Application of PeERF1 gene in regulating poplar to respond to low nitrogen

Abstract

The invention discloses application of a PeERF1 gene in regulating and controlling poplar to respond to low nitrogen, and belongs to the technical field of molecular biology. A plant overexpression vector or a dominant inhibition expression vector containing a gene PeERF1 is constructed, the vector is heterologously transformed into poplar 84K, a transgenic positive plant is obtained through screening, and a transgenic plant capable of efficiently utilizing nitrogen is obtained through phenotypic analysis of the positive plant and a wild plant under different nitrogen treatment conditions. The invention provides an important nitrogen efficient utilization gene resource possibly having universality, materials are provided for subsequent related research, and a foundation is laid for efficient utilization research of forest resources.

Description

Technical Field

[0001] The invention relates to application of a PeERF1 gene in regulating poplar response to low nitrogen, and belongs to the technical field of plant gene engineering. Background Art

[0002] With the rapid economic development of my country, the demand for timber is increasing, but my country's forest resources are limited and timber has been in short supply for a long time. Poplar is the main tree species of artificial forests in my country. The existing artificial forest area is 7.5707 million hectares, providing about 30% of the country's timber. However, most of my country's poplar artificial forests have poor site conditions and lack of soil nitrogen, resulting in a yield level of only 60% of that in Europe and India. Therefore, the breeding and promotion of nitrogen-efficient poplars has become an urgent problem to be solved in my country's poplar artificial forest breeding.

[0003] Ethylene response element binding protein (ERF) genes are mainly found in plants. They are named because they contain a structure that can specifically bind to the eukaryotic gene expression control (GCC) box involved in the transcription of genes involved in ethylene response. They belong to the AP2 / ERF transcription factor family. AP2 / ERF family genes have been reported to regulate a variety of abiotic (cold, heat, drought, salt, osmotic stress) and biotic stress (herbivorous insects and microbial pathogens) response processes in higher plants.

[0004] This study found that the PeERF1 gene can also regulate the low-nitrogen response of poplars, which will help lay a good foundation for the subsequent cultivation of poplars with efficient nitrogen utilization and provide technical exploration for increasing wood yield under low-nitrogen site conditions. Summary of the invention

[0005] The present invention aims to provide an application of a PeERF1 gene in regulating the response of poplars to low nitrogen based on a Populus euphratica gene PeERF1 for regulating nitrogen utilization of poplars, whose coding region nucleotide sequence and amino acid sequence are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively; the CDS of the Populus euphratica gene PeERF1 for regulating nitrogen utilization of poplars is 663bp in length, encoding 221 amino acids and 1 termination codon, and transforming poplars using its expression vector, so as to promote the development of molecular breeding technology for efficient utilization of nitrogen in forest trees, provide technical means for the cultivation or screening of excellent tree species, and lay a foundation for exploring the molecular mechanism of nitrogen utilization of poplars.

[0006] The above object of the present invention is achieved through the following technical solutions:

[0007] Application of PeERF1 gene in regulating poplar's response to low nitrogen.

[0008] Preferably, the PeERF1 gene is used to improve nitrogen utilization efficiency of poplar.

[0009] Preferably, the use of the PeERF1 gene in improving nitrogen utilization efficiency of poplars is characterized by: making the plant contain the PeERF1 gene or making the plant overexpress the gene PeERF1 and the dominant inhibition expression gene PeERF1.

[0010] Preferably, the application of the PeERF1 gene in improving the nitrogen utilization efficiency of poplar is characterized by: constructing a plant overexpression and dominant inhibition expression vector containing the PeERF1 gene, heterologously transforming it into Populus alba×Populus glandulosa 84K, screening to obtain transgenic positive plants, and obtaining transgenic plants with high nitrogen utilization efficiency through growth phenotype analysis of positive plants and wild-type plants under different nitrogen concentrations.

