Method for knocking down or overexpressing PDK4 gene of BV2 microglial cell by lentivirus technology and application of method in ferroptosis research
By using lentiviral technology to knock down or overexpress the PDK4 gene in BV2 microglia, the problems of instability and high cost of gene knockdown in the prior art have been solved, and stable gene expression and in-depth functional research have been achieved.
Patent Information
- Application Number
- CN202411608722.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-12
- Publication Date
- 2025-02-11
AI Technical Summary
In the prior art, siRNA gene knockdown technology has problems such as unstable performance, high cost and poor cell line gene stability, which limits the in-depth study of PDK4 function.
Lentiviral technology was used to design shRNA sequences or cDNA sequences, build lentiviral vectors, and cell lines that were stably low-expressed or overexpressed PDK4 were obtained by infecting BV2 microglia and screening for puromycin.
The stable knockdown or overexpression of PDK4 genes in BV2 microglia has been achieved, which has improved the accuracy and repeatability of the experiment, and has provided a powerful study on the mechanism of action of PDK4 in ferrodys and neurodegenerative diseases. tool.
Smart Images
Figure CN119410715A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology and cell biology, and in particular to a method for knocking down or overexpressing a BV2 microglial PDK4 gene by using a lentiviral technique and an application thereof in ferroptosis research. Background Art
[0002] Pyruvate dehydrogenase kinase 4 (PDK4) plays an important role in cellular energy metabolism, mainly regulating the balance between glycolysis and fatty acid oxidation by inhibiting the activity of pyruvate dehydrogenase. As immune cells of the central nervous system, microglia are highly sensitive to changes in the neural environment. PDK4 not only has the function of regulating microglial metabolism, but may also be involved in the occurrence and development of neuroinflammatory and neurodegenerative diseases. In a high glucose environment, microglia usually increase the use of glucose to adapt to environmental changes, which is manifested as increased glycolysis, increased fatty acid synthesis, and inhibited fatty acid oxidation, leading to an imbalance in energy metabolism. In addition, high sugar causes an increase in the level of oxidative stress in microglia, thereby damaging cell function. In this process, the expression of PDK4 is upregulated, which inhibits the activity of pyruvate dehydrogenase, reduces the conversion of pyruvate to acetyl-CoA, and reduces the rate at which the glycolysis product, i.e., pyruvate, flows into the tricarboxylic acid cycle, thereby inhibiting fatty acid synthesis and promoting fatty acid oxidation. This regulation helps microglia maintain metabolic homeostasis in a high glucose environment, reduce oxidative damage, and maintain cell function.
[0003] Ferroptosis is a type of cell death that is dependent on iron. It mainly causes cell death through iron-catalyzed lipid peroxidation, especially the oxidation products of polyunsaturated fatty acids (PUFA). Glutathione peroxidase 4 (GPX4) is a key antioxidant enzyme that inhibits ferroptosis and can effectively reduce the accumulation of lipid peroxides. The absence or dysfunction of GPX4 will lead to increased peroxidation of intracellular PUFA, thereby promoting ferroptosis. Malondialdehyde (MDA) is a decomposition product of lipid peroxidation and is often used as a marker of oxidative stress. Its increased level indicates the degree of cellular oxidative damage and lipid peroxidation. Therefore, the determination of MDA can be used to assess the oxidative stress status of cells or tissues.
[0004] Studies have shown that PDK4 may play an important role in regulating intracellular iron homeostasis and oxidative stress. By affecting iron metabolism and antioxidant mechanisms, PDK4 may play a key role in ferroptosis. Therefore, exploring the role of PDK4 in BV2 microglia, especially the specific mechanism in ferroptosis research, will provide a new perspective for understanding neurodegenerative diseases and other related pathological conditions.
[0005] Defects and shortcomings of the prior art: The commonly used siRNA gene knockdown technology currently has problems such as unstable performance, high cost and poor gene stability of cell lines. These defects may limit the in-depth study of the function of PDK4. Therefore, the development of more effective and stable gene regulation methods, such as lentivirus-mediated gene knockdown or overexpression, will provide a more reliable tool for studying the biological function of PDK4. Summary of the invention
[0006] To address the deficiencies in the prior art, the present invention provides a method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology and its application in ferroptosis research, thereby obtaining a cell line that stably underexpresses or overexpresses PDK4, and systematically studying its role in ferroptosis.
