ease of expression, during the co-transformation process, the "pGADT7" vector is abbreviated as "AD" and the "pGBKT7" vector is abbreviated as "BD". The yeast expression vectors pGADT7, pGBKT7, AD-T, AD-AtSGS3 and BD-53 (Liu, L., Wang, H., Fu,Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing interacts with ArabidopsisSGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.), and AD-PARN (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) are all stored in this laboratory. With reference to the reported SLCMV sequence (GenBank: KT861468.1), the target fragment Y2H-AC2 was synthesized (see Table 1 for the specific sequence). The synthesized fragment was double-digested with EcoRI and BamHI and then ligated with the large fragment recovered from the yeast vector pGBKT7 after the same double-digestion. The ligation product was transformed into Escherichia coli, and the obtained positive clones were identified by PCR and sequencing using primers AC2-1F and AC2-390R (see Table 2 for the specific sequence). The correct clones were named BD-AC2. The construction of YC-MeSGS3 was based on the following method: MeSGS3 was amplified using primers MeSGS3-1F and MeSGS3-2112R (see Table 2 for the specific sequence) with cassava cDNA as the template; the PCR product was double-digested with SpeI and KpnI and then ligated with the large fragment of pGADT7 recovered after the same double-digestion. The positive clones were identified by sequencing and named AD-MeSGS3.

[0022] After yeast vectors were transformed into competent yeast alone or together with reference to Table 3, single clone colonies positively identified by PCR were picked up and put into 25 μL sterile water, resuspended to make suspension, and gradiently diluted with sterile water to 10 times, 100 times, and 1000 times, and 2 μL of each was inoculated into SD / -Leu / -Trp (SD-LW) nutrient-deficient medium, SD / -Leu / -Trp / -His / -Ade (SD-LWHA), and SD-LWHA medium supplemented with different concentrations of the autoactivation inhibitor 3-AT. Yeast co-transformed with AD-T and BD-Lam and AD-T and BD-53 were used as negative and positive controls, respectively, and inoculated into solid culture medium together with yeast solution transformed with the target plasmid, and cultured inverted in a constant temperature incubator at 28°C for 3 days to observe and record the growth, and determine the screening concentration of 3-AT and the interaction relationship between proteins.

[0023] The results are as follows Figure 1 As shown, yeast self-activation verification showed that BD-AC2 plasmid has self-activation activity, that is, it can activate the transcriptional expression of downstream genes without interacting with other proteins, but 5 mM 3-AT can effectively inhibit the self-activation activity of BD-AC2. Yeast strains co-transformed with AD-AtSGS3 and AD-MeSGS3 and BD can only grow normally in SD-LW nutrient-deficient medium, but cannot grow normally in SD-LWHA nutrient-deficient medium, indicating that AD-AtSGS3 and AD-MeSGS3 plasmids do not have self-activation activity and can be directly used in subsequent yeast two-hybrid experiments.

[0024] The results of yeast two-hybrid studies are as follows Figure 1 As shown, all co-transformed yeasts can grow normally in SD-LW defective medium, but only yeast positive control, co-transformed BD-AC2 and AD-AtSGS3, and co-transformed BD-AC2 and AD-MeSGS3 can grow normally in SD-LWHA defective medium and SD-LWHA defective medium supplemented with 5 mM 3-AT, while negative control and co-transformed BD-AC2 and AD-PARN yeast cannot grow normally. The results show that there is an interaction between BD-AC2 and AD-AtSGS3, and between BD-AC2 and AD-MeSGS3.