[0011] Preferably, the use of the PeERF1 gene in improving nitrogen utilization efficiency of poplars is characterized by comprising the following steps:

[0012] 1) Collect Populus euphratica seedlings cultured in the tissue culture room of the Chinese Academy of Forestry in Haidian District, Beijing, extract RNA, reverse transcribe into cDNA, clone the CDS sequence of PeERF1, connect it to the pMDC32 vector for sequencing, and construct an overexpression vector and a dominant inhibition expression vector after identification, and heterologously transform them into Populus argentea 84K;

[0013] 2) The positive plants heterologously transformed with the PeERF1 gene into Populus argentea 84K were screened using hygromycin resistance and PCR techniques to obtain transgenic positive plants, and RNA was extracted and phenotypic statistics were performed on them. The transgenic plants were treated with different concentrations of nitrogen to verify their nitrogen utilization efficiency, and transgenic plants with high nitrogen utilization efficiency were obtained.

[0014] Phenotypic observations of transgenic Populus argentea 84K and wild-type Populus argentea 84K under different nitrogen concentrations showed that under low nitrogen conditions, the plant height and ground diameter of the transgenic poplars were higher than those of the wild type, indicating that the transgenic Populus argentea 84K grew better under low nitrogen conditions.

[0015] The above research results prove that the PeERF1 gene affects the growth of poplar under low nitrogen conditions, and it has important application value in the molecular breeding of efficient nitrogen utilization of forest trees and the selection of excellent varieties.

[0016] Compared with the prior art, the main beneficial technical effects of the present invention are:

[0017] The present invention uses Populus euphratica as material, screens and identifies the PeERF1 gene, and phenotypic identification based on its overexpression and dominant inhibition plants shows that it can improve the growth of poplars under low nitrogen conditions, providing a new option for screening high-yield poplars under barren site conditions, and has important application value in the field of forest genetic engineering.

[0018] The present invention is further described below through specific implementation modes and drawings, but it is not intended to limit the protection scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1-1 The positive plants of the transgenic silver gland poplar 84K strain overexpressing PeERF1 in Example 1 of the present invention are detected;

[0020] Figure 1-2 The positive plants of the dominantly inhibited PeERF1 transgenic Populus argentatus 84K strain in Example 1 of the present invention are detected;

[0021] Figure 2-1 The expression level of the transgenic Populus argentatus 84K plant overexpressing PeERF1 in Example 1 of the present invention is detected;

[0022] Figure 2-2 The expression level of the transgenic Populus argentatus 84K plant with dominant suppression expression of PeERF1 in Example 1 of the present invention is detected;

[0023] Figure 3-1 The phenotype of the transgenic silver gland poplar 84K under overexpression and dominant inhibition expression of PeERF1 under different nitrogen concentration conditions in Example 1 of the present invention;

[0024] Figure 3-2 The plant height and ground diameter statistics of transgenic Populus argentatus 84K overexpressing and dominantly inhibiting PeERF1 under different nitrogen concentration conditions in Example 1 of the present invention. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with specific examples. Operations not described in detail in the following examples can be implemented by referring to molecular cloning and the instructions for use of related kits.

[0026] Unless otherwise specified, the reagents involved in the following examples are all conventional reagents available on the market, and the methods used are all commonly used methods in the art.

[0027] Example 1

[0028] 1. Cloning of PeERF1 gene from Populus euphratica

[0029] Using Populus euphratica as the material, the Tiangen Polysaccharide and Polyphenol Total RNA Kit was used to extract RNA from Populus euphratica leaves (Populus euphratica total RNA), the method is as follows:

[0030] (1) 0.1 g of Populus euphratica leaf tissue was frozen with liquid nitrogen and ground in a mortar pre-cooled with liquid nitrogen. The leaf tissue sample was kept frozen during the grinding process. After the tissue sample was ground into powder, it was transferred to a 1.5 ml centrifuge tube. Then, 500 μl of lysis solution + 10 μl of β-mercaptoethanol) was added to a 2 ml sterilized centrifuge tube, and the tissue and reagent were thoroughly mixed using a turbine oscillator;

[0031] (2) Centrifuge at 12,000 rpm for 2 minutes and discard the supernatant;

[0032] (3) Transfer the supernatant to a filter column and centrifuge at 12,000 rpm for 2 minutes. Carefully pipette the supernatant into a new centrifuge tube.

