AcDRT100 protein and application thereof in improving disease resistance of kiwi fruits

Abstract

The invention belongs to the technical field of genetic engineering, and discloses an AcDRT100 protein and application thereof in improving disease resistance of kiwi fruits. The AcDRT100 gene capable of improving the kiwifruit canker resistance is screened out, the gene is subjected to Psa induced up-regulated expression in 'Hongyang' variety kiwifruit, the morbidity condition of the kiwifruit is remarkably relieved, and the plant resistance is improved. Besides, the invention proves that the expression level of disease-resistant pathway genes AcNPR1, AcPR1, AcJAR1 and AcERF1 can be enhanced by transient overexpression of the AcDRT100 gene in the kiwi fruit, and theoretical support is provided for molecular mechanism research of kiwi fruit canker resistance. The invention provides a new insight and idea for creating a high-quality kiwi fruit germplasm material, reducing the dependence on pesticides in prevention and treatment of kiwi fruit canker, improving the quality of kiwi fruits and increasing the yield.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to an AcDRT100 protein and an application thereof in improving the disease resistance of kiwifruit. Background Art

[0002] Kiwifruit (Actinidia chinensis Planch.), also known as kiwi, carambola, and Tengli, is widely popular for its unique taste and nutritional value. It is rich in vitamin C and is known as the "king of fruits". As the origin, evolution, and distribution center of Actinidia plants, China is extremely rich in natural resources, providing rich germplasm resources for the sustainable development of the world's kiwifruit industry. However, the diseases in kiwifruit production are also getting worse year by year. Kiwifruit canker, caused by Pseudomonas syringae pv. actinidiae (Psa), is the most devastating bacterial disease in the kiwifruit industry. The pathogen can infect multiple tissues and organs of kiwifruit, such as trunks, branches, young shoots, leaves, and flowers. In severe cases, it can cause necrosis of the entire tree and destruction of the orchard. However, due to the lack of knowledge about the interaction mechanism between pathogens and plants, the progress of disease-resistant breeding and the development of targeted drugs that can accurately prevent and control diseases have been severely restricted.

[0003] With the continuous development of the kiwifruit industry, bacterial canker has also spread rapidly, causing huge losses to kiwifruit planting and production. The pathogenicity of kiwifruit canker is extremely strong, and no resistant varieties that are completely immune to it have been found in the currently cultivated kiwifruit varieties. There are many kiwifruit varieties with different levels of resistance to canker, which provides an important material basis for the excavation of kiwifruit disease resistance genes. Most of the current research focuses on the screening of resistant germplasm resources and the response of resistance molecular mechanisms. There are few reports on the excavation of kiwifruit resistance and susceptibility genes.

[0004] Using pathogen effector proteins to identify disease resistance-related genes is an effective molecular breeding method for plant disease resistance, providing genes and directions with application potential for kiwifruit Psa resistance breeding, which will be of great significance for the green and efficient prevention and control of kiwifruit canker. Among them, type III secretion system effector protein (T3SE) is a key pathogenic factor of Psa. It is currently an effective means to identify plant target proteins through T3SEs of pathogens, analyze the host disease resistance mechanism and explore disease-resistant breeding materials. A pair of homologous effector proteins HopBB1-1 / HopBB1-2 of kiwifruit canker pathogens can target the DNA damage repair / tolerance protein (DRT) of the host kiwifruit, thereby affecting the resistance of kiwifruit to kiwifruit canker pathogens. The functions and importance of DRT proteins in plants are reflected in maintaining genome stability, responding to external environmental stress, participating in various cellular physiological processes, regulating DNA damage response, promoting DNA double-strand break repair, forming DNA repair bodies, and improving gene targeting efficiency. These functions have a vital impact on plant growth, development, resistance and crop yield.

