SNP (Single Nucleotide Polymorphism) molecular marker related to pig total nipple number character and application

Abstract

The invention provides an application of an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig total nipple number character. The SNP molecular marker sites related to the total nipple number character of the high-generation cross-bred resource population of the large white pigs and the fortune fortune pigs are screened out through genome-wide association analysis (GWAS). The sites of the SNP molecular marker are respectively located on a TTC17 gene segment (2: 18782565) of a pig chromosome 2, the specific nucleotide sequence is as shown in SEQ ID NO.1, W at the 501bp is A or T, and the mutation leads to the A / T polymorphism of the molecular marker. The invention provides a new SNP molecular marker resource for the genetic improvement of the pig total nipple number character, can be applied to marker-assisted selection of pig genetic breeding, and is used for breeding sow varieties with more nipples.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a SNP molecular marker related to the total nipple number trait on pig chromosome 2 and an application thereof. Background Art

[0002] The total number of nipples in pigs is an indicator of the sow's lactation ability. It is an important reproductive trait that has a direct impact on the reproductive efficiency and economic benefits of the pig herd. The total number of nipples of a sow is directly related to the number of piglets that survive during the lactation period, thereby affecting the survival rate and growth and development of the piglets. The total number of nipples has a strong correlation with the reproductive performance of sows and the growth performance of offspring. The more total nipples, the higher the sow's lactation ability and piglet survival rate. Therefore, studying and improving the total number of nipples in pigs has important research and practical significance in improving reproductive efficiency and economic benefits. Among them, molecular marker-assisted selection is an effective method to improve the total number of nipples in pigs, but it is not clear which gene is related to the total number of nipples in pigs and what the specific relationship is.

[0003] The present invention is based on the high-generation cross-bred resource population of Large White Pig × Tongcheng Pig cultivated by the applicant's research group. The whole genome genetic variation was obtained by resequencing and the whole genome association study (GWAS) of the total nipple number trait was performed. A SNP molecular marker affecting the pig nipple number trait was identified on chromosome 2. At present, some of the above findings have not been reported. TTC17 gene expression is negatively correlated in breast cancer, and its absence or low expression is a key factor in promoting breast cancer metastasis (Zhang et al., 2023). Therefore, a SNP marker-assisted selection method of the present invention has potential important value for improving pig reproductive traits. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP molecular marker related to the total nipple number trait of pigs and its application.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A SNP molecular marker associated with the total teat number trait of a pig, wherein the SNP molecular markers are located at bases 18782565 of chromosome 2 of the pig genome version 11.1 reference sequence, wherein the bases 18782565 are A or T, and the mutation leads to polymorphism.

[0007] Furthermore, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein W at the 501 bp position is A or T, and the mutation leads to the A / T polymorphism of the molecular marker.

[0008] As mentioned above, in the application of SNP molecular markers in sow assisted breeding, individuals with AA or TA genotypes at the polymorphic sites have significantly higher total nipple numbers than individuals with TT genotypes.

[0009] A primer for detecting the SNP molecular marker associated with the total teat number trait of pigs as described above, the nucleotide sequence of the primer is shown in SEQ ID NO.2-5.

[0010] A kit for detecting the SNP molecular marker associated with the total teat number trait of pigs as described above, the kit comprising primers with nucleotide sequences as shown in SEQ ID NO.2-5.

[0011] A method for detecting the SNP molecular marker associated with the total nipple number trait of pigs as described above, comprising the following steps:

[0012] 1) using the primers shown in SEQ ID NO.2-5 to perform PCR amplification on sow genomic DNA;

[0013] 2) Typing and identifying the polymorphic sites of the amplified product obtained in step 1).

[0014] In the method as described above, preferably, in step 1), the sow genomic DNA can be extracted from sow blood DNA or sow ear tissue DNA.

[0015] In the method described above, preferably, in step 2), when the amplification product shows three bands of 744 bp, 499 bp and 299 bp in size, the genotype of the sow is determined to be AT type;

[0016] When the amplified product showed two bands of 744 bp and 499 bp, the genotype of the sow was determined to be AA;

[0017] When two bands of 744 bp and 299 bp appeared in the amplified product, the genotype of the sow was determined to be TT type.

[0018] The primers, kits or methods for detecting SNP molecular markers associated with the total nipple number trait of pigs as described above are used in sow assisted breeding to select sow breeds with a larger number of nipples; when the genotype of the polymorphic site is AA or TA, the total nipple number of the sow is significantly higher than that of the TT type.