[0025] Table 1 Target fragment sequence Clip Name Sequence (5′–3′) Y2H-AC2 <![CDATA[ GGCCATGGAGGCCAGT GAATTC ATGCGACCTTCATCTCCCTCAGCGAGCCGCTCTACTCAGGTTCCAATCAAGGTCCAACACAGGGCAGCTAAGCGTAAGGCCATTCGGCGACGGAGAGTAGACCTCAATTGCGGCTGCTCATACTACGTGCACATCAACTGCCACAACCATGGATTCACGCACAGGGGAACTCATCACTGCAGCTCAGGCGATGAATGGCGTATATATCTGGGAGGTTCCAAATCCCCTCTATTTCAGGATCATCCAGCACGACAGCCGGCCGTTCAACAGGCCGTGGGACATAATAACCATCCAGATACGCTTCAACCACAACCTGAGGAAAGCGTTGGGACTACATCAATGCTGGATGGATTTCAAGGTCTGGACGACCTTACAGCCTCAGACCTGGCGTTTCTTGAGGGTATTTGA GGATCC ATCGAG CTCGAGCTGCA <!-- 4 -->]]> AC2-GRFP <![CDATA[ AACACGGGGGAC TCTAGA ATGCGACCTTCATCTCCCTCAGCGAGCCGCTCTACTCAGGTTCCAATCAAGGTCCAACACAGGGCAGCTAAGCGTAAGGCCATTCGGCGACGGAGAGTAGACCTCAATTGCGGCTGCTCATACTACGTGCACATCAACTGCCACAACCATGGATTCACGCACAGGGGAACTCATCACTGCAGCTCAGGCGATGAATGGCGTATATATCTGGGAGGTTCCAAATCCCCTCTATTTCAGGATCATCCAGCACGACAGCCGGCCGTTCAACAGGCCGTGGGACATAATAACCATCCAGATACGCTTCAACCACAACCTGAGGAAAGCGTTGGGACTACATCAATGCTGGATGGATTTCAAGGTCTGGACGACCTTACAGCCTCAGACCTGGCGTTTCTTGAGGGTATT GGATCC ATGGTGAGCAAGG G ]]> Note: Italic bold letters are vector sequences containing restriction sites Table 2 Primers used Primer name Primer sequence (5′–3′) AC2-1F ATGCGACCTTCATCTCCCTC AC2-390R CGCCAGGTCTGAGGCTGTAAG MeSGS3-1F ACTAGTATGCTTATTCTCTTGCTTCC MeSGS3-2112R GGTACCCTCTTTGCTGGTTGCATTAC Table 3 Pairing combinations of yeast bait plasmids and prey plasmids combination Bait carrier Prey carrier 1 (positive control) AD-T BD-53 2 (Negative control) AD-T BD-lam 3 AD BD-AC2 4 AD-AtSGS3 BD 5 AD-MeSGS3 BD 6 AD-AtSGS3 BD-AC2 7 AD-MeSGS3 BD-AC2 8 (Self-activation negative control) AD-PARN BD-AC2

[0026] 2.1 Bimolecular fluorescence identification of the interaction between AC2 and AtSGS3 and MeSGS3 BiFC vector p1300-YN1 (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.), YC-AtSGS3, p1300-FYC and nuclear localization red light labeling vector FIB2-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.), YN-AC2 (Liu Xueting, Xie Qiuxian, Liu Linyu, et al. Study on the interaction between Sri Lanka cassava mosaic virus AC2 and Arabidopsis SGS3 protein [J]. Journal of Tropical Crops, 2024, 45(07):1323-1331), silencing suppressor expression vector pZP-P19 (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional genesilencing at an early initiation step. Journal of virology, 77(1), 511–522.) were preserved in our laboratory; the construction of YC-MeSGS3 was based on the following method: MeSGS3 was amplified using primers MeSGS3-1F and MeSGS3-2112R (specific sequences are shown in Table 2) with cassava cDNA as a template; the PCR product was double-digested with SpeI and KpnI and ligated with the large fragment of p1300-FYC recovered by the same double enzyme digestion; the positive clone was named YC-MeSGS3 after being sequenced and confirmed to be correct.

[0027] (1) Plant expression vector transformation into Agrobacterium GV3101 The plant expression vectors YN-AC2, YC-AtSGS3, YC-MeSGS3, p1300-YN1, the silencing suppressor expression vector pZP-P19 and the nuclear localization red light expression vector FIB2-RFP were transformed into Agrobacterium GV3101 competent cells, respectively. The transformed Agrobacterium was evenly spread on LB solid culture medium containing corresponding resistance (YN-AC2, YC-SGS3, YC-MeSGS3, p1300-YN1 were spread on LB plates containing Kan and Rif resistance, pZP-P19 was spread on LB plates containing Spec and Rif resistance, and the working concentration was 50 μg / mL), and inverted culture was carried out at 28°C for 72-90 h.