[0005] However, the specific function of the DRT100 protein (AcDRT100) in kiwifruit has not yet been fully confirmed. Research on the AcDRT100 gene and its role in the disease resistance of kiwifruit canker is expected to provide technical ideas for the exploration of kiwifruit resistance resources and the development of molecular markers. Summary of the invention

[0006] According to the results of qRT-qPCR, the AcDRT100 gene responded to salicylic acid (SA), jasmonic acid (JA), ethylene (ET) and significantly upregulated expression in Psa-infected 'Hongyang' kiwifruit plants, but the specific function of the AcDRT100 gene has not yet been fully confirmed. In view of this, research was conducted on the AcDRT100 gene and its role in the disease resistance process of kiwifruit canker, thereby providing new insights and ideas for the exploration of kiwifruit resistance resources and the development of molecular markers. In order to achieve this technical purpose, the present invention provides the following technical solutions:

[0007] The present invention first provides an AcDRT100 protein, the amino acid sequence of the AcDRT100 protein is shown in SEQ ID NO:1.

[0008] In a second aspect, the present invention seeks to protect the gene encoding the AcDRT100 protein, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0009] In a third aspect, the present invention seeks to protect a recombinant vector comprising the above-mentioned coding gene.

[0010] In a fourth aspect, the present invention seeks protection for a recombinant genetically engineered bacterium, wherein the genetically engineered bacterium contains the above-mentioned recombinant vector.

[0011] In a fifth aspect, the present invention provides an application of the AcDRT100 protein in improving disease resistance of kiwifruit, specifically, the AcDRT100 protein plays a positive regulatory role after kiwifruit is infected with pathogenic bacteria of ulcer disease. In this application, the amino acid sequence of the AcDRT100 protein is shown in SEQ ID NO:1.

[0012] Furthermore, in the above application, the pathogen is Pseudomonas syringae pv. Actinidiae.

[0013] In a sixth aspect, the present invention also provides a method for breeding kiwifruit canker-resistant varieties, the method comprising: transferring the coding gene of the AcDRT100 protein into an expression vector to obtain a recombinant expression vector, and transferring the recombinant expression vector into kiwifruit material.

[0014] Compared with the prior art, the present invention "an AcDRT100 protein and its application in improving disease resistance of kiwifruit" has the following beneficial effects:

[0015] The present invention screens out an AcDRT100 gene that can improve the resistance of kiwifruit to bacterial canker. The gene is upregulated in the 'Hongyang' variety of kiwifruit under the induction of Psa, significantly reducing the incidence of kiwifruit and improving the resistance of the plant. In addition, the present invention has been confirmed by experiments that transient overexpression of the AcDRT100 gene in kiwifruit can enhance the expression levels of the disease resistance pathway genes AcNPR1, AcPR1, AcJAR1, and AcERF1, providing theoretical support for the study of the molecular mechanism of kiwifruit's resistance to bacterial canker.

[0016] The present invention provides new insights and ideas for creating high-quality kiwifruit germplasm materials, reducing dependence on pesticides in the prevention and treatment of kiwifruit bacterial canker, and improving the quality and increasing the yield of kiwifruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the gel electrophoresis image of the AcDRT100 gene. Figure 1 In the figure, AcDRT100-1 and AcDRT100-2 are two PCR amplification product samples.

[0018] Figure 2This is an evolutionary tree of AcDRT100 homologous genes in different species constructed based on the maximum likelihood method (ML).

[0019] Figure 3 It is based on multiple sequence alignment between AcDRT100 homologous genes in different species.

[0020] Figure 4 This is a schematic diagram of the predicted domain structure of the AcDRT100 protein.

[0021] Figure 5 The phenotypic differences after Psa M228 infected the leaves of 'Hongyang' kiwifruit. Figure 5 In the figure, pCAMBIA1302-GFP represents the Agrobacterium infection control containing only the pCAMBIA1302-GFP empty vector; pCAMBIA1302-AcDRT100 represents the Agrobacterium infection containing the recombinant plasmid vector.

[0022] Figure 6 The figures are the statistics of lesion area (left) and relative expression level of AcDRT100 gene (right) after Psa M228 infected the leaves of 'Hongyang' kiwifruit. Figure 6 In the figure, pCAMBIA1302-GFP represents the Agrobacterium infection control containing only the pCAMBIA1302-GFP empty vector; pCAMBIA1302-AcDRT100 represents the Agrobacterium infection containing the recombinant plasmid vector.

[0023] Figure 7 The expression of AcDRT100 gene at different time points after Psa M228 infected the leaves of 'Hongyang' kiwifruit.