[0019] The beneficial effects of the present invention are:

[0020] The SNP molecular marker related to the total nipple number trait of pigs provided by the present invention has a significant effect on the total nipple number trait of pigs. By determining the genotype of the polymorphism, it is possible to effectively identify whether a pig has high reproductive potential, providing a detection technology means for early breeding and improving breeding efficiency. The present invention also provides a reliable molecular marker detection method for the genetic improvement of pig reproductive traits, which is of great significance to the genetic improvement of pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the Manhattan plot of the GWAS results of the total number of papillae in Example 1 of the invention.

[0022] Figure 2 This is the significance analysis of the phenotypic values ​​corresponding to different genotypes of SNP sites in the present invention; * is significantly correlated (p<0.05), **** is extremely significantly correlated (p<0.0001), and N represents the sample size.

[0023] Figure 3 The agarose gel electrophoresis pattern of the PCR product of the Tetra primer ARMS PCR amplification of the pig TTC17 gene rs340400902 in the present invention, wherein the M lane is a DNA molecular weight marker (DL2000), 1-3: TT; 4-6: AT; 7-9: AA; 10: water control. DETAILED DESCRIPTION

[0024] The present invention is based on a high-generation cross-bred resource population constructed by the applicant's research group using Large White Pig and Tongcheng Pig. By measuring and recording the total nipple number, and combining the SNP typing data obtained by whole genome sequencing, a whole genome association analysis (GWAS) related to the total nipple number was carried out. Subsequently, the GWAS results were deeply analyzed, and two SNP molecular markers significantly correlated with the total nipple number were identified. The SNP molecular marker can be used for marker-assisted selection of the total nipple number, thereby screening in the early stage of breeding and improving breeding efficiency. This invention provides a reliable molecular marker detection method for the genetic improvement of the total nipple number.

[0025] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0026] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the present method are of analytical grade or above.

[0027] Example 1 Obtaining the gene affecting the total number of pig nipples SNP site

[0028] 1. Experimental population

[0029] A high-generation crossbreed group of Large White pigs × Tongcheng pigs was taken as the research object. Individual measurements were collected from Yunzhi Pig Farm in Tongcheng County (277 pigs) and the boutique pig farm of Huazhong Agricultural University (611 pigs). The phenotypic data of the total nipple number of all individuals were collected and recorded, and ear tissue samples were collected.

[0030] 2. Test methods

[0031] 2.1 DNA extraction

[0032] The DNA of ear tissue of relevant populations is extracted using the DNA phenol-chloroform crude extraction method (the phenol-chloroform crude extraction method can be found in Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning Laboratory Guide [M]. 2nd edition. Jin Dongyan, Li Mengfeng. Beijing: Science Press, 1999. 465 467) or other recognized extraction methods with equal effectiveness. These methods are all reported commonly used methods.

[0033] 3. Genome-wide association analysis

[0034] GWAS analysis of the total nipple number trait was performed based on the mixed linear model of GEMMA software.

[0035] The analysis model is as follows:

[0036] Y=Wα+Xβ+u+ε

[0037] where Y is the phenotypic value of the trait; W and X are the corresponding association matrices; α represents the fixed effect, including sex and the first three principal components (PCA); β represents the additive effect of genetic markers (SNPs); and u represents the random polygenic effect, where u~N(0, Gσ g 2 ), where G is the genomic kinship matrix between individuals estimated using GEMMA, σ g 2 is the variance of the polygenic additive effect; ε is the vector of random residual effects, which is distributed as ε~N(0, Iσ ε 2 ), where I is the identity matrix, σ ε 2 is the residual variance.

[0038] GWAS results Figure 1The results showed that the SNP sites significantly associated with the total number of nipples were mainly located on chromosome 2 and chromosome 7. Further analysis of the significantly associated SNP sites revealed that the specific nucleotide sequence of the 2:18782565 site (A>T) of chromosome 2 was as shown in SEQ ID NO.1, where the W of the 501st base was A or T, and the polymorphism of the nucleotide was significantly associated with the total number of nipples (based on the reference sequence of the pig genome version 11.1), and the results are shown in Table 1.

[0039] Table 1 Statistical analysis of genotypes at rs340400902 of TTC17 gene and phenotypic values ​​of total papilla number

[0040]

[0041]

[0042] Note: The values ​​in the table are "mean ± standard deviation". Different lowercase letters in the same row indicate extremely significant differences (P<0.0001), and the same letters indicate insignificant differences.