[0028] (2) Agrobacterium infiltration of Nicotiana benthamiana Use a pipette to pick up a single colony that is positive by colony PCR into 5 mL of LB liquid medium containing the corresponding antibiotics, and place it in a constant temperature shaker at 28°C 200 r / min for overnight shaking. After centrifugation of the bacterial solution at 7000 rmp / min for 15 min, the supernatant is discarded, and the precipitate is resuspended with 5 mL of injection buffer. After sufficient vortex shaking, the bacterial solution concentration is diluted to OD600 of 0.5. After the diluted bacterial solution is placed at room temperature for 2-3 h, the resuspended solutions of different recombinant vectors are mixed in a ratio of 1:1:1 (see Table 4 for specific combinations), and the combination of p1300-YN1 mixed with YC-AtSGS3 and YC-MeSGS3 resuspended bacterial solutions for injection is set as a negative control. Each combination is added with 1 / 10 of the total volume of the nuclear localization red light vector FIB2-RFP bacterial solution as the nuclear marker positioning in the experiment. Fully mixed for injection into the leaves of Nicotiana benthamiana with vigorous growth and 5-7 leaves. Each combination was injected with at least 3 replicates, and the injected N. benthamiana was kept in the dark overnight and then cultured under normal conditions. After 2-3 days, about 1-2 cm2 of each sample was taken to observe the fluorescence of tobacco cells and take pictures using a laser confocal microscope (Olympus FV3000), with GFP excitation light at 488 nm and RFP excitation light at 546 nm.

[0029] YN-AC2 was co-injected with YC-AtSGS3 and YC-MeSGS3, and FIB2-RFP was co-injected as a nuclear marker. The leaves of Nicotiana benthamiana treated with different treatments were cut and observed under a laser confocal microscope with excitation light of 488 nm and 546 nm. The results are shown in Figure 2 , Figure 3As shown: YN-AC2 co-injected with YC-AtSGS3 and YC-MeSGS3 in N. benthamiana leaves can restore green fluorescence under the excitation light of 488 nm, and overlap with the red fluorescence expressed by FIB2-RFP under the excitation light of 546 nm, while no green fluorescence recovery was observed when empty p1300-YN1 was co-injected with YC-AtSGS3 and YC-MeSGS3. The BiFC research results further illustrate the interaction between Sri Lankan cassava mosaic virus AC2 and AtSGS3 and MeSGS3.

[0030] Table 4 Combinations of different recombinant plasmids Agrobacterium combination Recombinant plasmid name 1 YN-AC2 + YN-AtSGS3 + pZP-P19 +1 / 10 nuclear marker FIB2-RFP 2 YN-AC2 + YN-MeSGS3 + pZP-P19 + 1 / 10 nuclear marker FIB2-RFP 3 p1300-YN1 + YN-AtSGS3 + pZP-P19 + 1 / 10 nuclear marker FIB2-RFP 4 p1300-YN1 + YN-MeSGS3 + pZP-P19 +1 / 10 nuclear marker FIB2-RFP

[0031] 2.2 Subcellular localization and colocalization experiments AtSGS3-GFP and nuclear localization expression vector FIB2-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinklevirus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 toenhance virus infection. Molecular plant pathology, 24(2), 154–166.), pZP-P19 (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiationstep. Journal of virology, 77(1), 511–522.) and prSSU (Dabney-Smith C, VAN DENWIJNGAARD ​​PW, TREECE Y, et al. The C Terminus of a Chloroplast PrecursorModulates Its Interaction with the Translocation Apparatus and PIRAC[J].Journal of Biological Chemistry, 1999, 274(45): 32351-32359.) is preserved in our laboratory.

[0032] (1) Construction of AC2-GFP and AC2-RFP In order to construct the subcellular localization vectors AC2-GFP and AC2-RFP containing green fluorescent protein and red fluorescent protein sequences of SLCMV AC2 protein, the expression vector p1300-sGFP and p1300-RFP restriction endonucleases were added to the two ends of the artificial synthesis, respectively. XB I and Bam The target fragment AC2-GRFP of the sequence on both sides of the HI site (see Table 1 for the specific sequence).