[0033] (4) Add 0.4 times (200 μL) of anhydrous ethanol, mix well, transfer to the adsorption column, centrifuge at 12,000 rpm for 15 seconds, and discard the liquid;

[0034] (5) Add 80 μl of DNase working solution to the adsorption column and let stand at room temperature for 15 minutes; (DNase: 10 μl of DNase storage solution + 70 μl of buffer);

[0035] (6) Add 350 μL of deproteinized solution to the adsorption column, centrifuge at 12,000 rpm for 15 seconds, and discard the liquid;

[0036] (7) Add 500 μL of rinse solution to the adsorption column, centrifuge at 12,000 rpm for 15 seconds, and discard the liquid;

[0037] (8) Repeat (7);

[0038] (9) Centrifuge at 12,000 rpm for 2 minutes, transfer to a new centrifuge tube, dry, add 30 μL of RNA-free ultrapure water to dissolve the precipitate, let stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 1 minute to obtain the plant total RNA extract;

[0039] 2.0 μg RNA was taken from each sample and reverse transcribed into cDNA using Tiangen reverse transcription reagent. All experimental consumables were free of RNA contamination and the reactions were performed on ice. The reverse transcription steps were as follows:

[0040] 1) gDNA removal reaction (10 μl system) see Table 1 below:

[0041] Table 1

[0042]

[0043] Reaction conditions: 42°C, 3 minutes;

[0044] 2) The product of the previous step was used as a template for the reaction (20 μl system) as shown in Table 2 below:

[0045] Table 2

[0046]

[0047] 3) Add 1) to 2), reaction conditions: 42°C, reaction for 15 minutes; 95°C, reaction for 3 minutes. When using, dilute 10 μl cDNA + 190 μl ultrapure water to obtain the template cDNA;

[0048] With reference to the published genome sequence of Populus euphratica, primers were designed using Primer3 software (amplicon included the start codon and the stop codon) to perform full-length gene amplification (a GATEWAY linker was introduced into the primer); wherein the forward primer PeERF1-CDS-F for PeERF1 ORF is shown as SEQ ID NO.1 in the sequence listing (Table 3), and the reverse primer PeERF1-CDS-R is shown as SEQ ID NO.2 (Table 4); SRDX-PeERF1-CDS-F is shown as SEQ ID NO.3 in the sequence listing (Table 5), and the reverse primer SRDX-PeERF1-CDS-R is shown as SEQ ID NO.4 (Table 6);

[0049] Table 3

[0050]

[0051] Table 4

[0052]

[0053] Table 5

[0054]

[0055] Table 6

[0056]

[0057] Using Populus euphratica cDNA as a template, PCR amplification was performed using corresponding primers. The PCR reaction system (20 μl system) is shown in Table 7 below:

[0058] Table 7

[0059]

[0060] The reaction conditions are shown in Table 8 below:

[0061] Table 8

[0062]

[0063] The target fragment was excised and recovered by gel excision. The gel recovery kit of OMEGA Biotechnology Company of the United States was used to excise and recover the target fragment of PeuERF1 amplified by PCR. The specific operation steps are as follows:

[0064] 1) Cut the target fragment into a 1.5 ml sterile centrifuge tube, add 600 μl of binding buffer, and incubate at 50°C until the gel melts;

[0065] 2) Transfer the melted liquid into the filter column, centrifuge at 12,500 rpm for 2 minutes, and discard the waste liquid;

[0066] 3) Add 600 μl of eluent, centrifuge at 12,500 rpm for 30 minutes, and discard the waste liquid;

[0067] 4) Repeat (3) and discard the waste liquid;

[0068] 5) Centrifuge the empty filter column at 12,500 rpm for 2 minutes;

[0069] 6) Transfer the filter column to another 1.5 ml centrifuge tube, add 30 μl of sterile deionized water, let stand at room temperature for 5 minutes, centrifuge at 12,500 rpm for 2 minutes, and repeat the elution once;