[0007] In order to achieve the purpose of the present invention, the following scheme is proposed: A method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology, comprising the following steps: The full-length sequence of the mouse PDK4 gene was used to design shRNA sequences for gene knockdown, or cDNA sequences for gene overexpression; Constructing a lentiviral vector containing shRNA sequence or cDNA sequence, the vector carries green fluorescent protein GFP and puromycin resistance gene; then packaging and purifying the lentiviral vector; BV2 microglial cells were obtained and cultured; BV2 microglial cells were infected with lentivirus, and BV2 microglial cell lines with stable knockdown or stable overexpression of PDK4 gene were obtained through puromycin selection.
[0008] Furthermore, during lentiviral packaging and purification, the constructed lentiviral vector was transfected into 293T cell line.
[0009] Furthermore, BV2 microglia cells were infected with lentivirus for 72 h and then selected with 6 µg / mL puromycin.
[0010] Furthermore, when lentivirus was used to infect BV2 microglia cells, 20 μL of 25×HiTransG P infection enhancement solution was added.
[0011] Furthermore, the culture medium used for culturing BV2 microglia was DMEM (containing 25 mM glucose) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin; the incubator environment was set at 37°C, 95% humidity, and 5% CO2.
[0012] A PDK4 gene knockdown BV2 microglial cell line is obtained by using the above method.
[0013] A BV2 microglial cell line overexpressing the PDK4 gene is obtained by using the above method.
[0014] The application of BV2 microglial cell line with PDK4 gene knockdown in ferroptosis research is used to reduce GPX4 protein expression.
[0015] The application of BV2 microglial cell line overexpressing PDK4 gene in ferroptosis research is used to promote GPX4 protein expression and effectively reverse the effect of high glucose on GPX4.
[0016] The beneficial effects of the present invention are: 1. Compared with traditional gene transfection methods, lentivirus can effectively infect dividing and non-dividing cells, achieve stable gene expression in a variety of cell types, and is particularly suitable for microglia that are difficult to transfect. This technology ensures long-term stable gene expression by integrating the target gene into the host cell genome, making it easier to study the long-term effects of gene function. At the same time, lentivirus is suitable for a variety of cell types and animal models, providing a flexible application platform for the study of neurological diseases.
[0017] 2. When studying the function of PDK4 in BV2 microglia, the use of lentiviral technology can effectively achieve specific knockdown and overexpression of PDK4, thereby deeply exploring its mechanism of action in ferroptosis and neurodegenerative diseases. This method not only improves the accuracy and repeatability of the experiment, but also provides a powerful tool for understanding the role of PDK4 in disease development. Combining lentiviral technology with other cell biology and molecular biology methods, researchers can more comprehensively reveal the biological functions of PDK4 and its potential application value in neurological diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 In the figure, 1A is the green fluorescence and white light images of PDK4 knockdown cells and PDK4 overexpression cells after puromycin selection; 1B is the PDK4 expression level of PDK4 knockdown cells detected by qPCR; 1C is the PDK4 expression level of PDK4 overexpression cells detected by qPCR; Figure 2In the figure, 2A is the Western Blot detection result after PDK4 knockdown; 2B is the corresponding PDK4 expression level in PDK4 knockdown cells; 2C is the Western Blot detection result after PDK4 overexpression; 2D is the corresponding PDK4 expression level in PDK4 overexpression cells; Figure 3 In the figure, 3A is a graph showing the MDA content levels in different groups; 3B is a graph showing the PUFA concentrations in different groups; 3C is a graph showing the Western Blot detection results of GPX4 in different groups; 3D is a graph showing the GPX4 expression levels in different groups; Figure 4 In the figure, 4A is a graph showing the expression of PDK4 in different groups detected by qPCR; 4B is a graph showing the results of Western Blot detection of PDK4 in different groups; 4C is a graph showing the expression of PDK4 in different groups detected by Western Blot; Figure 5 5A is the Western Blot detection result of GPX4 after BV2 overexpression and PDK4 knockdown and high glucose treatment; 5B is the GPX4 expression level diagram of the corresponding group. DETAILED DESCRIPTION
[0019] Example 1 Preparation of mouse PDK4 gene knockdown and overexpression lentivirus S1. Gene sequence acquisition First, the full-length sequence of the mouse PDK4 gene (Gene ID: 18534) was queried through the NCBI database to design appropriate shRNA sequences for gene knockdown or cDNA sequences for gene overexpression. Ensure that the obtained sequence is accurate and confirm the integrity and accuracy of the gene sequence through multiple comparisons.
[0020] S2. Vector selection For gene knockdown, a lentiviral vector containing the shRNA sequence and carrying green fluorescent protein (GFP) and puromycin resistance genes was used as a screening and labeling tool; for gene overexpression, a lentiviral vector carrying the full-length PDK4 gene cDNA was selected, which also contained GFP and puromycin resistance genes for post-transfection screening and cell labeling.