[0024] Figure 8 The biomass changes of kiwifruit leaves after Psa M228 infects 'Hongyang'. Figure 8 In the figure, pCAMBIA1302-GFP represents the Agrobacterium infection control containing only the pCAMBIA1302-GFP empty vector; pCAMBIA1302-AcDRT100 represents the Agrobacterium infection containing the recombinant plasmid vector.

[0025] Fig. 9 The expression of defense response-related genes AcNPR1, AcPR1, AcJAR1, and AcERF1 after PsaM228 infected the leaves of 'Hongyang' kiwifruit. Fig. 9 In the figure, pCAMBIA1302-GFP represents the Agrobacterium infection control containing only the pCAMBIA1302-GFP empty vector; pCAMBIA1302-AcDRT100 represents the Agrobacterium infection containing the recombinant plasmid vector. DETAILED DESCRIPTION

[0026] The present invention is explained below in conjunction with the embodiments, and the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] The pCAMBIA1302-GFP vector and various reagents involved in the following examples are all commercially available; the 'Hongyang' kiwifruit variety is cultivated in a greenhouse; the Pseudomonas syringae pv. actinidiae (Psa) M228 strain used in the experiment was isolated and provided by our laboratory.

[0028] Example 1

[0029] This example describes the acquisition of the full-length cDNA sequence of the AcDRT100 gene.

[0030] RNA was extracted from the leaves of 'Hongyang' kiwifruit using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., catalog number: 0416-50); cDNA was obtained using a reverse transcription kit (Thermo Fisher Scientific, catalog number: K1162). The complete coding sequence (CDS) of the kiwifruit DRT100 gene (i.e., AcDRT100 gene) was obtained based on the latest kiwifruit genome (V 3.0), and the full-length primers of the AcDRT100 gene CDS sequence were designed using Primer 5.0 software, and PCR amplification was performed using cDNA as a template. The reaction system is shown in Table 1.

[0031] Table 1. Amplification system of AcDRT100 gene

[0032] Components volume cDNA 2.0μL AcDRT100-F (10 μM) 2.0μL AcDRT100-R (10 μM) 2.0μL 2×PhantaMaxBuffer 25.0μL NTPMix (10 mM each) 1μL PhantaMaxSuper-FidelityDNAPolymerase 1μL <![CDATA[ddH 2 The]]> 19.0μL Total volume 50.0μL

[0033] The PCR amplification program was based on the high-fidelity enzyme used (Nanjing Novozyme Biotechnology Co., Ltd., catalog number: P505) and the optimization during the experiment, specifically: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 58°C annealing for 15 s, 72°C extension for 45 s, 35 cycles; 72°C extension for 5 min, 4°C storage. The agarose gel electrophoresis results of the PCR amplification products are shown in Figure 2. Figure 1 shown.

[0034] Example 2

[0035] This example describes the sequence analysis and homologous evolutionary relationship of the AcDRT100 gene.

[0036] The cDNA sequence of the AcDRT100 gene obtained by PCR gel electrophoresis was consistent with its genomic coding region sequence, with a total length of 1125 bp, encoding 374 amino acids. The homologous genes of this gene in different species were compared using the Phytozome (https: / / phytozome.jgi.doe.gov / ) database, and an evolutionary tree based on the maximum likelihood method (ML) was constructed using MEGAX (see Figure 2 ). It was found that the AcDRT100 gene was evolutionarily distantly related to the reported DNA-damage-repair / tolerationprotein DRT100-like (DRT100) gene of Arabidopsis thaliana (L.) Heynh., and it was inferred that the gene was a newly discovered gene in kiwifruit.

[0037] By multiple sequence alignment (see Figure 3 ) and NCBI (National Center for Biotechnology Information) CD search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) conservative domain analysis found that the AcDRT100 gene has a repeated LRR domain. The LRR domain is shown in Figure 4 The nucleotide sequence of the AcDRT100 gene is shown in SEQ ID NO:2, and the amino acid sequence of the protein encoded by the AcDRT100 gene is shown in SEQ ID NO:1.

[0038] Example 3

[0039] This example describes the analysis of transient expression of the AcDRT100 gene.