[0070] 7) After 0.1% agarose gel electrophoresis, store at -20°C;

[0071] The obtained full-length cDNA sequence of the gene is 663 bp, named as PeERF1 gene, and the sequence is shown in the sequence table SEQ ID NO.5 (Table 9), and the compiled protein sequence is shown in SEQ ID NO.6 (Table 10);

[0072] Table 9

[0073]

[0074] Table 10

[0075]

[0076] 2. Construction of plant expression vector of PeERF1 gene

[0077] 1. Construction of overexpression and dominant suppression expression vectors

[0078] The overexpression vector was constructed using the Gateway method. The gel-recovered product of PeERF1 with the Gateway tag obtained by PCR amplification was first constructed on the pDONR222 intermediate vector by recombination reaction (BP reaction) (Thermo Fisher, Shanghai, China). The BP reaction system is shown in Table 11. Subsequently, PeERF1 was constructed on the pMDC32 vector by Gateway cloning (LR reaction) (Thermo Fisher, Shanghai, China) to obtain PeERF1 and SRDX-PeERF1, respectively;

[0079] The BP reaction system (5 μl system) is shown in Table 11 below:

[0080] Table 11

[0081]

[0082] Reaction conditions: 16°C, 1 hour;

[0083] The ligation product was transformed into E. coli DH5α. The specific transformation steps are as follows:

[0084] 1. Take 5 μl of the ligation product on an ice box, add it to 50 μl of E. coli competent DH5α produced by Beijing Quanshijin Biotechnology Co., Ltd., mix gently with a pipette, and place on ice for 30 minutes;

[0085] 2. Heat shock the transformed bacterial solution at 42°C for 90 seconds, take it out and place it in an ice bath for 5 minutes;

[0086] 3. Add 300 μl of LB liquid medium and shake at 37°C, 180 rpm for 1 hour;

[0087] 4. Centrifuge at room temperature, 4000 rpm for 5 minutes, discard the supernatant, and resuspend the remaining bacterial solution;

[0088] 5. Spread all the mixed transformed bacteria onto the LB solid plate containing 50 mg / L Kan, dry it, seal it and place it upside down in a 37℃ constant temperature box for 12 to 14 hours;

[0089] Randomly pick a number of single colonies grown on the resistance plate, add 300 μL of LB liquid medium containing Kan (50 mg / L), incubate at 37°C, 180 rpm, shake culture for 4-5 hours, and use the bacterial liquid as a template to perform PCR detection of positive clones;

[0090] The PCR reaction system (20 μl system) is shown in Table 12 below:

[0091] Table 12

[0092]

[0093]

[0094] The reaction conditions are shown in Table 14 below:

[0095] Table 14

[0096]

[0097] After the reaction is completed, 5 μl of PCR amplification product is taken, and detected by 0.1% agarose gel electrophoresis, and photographed under ultraviolet light of the gel imaging system. The bands with the same size as the amplification primers can be regarded as positive clones. 3 to 5 PCR positive clones are selected and sequenced by Beijing Qingke Biotechnology Co., Ltd. to confirm that they are successfully constructed on the intermediate vector; according to the sequencing results, the target strain is added to an equal volume of 50% sterile glycerol, shaken and evenly mixed, and transferred to a -80°C refrigerator for storage after pre-freezing in liquid nitrogen, or the pDNOR222-PeERF1 plasmid is extracted and stored by expanding the culture;

[0098] The gene fragment of pDNOR222-PeuERF1 plasmid was subjected to restriction digestion and LR ligation reaction;

[0099] The enzyme digestion reaction system (10 μl system) is shown in Table 15 below:

[0100] Table 15

[0101]

[0102] Reaction conditions: 37°C, 3 hours;

[0103] The pDNOR222-PeERF1 plasmid was subjected to LR reaction ligation. The LR reaction system (5 μl system) is shown in Table 16 below:

[0104] Table 16

[0105]

[0106]

[0107] Reaction conditions: 25°C, 2.5 hours;