[0021] S3. Virus packaging and purification After the vector construction is completed, the virus packaging and purification is completed by GeneCare Genetics. The specific steps are as follows: the constructed vector is transfected into the 293T cell line, and the cells secrete virus particles; after the virus particles are collected, the virus is purified by ultracentrifugation or gradient centrifugation to ensure that a high-purity virus sample is obtained.
[0022] S4. Virus titer detection After the virus is packaged and purified, its titer is tested to determine its infection efficiency. Titer determination is usually performed using methods such as real-time quantitative PCR or ELISA. By calculating the number of virus particles contained in each milliliter of virus liquid (i.e., TU / mL), accurate virus dosage information is provided for subsequent cell infection experiments. The titer result ensures that the MOI value can be accurately calculated in subsequent experiments to ensure the repeatability and reliability of the experiment.
[0023] Through this implementation scheme, mouse PDK4 gene knockdown or overexpression lentivirus can be successfully prepared and ensure that subsequent cell infection experiments achieve the expected results.
[0024] Example 2 Lentivirus infection of BV2 microglia In this example, BV2 microglia were purchased from Zhejiang Meisen Cell Technology Co., Ltd. The cells used in the experiment were kept within 10 generations and cultured in DMEM (containing 25 mM glucose) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The incubator environment was set at 37°C, 95% humidity, and 5% CO2 to ensure optimal growth conditions for the cells.
[0025] S1. Cell recovery After taking the cell cryovial out of the liquid nitrogen tank, immediately place it in a 37°C water bath and continue to gently shake the cryovial to ensure that the cells are thawed evenly and quickly. The whole process should be controlled within 1-2 minutes until only pea-sized ice cubes remain in the cryovial. After thawing, wipe the surface of the cryovial with 75% alcohol for disinfection. Then, in the biosafety cabinet, quickly transfer the cell suspension to a 15 mL centrifuge tube containing pre-warmed complete medium. Centrifuge at 1000 rpm for 5 minutes to pellet the cells. Carefully discard the supernatant, then resuspend the precipitated cells in fresh pre-warmed complete medium, gently pipetting to ensure a uniform cell suspension. Transfer the cell suspension to a T25 culture flask, add 5 mL of complete medium, and place the culture flask in a 37°C, 5% CO2 incubator. Within 24 hours after recovery, observe the cell adhesion, replace with fresh culture medium, and remove cryoprotectant and cell debris.
[0026] S2. Cell passaging Observe the cell status and density under a microscope. When the cell confluence reaches 80%-90%, discard the old culture medium. Add 1 mL of preheated PBS or fresh culture medium and gently scrape the cell layer with a cell scraper. Collect the scraped cell suspension into a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes to precipitate the cells. After discarding the supernatant, add 1 mL of fresh complete culture medium to resuspend the cells, and transfer the cells to three new T25 culture flasks at a ratio of 1:3, add an appropriate amount of culture medium, and continue culturing.
[0027] S3. Cell seeding When the cell confluence reaches 80%-90% again, discard the old culture medium, gently scrape the cell layer with 1 mL of preheated culture medium, and collect the cell suspension into a 15 mL centrifuge tube. After centrifugation at 1000 rpm for 5 minutes, discard the supernatant and resuspend the cells in 1 mL of fresh culture medium. Use Trypan Blue staining to count cells and dilute to 4000 cells / mL cell suspension as needed. Then inoculate 1 mL of cell suspension / well in a 12-well plate and culture in an incubator at 37°C and 5% CO2.
[0028] S4. Cell infection 24 hours after cell inoculation, observe the cell adhesion and discard the old culture medium. Add 500 µL of fresh complete culture medium and 20 µL of 25×HiTransG P infection enhancement solution. Calculate the required amount of virus according to the set MOI value and virus titer. The calculation formula is as follows: Virus volume = (MOI × number of cells) / virus titer. Add the virus to the culture dish and incubate at 37°C for 16 hours. After infection, discard the old culture medium and replace it with fresh complete culture medium. Continue to culture, and change the culture medium once a day. After 72 hours of infection, observe the infection efficiency, and subculture the successfully infected cells into T25 culture flasks and continue to culture.
[0029] S5. Screening of successfully transfected cells 72 hours after infection, puromycin selection solution with a final concentration of 6 µg / mL was added to start screening for successfully transfected cells. Through continuous puromycin selection, BV2 microglial cell lines with stable knockdown or stable overexpression of the PDK4 gene were finally obtained.