[0040] 1. Construction of recombinant expression vector

[0041] The pCAMBIA1302-GFP vector comes with a GFP marker gene. The target gene is inserted behind the 35S promoter, which satisfies the functions of subcellular localization and gene overexpression. Therefore, this vector is selected for constructing a recombinant expression vector. Based on the available restriction sites (NcoI and SpeI) of the pCAMBIA1302-GFP vector, homology arm primers were designed using SnapGene software (https: / / www.snapgene.com / ). The primer sequences used to construct the recombinant expression vector are:

[0042] AcDRT100-SpeI-F:

[0043] TTGGAGAGGACACGCTCGAGATGGAGGTACTATTATTCAGCTCTA (SEQ ID NO: 3);

[0044] AcDRT100-NcoI-R:

[0045] CGCCCTTCGACATAAGCTTTAGAGCTGAATAATAGTACCTCCAT (SEQ ID NO: 4).

[0046] Use the primer pair with homologous restriction sites to re-PCR amplify the target gene fragment, purify it and measure its concentration. The amplification system is shown in Table 2.

[0047] Table 2. Amplification system of recombinant expression vector

[0048] Components volume cDNA 2.0μL AcDRT100-SpeI-F (10 μM) 2.0μL AcDRT100-NcoI-R (10 μM) 2.0μL 2×PhantaMaxBuffer 25.0μL NTPMix (10 mM each) 1μL PhantaMaxSuper-FidelityDNAPolymerase 1μL <![CDATA[ddH 2 The]]> 19.0μL Total volume 50.0μL

[0049] At the same time, after the E. coli containing the pCAMBIA1302-GFP empty vector was activated, the plasmid was extracted by shaking bacteria, and the concentration was detected and double enzyme digestion was performed. The double enzyme digestion system is shown in Table 3.

[0050] Table 3. Plasmid double restriction enzyme digestion system

[0051] pCAMBIA1302-GFP plasmid vector 1.0 μg SpeI 1.0μL NcoI 1.0μL 10×GreenBuffer 2.0μL <![CDATA[ddH 2 The]]> Make up to a total volume of 20.0 μL

[0052] Double enzyme digestion conditions: digestion at 37°C for 1h in a water bath, and then inactivate the enzyme at 85°C for 10min. Detection was performed by 1.0% agarose gel electrophoresis, and the target fragment was purified and recovered (Shanghai Maigen Biotechnology Co., Ltd., catalog number: D2111-03). According to the software (CE Design V1.04) provided by Novozyme, the amount of AcDRT100 gene fragment and linearized pCAMBIA1302-GFP plasmid vector was calculated, and the two were connected to obtain the recombinant pCAMBIA1302-AcDRT100 plasmid vector (length 1686bp). The connection system is shown in Table 4.

[0053] Table 4. Connection system

[0054] Linearized pCAMBIA1302-GFP plasmid vector 1.0 μg AcDRT100 gene fragment 1.0μL 5×CEIIBuffer 1.0μL Exnase 2.0μL <![CDATA[ddH 2 The]]> Make up to a total volume of 20.0 μL

[0055] Note: Exnase and 5×CE II Buffer were purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: C112.

[0056] The mixture was placed in a PCR instrument at 37°C for 30 minutes, and then transformed into E. coli competent cells DH5α (Beijing Qingke Biotechnology Co., Ltd., catalog number: TSC-C14), and recombinant E. coli screening and sequencing verification were performed.

[0057] 2. Transformation of recombinant expression vector into Agrobacterium

[0058] 0.5 μL of the recombinant E. coli culture was verified by sequencing and cultured in 5 mL LB / Spe+ liquid medium at 37°C and 200 rpm overnight. The pCAMBIA1302-AcDRT100 plasmid vector in E. coli was extracted using a plasmid recovery kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd., catalog number: ZPK101-3) and transformed into Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1001). After culturing for about 48 hours, a single colony was picked and placed in LB liquid medium (containing kanamycin and rifampicin), and the culture was shaken at 28°C and 220 rpm until the OD of the culture solution reached 0. 600 =0.6~0.8, and obtain Agrobacterium carrying the recombinant plasmid vector.