[0108] The ligation product was transformed into Escherichia coli, and single clones were picked for sequencing. The correct single colonies were the pMDC32-PeERF1 and pMDC32-SRDX-PeERF1 plasmids. Finally, the PeERF1 overexpression vector PeERF1 and the dominant inhibition expression vector SRDX-PeERF1 were cloned;

[0109] 3. Genetic transformation and detection of PeERF1 gene

[0110] 1. Genetic transformation of PeERF1 gene

[0111] The constructed overexpression vector (PMDC32-PeERF1) and dominant suppression expression vector (PMDC32-SRDX-PeERF1) were transferred into Agrobacterium GV3101 by electroporation, and then transferred into poplar by Agrobacterium-mediated genetic transformation. The transformation steps are as follows: Populus alba×P.glandulosa callus used for genetic transformation was cultured at 23-25°C, 16 / 8h (day / night) of light intensity and 50μM m-2s-1 of light intensity. Agrobacterium containing the target expression vector infected the callus at OD600=0.6-0.8. The infected callus was placed on L&M, Lloyd&McCown Woody Plant Basal Medium with Vitamins, and co-cultured for 3 days in the dark at 22±2°C. The leaves after co-cultivation were transferred to a medium containing 0.5mg / l 6-benzyl aminopurine (6-BA) and 0.05 mg / l naphthaleneacetic acid (NAA), 3 mg / l hygromycin B and 200 mg / l Timentin were cultured at 23-25°C, 16 / 8 h (day / night) light intensity of 50 μM m-2s-1 to induce and screen resistant adventitious buds. After 30-45 days of induction culture, the resistant adventitious buds were transferred to a rooting medium (1 / 2 Murashige and Skoog (MS) basic medium supplemented with 0.05 mg / l IBA and 0.02 mg / l NAA) containing 3 mg / l hygromycin B and 200 mg / l Timentin until roots were induced. DNA from leaves of rooted plants was extracted for PCR verification.

[0112] 2. Detection of overexpression and dominant suppression transgenic plants

[0113] The resistant PeERF1 gene overexpression, dominant inhibition expression 84K poplar and wild-type plants were obtained, and genomic DNA was extracted. The resistance gene on the expression vector was amplified by PCR. If a clear band was amplified, it was a transgenic plant; Figure 1-1 and Figure 1-2As shown, they are respectively detection diagrams of wild-type silver gland poplar 84K and transgenic poplar positive plants overexpressing and dominantly inhibiting PeERF1 in Example 1 of the present invention; leaves of transgenic plants were selected, and the wild type was used as a control, total RNA was extracted and reverse transcribed, and PeERF1 gene quantitative analysis was performed to determine the expression level of the target gene in the transgenic plants, and finally 11 transgenic positive strains overexpressing PeuERF1 were obtained, which were named OE-1, OE-2, OE-3, OE-4, OE-5, OE-6, OE-7, OE-8, OE-9, OE-10, and OE-11 respectively; 10 transgenic positive strains dominantly inhibiting SRDX-PeERF1 were named SE-1, SE-2, SE-3, SE-4, SE-5, SE-6, SE-7, SE-8, SE-9, and SE-10 respectively; the quantitative primer was PeERF1-RT-F (SEQ ID NO.7), see Table 17 below; PeERF1-RT-R (SEQ ID NO.8), see Table 18 below;

[0114] Table 17

[0115] name Sequence 7 (SEQ ID NO.7) PeERF1-RT-F TGGCGTAAGGGTTTGGTTAG

[0116] Table 18

[0117] name Sequence 8 (SEQ ID NO.8) PeERF1-RT-F GACTCCCTCACTCTTTCAACTG

[0118] The expression level of PeERF1 gene in transgenic poplars was detected by RT-PCR. The results showed that the gene expression levels in 11 transgenic lines overexpressing PeERF1 gene were significantly higher than those in wild-type control plants, and the relative expression levels were 7.51-85.63 times that of the control (e.g. Figure 2-1 The expression levels of the 10 dominant transgenic lines that suppressed the expression of SRDX-PeERF1 gene were significantly higher than those of the wild-type control plants, and the relative expression levels were 1.05-25.39 times that of the control (as shown in Figure 2-2 shown).