[0030] Example 3 Identification of PDK4 gene knockdown and PDK4 gene overexpression efficiency in mouse BV2 microglia 1. qPCR identification of PDK4 gene knockdown or expression ① RNA extraction When BV2 microglia cells grew to 80%-90% confluence, cell pellets were collected and total RNA was extracted using RNAiso Plus (Takara, 9109) reagent according to the manufacturer's instructions, and the quality of RNA extraction was ensured by gel electrophoresis or spectrophotometer.
[0031] ② Reverse transcription The extracted RNA was reverse transcribed into cDNA using PrimeScript™ RT Reagent Kit (Perfect Real Time) (Takara, RR037A) with the following reaction conditions: Reverse transcription reaction: 37°C, 15 minutes; Reverse transcriptase inactivation reaction: 85°C, 5 seconds; The reaction was terminated at 4°C.
[0032] ③ qPCR reaction Real-time quantitative PCR (qPCR) amplification was performed using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara, RR820A). The specific primers for the PDK4 gene are as follows: - Forward Primer: F:AAACCCAAGCCACATTGGAAGTA - Reverse Primer: R: CGCAGAGCATCTTTGCACAC The internal reference gene was β-actin, and its primer sequences were as follows: - Forward primer: F: CCTCACTGTCCACCTTCC-3 - Reverse primer: R: GGGTGTAAAACGCAGCTC-3 qPCR cycling conditions were as follows: Step 1: 95℃ for 30 seconds (initial denaturation); Step 2: 95°C for 5 seconds, 60°C for 30 seconds, 40 cycles (annealing and extension); Step 3: Melting curve analysis is used to confirm the specificity of the amplified product.
[0033] qPCR reactions were performed on a CFX96 Real-Time Detection System (Bio-Rad), and data acquisition and analysis were performed using the software provided with the instrument.
[0034] ④ Data analysis The ΔΔCt method was used to analyze gene expression changes. The expression levels of the PDK4 gene in the knockdown group or overexpression group relative to the control group were standardized and analyzed, and the internal reference gene was β-actin. The results showed that the mRNA expression of the PDK4 gene in the knockdown group was significantly lower than that in the control group, while it was significantly increased in the overexpression group.
[0035] 2. Western Blot Identification of PDK4 Protein Expression ① Protein extraction The cells were lysed with RIPA lysis buffer (Biyuntian, P0013B) to extract total protein. The protein concentration was quantified using the BCA method (Glpbio, GK10009) to ensure that the protein content of different samples was consistent.
[0036] ② SDS-PAGE electrophoresis and membrane transfer Equal amounts of protein samples (determined by quantification results) were loaded onto SDS-PAGE gels. After electrophoretic separation, the proteins were transferred to PVDF membranes by wet transfer.
[0037] ③ Antibody incubation The membrane was incubated with a specific primary antibody for PDK4 (Abmart, PS03577S) at 4°C overnight. Subsequently, the membrane was incubated with an HRP-labeled secondary antibody (Abbkine, A21020) at room temperature for 1 hour. The internal reference protein was β-actin (Zhengneng, 380624).
[0038] ④ Signal detection Protein expression was detected using ECL chemiluminescence (Abbkine, BMU102), and the luminescent bands were scanned and recorded using a chemiluminescence imager. ImageJ software was used to quantitatively analyze the grayscale values of the protein bands and compare the relative expression levels of PDK4 in different experimental groups. The PDK4 protein expression in the knockdown group should be significantly lower than that in the control group, while the PDK4 protein expression in the overexpression group should be significantly higher than that in the control group.
[0039] 3. Experimental Results Observation under a fluorescence microscope showed that in the transfected BV2 microglia selected by puromycin, cells with successful knockdown or overexpression all showed green fluorescence (e.g. Figure 1 A).
[0040] The qPCR results showed that the mRNA expression of PDK4 gene in the knockdown group was significantly lower than that in the control group (e.g. Figure 1 B), while the PDK4 mRNA level in the overexpression group increased significantly (as shown in Figure 1 C). Western Blot results showed that the expression level of PDK4 protein in the knockdown group was significantly lower than that in the control group (e.g. Figure 2 A, 2B), while the PDK4 protein expression in the overexpression group was significantly increased (as shown in Figure 2 C, as shown in 2D).
[0041] Western Blot results were consistent with qPCR data, further verifying the successful knockdown or overexpression of the PDK4 gene.