[0059] 3. Transient overexpression of target gene

[0060] (1) Disinfection: Take normal-sized and spot-free 'Hongyang' kiwifruit leaves, which were grown in the greenhouse of Northwest Agriculture and Forestry University. Place the collected leaves in a foam box, first soak them in 0.06% sodium hypochlorite (NaClO) in the dark for 5 minutes, then wash them twice with sterile water until there is no pungent odor, soaking for 1 minute before each wash. Then use sterile filter paper to absorb excess water on the surface of the leaves.

[0061] (2) Leaf disc extraction: Place the treated leaves on sterile filter paper and use a sterile puncher with a pore size of 1 cm to extract leaf discs. Be careful to avoid the main veins and lateral veins of the leaves when punching leaf discs.

[0062] (3) Agrobacterium infection: Collect the Agrobacterium carrying the recombinant plasmid vector cultured in step 2 and inoculate with 10 mM MgCl 2 Wash twice and then infect with Agrobacterium infection solution (0.2 mM acetosyringone (AS), 10 mM MgCl 2 , 10mM MES with pH=5.6 (KOH to adjust pH), then place the beaten leaf disc in a 50mL centrifuge tube containing bacterial suspension and mix well to make the leaf disc fully contact with Agrobacterium bacterial suspension. Use vacuum method (0.2Mpa, 15min) to make it fully immersed in the leaf disc. Then take out the leaf disc, dry the surface water, place it on 0.08% water agar, and place it in a 28℃ incubator for 48h. Take the Agrobacterium infection containing pCAMBIA1302-GFP empty vector as the control, and the rest of the treatment steps are the same.

[0063] (4) Inoculation of Psa: 20 μL of Psa M228 bacterial solution stored at ultra-low temperature was aspirated and inoculated onto LB solid medium using the plate streak method in an ultra-clean workbench. After activation and culture at 28°C for 2 days, a single colony was randomly selected and inoculated into LB liquid medium. The culture was shaken at 28°C and 220 rpm for 14 h until the OD 600 =0.6. The obtained bacterial suspension was centrifuged at 8000 rpm for 10 min, the bacterial precipitate was collected, the bacterial cells were washed with sterile water 3 times, and then pipetted and mixed. The concentration of the bacterial suspension was measured using a spectrophotometer. The concentration of the bacterial suspension was adjusted to OD 600 =0.1, collect the cells and dilute to a final concentration of 1×10 5 CFU / mL. The vacuum method was also used to infect kiwifruit leaves with PsaM228.

[0064] 4. Analysis of transient overexpression results of target gene

[0065] (1) Statistics of leaf disease and AcDRT100 gene expression

[0066] After Psa M228 was infected into kiwifruit leaves using the above method, the leaves were placed in a 16°C incubator for about 5 days, photos were taken to observe the disease condition of the leaves after Psa M228 infection, and the lesion area was counted. In addition, the relative expression level of the AcDRT100 gene was counted. Figure 5 The phenotypic differences after Psa M228 infected the leaves of 'Hongyang' kiwifruit. Figure 6 The figures are the statistics of lesion area (left) and relative expression level of AcDRT100 gene (right) after Psa M228 infected the leaves of 'Hongyang' kiwifruit. Figures 5-6 The results showed that after inoculation with Psa M228, the disease of the 'Hongyang' kiwifruit leaves overexpressing the AcDRT100 gene was alleviated, the lesion area was significantly reduced, and the relative expression level of the AcDRT100 gene was increased, indicating that the disease resistance of the kiwifruit material to Psa was improved after transient overexpression of the AcDRT100 gene.

[0067] (2) Temporal expression characteristics of the AcDRT100 gene during Psa infection

[0068] Samples were taken at 0h, 12h, 24h, 48h, 72h, 96h and 120h after Psa M228 infection, RNA was extracted from kiwifruit leaves and cDNA was obtained using a reverse transcription kit. These cDNAs were used for qRT-PCR to detect the expression of the AcDRT100 gene. Figure 7 The expression of AcDRT100 gene at different time points after PsaM228 infected the leaves of 'Hongyang' kiwifruit. Figure 7It can be seen that the expression of AcDRT100 gene was significantly upregulated after induction by Psa M228, and the expression level was highest at 48h.