[0033] use XB I and Bam The vectors p1300-sGFP and p1300-RFP were double-digested with HI endonuclease, and the large fragments of the digested vectors p1300-sGFP and p1300-RFP were recovered using an agarose gel recovery kit. XB I and Bam The vectors were connected after HI double digestion, and the ligation products were transformed into Escherichia coli DH5α competent cells and spread into LB medium containing 50 μg / mL kanamycin. The plates were placed upside down in a 37°C constant temperature incubator for 12 h. 3-5 single colonies were picked and identified by colony PCR using AC2-specific primers AC2-1F and AC2-390R (specific sequences are shown in Table 1). Two positive clones identified by colony PCR were picked and sequenced by BGI Technology Co., Ltd. The positive clones that were correctly sequenced were picked and named AC2-GFP and AC2-RFP.

[0034] (2) Plant expression vector transformation into Agrobacterium GV3101 The recombinant plasmids AC2-GFP, AC2-RFP, AtSGS3-GFP, prSSU, FIB2-RFP and pZP-P19 were transformed into Agrobacterium GV3101 competent cells, respectively. The transformed Agrobacterium was evenly spread on LB solid culture medium containing corresponding resistance (AC2-GFP, AC2-RFP, AtSGS3-GFP, RDR6-GFP, RDR6-RFP, prSSU and FIB2-RFP were spread on LB plates containing Kan and Rif resistance, pZP-P19 was spread on LB plates containing Spec and Rif resistance, and the working concentration was 50 μg / mL), and cultured inverted at 28°C for 72-90 h.

[0035] (3) Agrobacterium infiltration of Nicotiana benthamiana Use a pipette to pick up a single colony that is positive by colony PCR into 5 mL of LB liquid medium containing the corresponding antibiotics, and place it in a constant temperature shaker at 28°C 200 r / min for overnight culture. Centrifuge the bacterial solution at 7000 rmp / min for 15 min and discard the supernatant. Resuspend the precipitate with 5 mL of injection buffer, and dilute the bacterial solution to an OD600 of 0.5 after sufficient vortexing. After the diluted bacterial solution is placed at room temperature for 2-3 h, the resuspended bacterial solution of different recombinant vectors is mixed in equal volumes (see Table 5 for specific combinations). For each combination, add 1 / 10 of the total volume of the bacterial solution of the nuclear localization red light vector FIB2-RFP as the nuclear marker positioning in the experiment, or add 1 / 10 of the total volume of the bacterial solution of the membrane localization red light expression prSSU as the membrane marker positioning in the experiment. After the different resuspended bacterial solutions are fully mixed, inject them into the leaves of the Nicotiana benthamiana with vigorous growth and 5-7 leaves. Each combination is injected with at least 3 replicates. The injected Nicotiana benthamiana is kept away from light overnight and then cultured under normal conditions. After 2-3 days, take about 1-2 cm of each sample 2 A laser confocal microscope (Olympus FV3000) was used to observe and photograph the fluorescence expression of tobacco cells. The excitation light for GFP was 488 nm and the excitation light for RFP was 546 nm.

[0036] Observation results such as Figure 4 As shown: After AC2-GFP was co-injected with the nuclear localization red light expression vector FIB2-RFP, AC2-GFP could express green fluorescence under 488 nm excitation light conditions and overlap with the red fluorescence-labeled nuclear localization plasmid, indicating that the AC2 protein was nuclear localized; after AtSGS3-GFP was co-injected with the cytoplasmic red light localization marker prSSU, AtSGS3-GFP was granular and overlapped with the red light of prSSU, indicating that the localization pattern of AtSGS3 protein was cytoplasmic localization.

[0037] AC2-RFP and AtSGS3-GFP were co-injected into N. benthamiana. Three days later, leaves of N. benthamiana with different treatments were cut and observed under a laser confocal microscope with excitation light of 488 nm and 546 nm. The results are shown in the figure. Figure 5 As shown: In the tobacco combination co-injected with AC2-RFP and AtSGS3-GFP, granular AtSGS3-GFP attached to the vicinity of nuclear-localized AC2-RFP, indicating that AC2 protein co-localized with AtSGS3, suggesting that AC2 may exert an inhibitory silencing function by changing the localization of AtSGS3.