[0042] Example 4 Application of PDK4 gene in high glucose-induced ferroptosis of microglia 1. Figure 3 In the experiment, Fac was treated with ammonium ferric citrate; HG-FAC was treated with high glucose + ammonium ferric citrate; Erastin was treated with ferroptosis inducer; HG-FAC+Fer-1 was treated with high glucose + ammonium ferric citrate + ferroptosis inhibitor. Ferroptosis is a form of cell death that is iron-dependent. Low-dose iron does not cause ferroptosis, so low-dose iron (5 mg / L Fac) was used in the experiment.
[0043] High glucose treatment caused an increase in MDA content in BV2 microglia (e.g. Figure 3 A), increased PUFA levels (such as Figure 3 B), GPX4 expression decreased (as shown in Figure 3 C, 3D), which is similar to the changes caused by the ferroptosis inducer Erastin, and the ferroptosis inhibitor Ferrostatin-1 (Fer-1) can inhibit this change (as shown in Figure 3 C and 3D), suggesting that BV2 microglia may undergo ferroptosis under high glucose conditions.
[0044] 2. qPCR showed that high glucose caused an increase in the mRNA level of PDK4 in BV2 microglia (e.g. Figure 4 Similarly, Western Blot showed that PDK4 protein levels were increased (as shown in Figure 4 B, 4C). PDK4 can reduce the conversion of glucose to fatty acid synthesis by inhibiting the activity of pyruvate dehydrogenase. Upregulation of PDK4 promotes fatty acid oxidation, thereby inhibiting the synthesis of polyunsaturated fatty acids (PUFA).
[0045] 3. Western Blot results showed that GPX4 protein expression was significantly reduced under high glucose conditions, indicating that high glucose environment inhibits GPX4. PDK4 overexpression can not only promote GPX4 expression, but also effectively reverse the effect of high glucose on GPX4, making its GPX4 level significantly higher than that of the high glucose group. On the contrary, PDK4 knockdown led to a significant decrease in GPX4 protein expression, a result similar to the decrease in GPX4 caused by high glucose. Under high glucose conditions, GPX4 was also reduced in the PDK4 knockdown group (e.g. Figure 5 A, 5B).
[0046] In summary, overexpression of PDK4 can effectively rescue the decrease of GPX4 caused by high glucose, while knockdown of PDK4 leads to a significant decrease of GPX4, indicating the important role of PDK4 in regulating ferroptosis.
[0047] The above embodiments are only used to illustrate the technical ideas and features of the present invention, and are not intended to be the only or limit the present invention. It should be understood by those skilled in the art that various changes or equivalent substitutions made to the present invention without departing from the scope of the present invention all fall within the scope of protection of the present invention.
Claims
1. A method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology, characterized in that: The following steps are involved: The full-length sequence of the mouse PDK4 gene was used to design shRNA sequences for gene knockdown, or cDNA sequences for gene overexpression; Constructing a lentiviral vector containing shRNA sequence or cDNA sequence, the vector carries green fluorescent protein GFP and puromycin resistance gene; then packaging and purifying the lentiviral vector; BV2 microglial cells were obtained and cultured; BV2 microglial cells were infected with lentivirus, and BV2 microglial cell lines with stable knockdown or stable overexpression of PDK4 gene were obtained through puromycin selection.
2. The method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology according to claim 1, characterized in that: During lentiviral packaging and purification, the constructed lentiviral vector was transfected into 293T cell line.
3. The method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology according to claim 1, characterized in that: BV2 microglial cells were infected with lentivirus for 72 hours and then selected with 6 µg / mL puromycin.
4. The method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology according to claim 1, characterized in that: When infecting BV2 microglia with lentivirus, add 20 µL of 25×HiTransG P infection enhancement solution.
5. The method for knocking down or overexpressing the PDK4 gene in BV2 microglia using lentiviral technology according to claim 1, characterized in that: The culture medium used for culturing BV2 microglia cells was DMEM (containing 25 mM glucose) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin; the incubator environment was set at 37°C, 95% humidity, and 5% CO2.
6. A BV2 microglial cell line with PDK4 gene knockdown, characterized in that: The method according to any one of claims 1 to 5 is used to obtain the 7. A BV2 microglial cell line overexpressing the PDK4 gene, characterized in that: The method according to any one of claims 1 to 5 is used to obtain the 8. Application of BV2 microglial cell line with knockdown of PDK4 gene in ferroptosis research, characterized in that: Used to reduce GPX4 protein expression.
9. Application of the BV2 microglial cell line overexpressing the PDK4 gene in ferroptosis research, characterized in that: Used to promote the protein expression of GPX4 and effectively reverse the effect of high sugar on GPX4.