[0069] (3) Calculation of pathogen biomass on leaf disks after Psa infection

[0070] Take 3 leaf discs infected with Psa M228 for 5 days, disinfect the surface with 0.6% NaClO for 30 seconds, wash with sterile water 3 times, disinfect the surface with 75% alcohol for 30 seconds, wash with sterile water 3 times, and then use sterile filter paper to absorb the moisture on the surface of the leaf disc. Place the dried leaf disc in a sterile mortar prepared in advance, add 1 mL of sterile water and grind it. After grinding into a homogenate, let it stand for 10 minutes, and then make a 10-fold gradient dilution. Take 50 μL of the dilution and spread it on LB solid culture medium containing 50 μg / mL kanamycin, then invert it in a 28°C incubator. After 4 days of incubation, use ultraviolet light to irradiate and count the colonies with green fluorescence. There are 3 biological replicates for each treatment. Figure 8 The biomass changes of kiwifruit leaves after Psa M228 infects 'Hongyang'. Figure 8 The results showed that the biomass of PsaM228 was significantly decreased after overexpression of the AcDRT100 gene.

[0071] (4) Expression of immune-related genes in leaf discs after Psa infection

[0072] The salicylic acid (SA) pathway genes NPR1 and PR1, the jasmonic acid (JA) pathway gene JAR1, and the ethylene (ET) pathway gene ERF in Arabidopsis were compared in the kiwifruit database to obtain the corresponding homologous genes of kiwifruit: AcNPR1, AcPR1, AcJAR1, and AcERF1. NCBI Primerblast was used to design qRT-PCR specific primers for these genes, and their specificity was verified to ensure accurate amplification results. The cDNA of the leaf disc 1 day after inoculation with Psa M228 was used as a template to detect the expression of the above 4 genes. The reaction system was based on ChamQ qPCRMasterMix instruction manual, Actin was used as the internal reference gene, and the 2-ΔΔT method was used to calculate the relative expression of each gene to analyze the expression of immune-related genes. Three biological replicates were performed.

[0073] Fig. 9 The expression of defense response-related genes AcNPR1, AcPR1, AcJAR1, and AcERF1 after PsaM228 infected the leaves of 'Hongyang' kiwifruit. Fig. 9 The results showed that after Psa induction, the expression levels of defense response-related genes were significantly upregulated.

[0074] In summary, the present invention screened out an AcDRT100 gene that can improve the resistance of kiwifruit to bacterial canker. The gene was upregulated in the 'Hongyang' variety of kiwifruit under the induction of Psa, which significantly reduced the incidence of kiwifruit and improved the resistance of the plant. In addition, the present invention has been confirmed by experiments that transient overexpression of the AcDRT100 gene in kiwifruit can enhance the expression levels of the disease resistance pathway genes AcNPR1, AcPR1, AcJAR1, and AcERF1, providing theoretical support for the study of the molecular mechanism of kiwifruit resistance to bacterial canker. The present invention provides new insights and ideas for creating high-quality kiwifruit germplasm materials, reducing the dependence on pesticides in the prevention and control of kiwifruit bacterial canker, and improving the quality and yield of kiwifruit.

[0075] The embodiments described above are only some embodiments of the present invention, not all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. An AcDRT100 protein, characterized in that The amino acid sequence of the AcDRT100 protein is shown in SEQ ID NO:

1.

2. The gene encoding the AcDRT100 protein according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the AcDRT100 protein is shown in SEQ ID NO:

2.

3. A recombinant vector, characterized in that: The recombinant vector contains the coding gene according to claim 2.

4. A recombinant genetically engineered bacterium, characterized in that: The genetically engineered bacteria contains the recombinant vector according to claim 3.

5. The application of AcDRT100 protein in improving disease resistance of kiwifruit, characterized in that: The AcDRT100 protein plays a positive regulatory role after kiwifruit is infected with the pathogen of ulcer disease; The amino acid sequence of the AcDRT100 protein is shown in SEQ ID NO:

1.

6. The use according to claim 5, characterized in that: The pathogen is Pseudomonas syringaepv. Actinidiae.

7. A method for breeding kiwifruit canker-resistant varieties, characterized in that: The method comprises: The coding gene of the AcDRT100 protein according to claim 1 is transferred into an expression vector to obtain a recombinant expression vector, and the recombinant expression vector is transferred into kiwifruit material.

Images