[0038] Table 5 Combinations of different recombinant plasmids Agrobacterium combination Recombinant plasmid name 1 AC2-GFP + 1 / 10 FIB2-RFP 2 AtSGS3-GFP + 1 / 10 prSSU 3 AC2-RFP + AtSGS3-GFP

[0039] 2.3 AC2 negatively regulates the formation of Arabidopsis cytoplasmic SGS3 / RDR6 particles YN-AtRDR6 and YC-AtSGS3 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154-166.) and p1300-FYC are stored in our laboratory (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.; Liu Xueting, Xie Qiuxian, Liu Linyu, et al. Study on the interaction between Sri Lanka cassava mosaic virus AC2 and Arabidopsis SGS3 protein [J]. Journal of Tropical Crops, 2024, 45(07): 1323-1331). The construction of p1300-Flag was carried out according to the following method: the Flag-BanHISacI fragment (specific sequence is shown in Table 6) was synthesized, the p1300-FYC large fragment recovered by double digestion with BamHI and SacI was connected, and the positive clone was named p1300-Flag after sequencing.

[0040] (1) Artificial synthesis of AC2 target fragment In order to construct the expression vectors AC2-Flag and AC2-FYC containing the Flag tag and FYC tag (Flag tag + YFP fluorescent protein C-terminal sequence) of SLCMV AC2 protein, the expression vector p1300-Flag and p1300-FYC restriction endonucleases were added to the two ends of the artificial synthesis, respectively, with reference to the reported SLCMV sequence (GenBank: KT861468.1). Spe I and Kpn The target fragment AC2-FYC of the sequence on both sides of the I site (see Table 6 for the specific sequence).

[0041] Table 6 Target fragment sequence Clip Name Sequence (5′–3′) Flag-BanHISacI GGATCCGACTATAAGGATGATGACGACAAAGGCTCTGGTTCCGATTACAAAGATGACGACGATAAGGGGAGCGGCTCTGACTACAAGGACGACGATGACAAGTAAGAGCTC AC2-FYC <![CDATA[ CATATGCCCGTCGAC ACTAGT ATGCGACCTTCATCTCCCTCAGCGAGCCGCTCTACTCAGGTTCCAATCAAGGTCCAACACAGGGCAGCTAAGCGTAAGGCCATTCGGCGACGGAGAGTAGACCTCAATTGCGGCTGCTCATACTACGTGCACATCAACTGCCACAACCATGGATTCACGCACAGGGGAACTCATCACTGCAGCTCAGGCGATGAATGGCGTATATATCTGGGAGGTTCCAAATCCCCTCTATTTCAGGATCATCCAGCACGACAGCCGGCCGTTCAACAGGCCGTGGGACATAATAACCATCCAGATACGCTTCAACCACAACCTGAGGAAAGCGTTGGGACTACATCAATGCTGGATGGATTTCAAGGTCTGGACGACCTTACAGCCTCAGACCTGGCGTTTCTTGAGGGTATT GGTACC GGATCCACGC GTATG ]]> Note: Italic bold letters are vector sequences containing restriction sites (2) Construction of plant expression vectors AC2-Flag and AC2-FYC use Spe I and Kpn I endonuclease double digest vector p1300-Flag, p1300-FYC, and use agarose gel recovery kit to recover the large fragments of the digestion products. Referring to the instructions of the seamless cloning kit, the artificially synthesized fragment AC2-FYC was cleaved with restriction endonucleases Spe I and Kpn I. The p1300-MeSGS3-Flag and p1300-FYC vector large fragments after double restriction digestion were connected, and the connection products were transformed into E. coli DH5α competent cells and spread into LB medium containing 50μg / mL kanamycin. The plates were placed upside down in a 37°C constant temperature incubator for 12 h. Pick 3-5 single colonies respectively, and use AC2-specific primers AC2-1F and AC2-390R (specific sequences are shown in Table 2) for colony PCR identification. Pick 2 positive clones identified by colony PCR respectively, and entrust BGI Technology Co., Ltd. to sequence and identify. Pick the positive clones that are correctly sequenced and named AC2-Flag and AC2-FYC respectively.