[0119] 4. Phenotypic observation of PeERF1 transgenic plants

[0120] More than 10 biological replicates were set for the transgenic lines of PeERF1 overexpression and dominant suppression expression, and wild-type Populus 84K (WT) was set as a control interplant. The culture site was the poplar tissue culture room of the Chinese Academy of Forestry. Overexpression and suppression expression transgenic poplars with the same growth status were selected and planted in vermiculite and perlite for one month. After that, they were irrigated every 3 days with Hoagland's nutrient solution containing 0.5mM and 4mM nitrogen and cultured for 45 days. On the 45th day, the growth status of each transgenic poplar and the control was observed, and the plant height and ground diameter of the transgenic poplars under each treatment condition were counted. Figure 3-1 to Figure 3-2 As shown, it is a comparison diagram of the plant height phenotype of the wild-type silver gland Populus 84K and the transgenic poplars with overexpression and dominant inhibition of PeERF1 in Example 1 of the present invention. Under 4mM nitrogen conditions, the plant height and ground diameter of the PeERF1 transgenic poplar are respectively lower than those of WT; under 0.5mM nitrogen conditions, the plant height and ground diameter of the PeERF1 transgenic poplar are the same as or slightly higher than those of WT; therefore, based on the comprehensive phenotype and statistical data, it is preliminarily speculated that the Populus euphratica PeERF1 gene has the effect of improving the growth of poplars under low nitrogen conditions to a certain extent.

[0121] The present invention provides an important and potentially universal nitrogen efficient utilization gene resource, which provides material for future related research and also lays a foundation for research on efficient utilization of forest resources.

[0122] Although the purpose, concept and embodiments of the present invention have been described in detail above, a person skilled in the art will recognize that various improvements and modifications may be made to the present invention without departing from the scope of the claims, and such improvements and modifications shall still fall within the scope of protection of the present invention.

Claims

1. Application of PeERF1 gene in regulating poplar's response to low nitrogen.

2. The use of the PeERF1 gene as claimed in claim 1 in regulating poplar's response to low nitrogen, specifically refers to its use in improving the growth of poplar under low nitrogen conditions.

3. The use of the PeERF1 gene in improving the growth of poplar under low nitrogen conditions as claimed in claim 2, characterized in that: Plants were made to contain the gene PeERF1.

4. The use of the PeERF1 gene in improving the growth of poplar under low nitrogen conditions as claimed in claim 2, characterized in that: The plants were made to overexpress the gene PeERF1 and dominantly suppress the expression of the gene PeERF1.

5. The use of the PeERF1 gene in improving the growth of poplar under low nitrogen conditions as claimed in claim 4, characterized in that: A plant overexpression vector or dominant inhibition expression vector containing the gene PeERF1 was constructed and heterologously transformed into Populus argentatus 84K, and transgenic positive plants were screened. Through phenotypic analysis of positive plants and wild-type plants under different nitrogen treatment conditions, transgenic plants with efficient nitrogen utilization were obtained.

6. The use of the PeERF1 gene in improving the growth of poplar under low nitrogen conditions as claimed in claim 4, characterized in that: The specific steps include: (1) Collect Populus euphratica tissue culture seedlings, extract RNA, reverse transcribe into cDNA, clone the CDS sequence of PeERF1, connect it to pMDC32 vector for sequencing, and after correct identification, construct overexpression vector and dominant inhibition expression vector, and heterologously transform into Populus argentea 84K; (2) The positive plants heterologously transformed with the PeERF1 gene in Populus alba 84K were screened using hygromycin resistance and PCR techniques to obtain transgenic positive plants. RNA was extracted and phenotypic statistics were performed on the transgenic plants. The transgenic plants were treated with different concentrations of nitrogen and their growth was analyzed to obtain transgenic plants with efficient nitrogen utilization.

Images