[0042] The fluorescent bimolecular expression vectors YN-RDR6 and YC-SGS3 were co-injected with empty vector (EV) or AC2-FYC into N. benthamiana leaves, and fluorescence confocal microscopy was used to observe on the 5th day after injection. We found that co-injection of YN-RDR6, YC-SGS3 with EV or AC2-FYC could restore the expression of green fluorescence ( Figure 6 A), indicating that AC2 cannot prevent SGS3 from forming a complex with RDR6. However, the fluorescence intensity was analyzed using image J, and the results showed that the fluorescence intensity of YN-RDR6, YC-SGS3 and AC2-FYC co-injected was lower than that of the empty vector co-injected ( Figure 6 B). This indicates that when AC2 is present, the amount of SGS3 / RDR6 complex formed by YC-SGS3 and YN-RDR6 is significantly reduced, and AC2 negatively regulates the formation of the SGS3 / RDR6 complex.

[0043] 2.4 Transient expression of AC2 downregulates the expression of AtSGS3 and MeSGS3 The large fragment was recovered from the expression vector p1300-Flag after double digestion with restriction endonucleases Spe I and Kpn I, and then ligated with the small fragments recovered from YC-AtSGS3 and YC-MeSGS3 by the same double digestion. The ligation products were transformed into Escherichia coli and the correct ones were named AtSGS3-Flag and MeSGS3-Flag after sequencing.

[0044] AtSGS3-Flag and AC2-GFP expression vectors were co-infiltrated into N. benthamiana leaves, and AtSGS3-Flag and buffer or EV were co-injected as controls, and only buffer was injected as a blank control group. Five days after infiltration, proteins and RNA of each combination were extracted for detection. Western Blot detection was performed using Flag antibody and GFP antibody, respectively. The results are shown in Figure 7 As shown in A, the accumulation level of AtSGS3-Flag protein after co-expression with AC2-GFP was significantly lower than that of the control group co-injected with buffer or EV. At the same time, Western Blot of GFP antibody also verified the production of AC2 protein. This shows that AC2 can downregulate AtSGS3 expression. To study whether AC2 downregulates AtSGS3 expression at the RNA level, we used qRT-PCR technology to detect the relative expression level of AtSGS3 mRNA in each infiltration combination. The results are shown in Figure 7 As shown in B, the relative expression level of AtSGS3 mRNA in the tobacco plant co-injected with AC2-GFP and AtSGS3-Flag was significantly lower than that in the control group. The results showed that AC2 down-regulation of AtSGS3 expression can occur at the RNA level.

[0045] The accumulation level of MeSGS3-Flag protein after co-expression with AC2-GFP was significantly lower than that of the control group co-injected with buffer or EV. Meanwhile, Western Blot of GFP antibody also verified the production of AC2 protein ( Figure 8 A), indicating that AC2 can downregulate MeSGS3 expression. To study whether AC2 downregulates MeSGS3 expression at the RNA level, we used qRT-PCR to detect the relative expression level of MeSGS3 mRNA in each infiltration combination. The results showed that the relative expression level of MeSGS3 mRNA in the combination of AC2-GFP and MeSGS3-Flag co-injected tobacco was significantly lower than that in the control group. Figure 8 B) Downregulation of MeSGS3 expression by AC2 can occur at the RNA level.

[0046] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in reducing the expression level of AtSGS3, and / or reducing the expression level of MeSGS3, and / or reducing the SGS3 / RDR6 complex, wherein the interaction between AC2 and AtSGS3 leads to a reduction in the expression level of AtSGS3, and / or a reduction in the SGS3 / RDR6 complex, and the interaction between AC2 and MeSGS3 leads to a reduction in the expression level of MeSGS3; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO: 2; The nucleotide sequence of the gene corresponding to MeSGS3 is shown in SEQ ID NO: 3; The nucleotide sequence of the gene corresponding to AtRDR6 is shown in SEQ ID NO:4; The SGS3 / RDR6 complex is formed by the interaction of the proteins AtSGS3 and AtRDR6.

2. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in the interaction with AtSGS3 or MeSGS3, wherein the interaction between AC2 and AtSGS3 or the interaction between AC2 and MeSGS3 improves the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutritional deficiency medium; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO: 2; The nucleotide sequence of the gene corresponding to MeSGS3 is shown in SEQ ID NO:

3.

3. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in the interaction with AtSGS3 or MeSGS3, wherein the interaction between AC2 and AtSGS3 or the interaction between AC2 and MeSGS3 improves the growth ability of yeast in a SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium supplemented with 3-AT; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO: 2; The nucleotide sequence of the gene corresponding to MeSGS3 is shown in SEQ ID NO:3.

Images