[0043] SEQ ID NO.1:GGGGTGGGGGACGTCATCTAGGGGATTTAAGGAG。

[0044] In the sample of this study population, there were 794 AA-type, 75 TA-type, and 19 TT-type TTC17 genes. The results showed that individuals with the AA genotype of the TTC17 gene had significantly higher total nipples than individuals with the TT genotype. Therefore, the AA genotype can be used as a basis for breeding selection. By using this SNP site, marker-assisted selection can be performed for the total nipple number trait, thereby improving the efficiency of early breeding and providing a reliable detection method for the genetic improvement of the total nipple number trait in pigs.

[0045] Example 2 Establishment of a polymorphism detection method for molecular markers associated with the total nipple number trait of pigs

[0046] 1. Primer design

[0047] According to the flanking 500bp sequence information of the candidate SNP site in the Ensembl database (SNP number: Ensembl genome browser database rs340400902; reference genome: Sscrofa11.1, mutation position 2:18782565, allele, gene name TTC17), Tetraprimer ARMS PCR primer design was performed using the Tetra primer ARMS PCR primer online design program (http: / / cedar.genetics.soton.ac.uk / public_html / primer1.html), and multiple sets of primers were designed, and the product fragment size was controlled at 150-800bp. For each SNP site, two inner primers with 3′ ends that paired with the two alleles of the SNP and extended in opposite directions and two outer primers in opposite directions were designed. The primer length should be kept at 20bp-30bp. If the primer is too short, the specificity of the primer itself will be reduced. At the same time, a mismatch was artificially introduced at the third base of the 3′ end of the inner primer to increase the specificity of amplification. The primer with the mismatched base introduced at this position has the highest specificity. Since this method adds four primers in the same PCR reaction tube at the same time, the concentration and ratio of the inner and outer primers are important contents for optimizing the Tetra primer ARMS PCR reaction system. The primer ratio needs to be optimized multiple times to find the most suitable ratio of the inner and outer primer concentrations, so that the amplified bands are bright and accurately distinguish different genotypes, avoiding false positives and nonspecific amplification. The primer information after final optimization is shown in Table 2, and the primer synthesis was completed by Wuhan Qingke Biotechnology Co., Ltd.

[0048] Table 2 Primer sequence information

[0049]

[0050] 2. Tetra primer ARMS PCR amplification

[0051] DNA template

[0052] According to the whole genome DNA sequencing results, genomic DNA of three individuals for each genotype of the SNP site was selected as DNA template.

[0053] 2.1. Tetra primer ARMS PCR amplification of rs340400902

[0054] PCR reaction system 20μL: 2×Taq Master Mix 10.0μL, two outer primers (outer, 10μM) 0.2μL each, two inner primers (inner, 10μM) 0.6μL each, DNA template 1.0μl (50ng / μL), ddH2O 7.4μL. PCR reaction program: 95℃ pre-denaturation 5min, 95℃ denaturation 30s, annealing (annealing temperature see Table 3) 30s, 72℃ extension 30s, a total of 27 cycles; 72℃ extension 5min, 4℃ storage. 5μl of PCR product was measured and added to 3μl of Loading buffer, separated by 2% agarose gel electrophoresis, and the gel results were observed by gel imaging. The amplified product was detected by 2% agarose gel electrophoresis, and the electrophoresis results were observed and saved by the gel imaging system. Different genotypes were distinguished according to the size of the amplified fragment and the number of bands.

[0055] 2.2. Tetra primer ARMS PCR amplification of rs340400902

[0056] PCR reaction system 20μL: 2×Taq Master Mix 10.0μL, two outer primers (outer, 10μM) 0.2μL each, two inner primers (inner, 10μM) 0.2μL each, DNA template 1.0μl (50ng / μL), ddH2 O 8.2μL. PCR reaction program: 95℃ pre-denaturation 5min, 95℃ denaturation 30s, annealing (annealing temperature see Table 2) 30s, 72℃ extension 30s, a total of 29 cycles; 72℃ extension 5min, 4℃ storage. 5μl of PCR product was measured and added to 3μl of Loading buffer, separated by 2% agarose gel electrophoresis, and the gel results were observed by gel imaging. The amplified product was detected by 2% agarose gel electrophoresis, and the electrophoresis results were observed and saved by the gel imaging system. Different genotypes were distinguished according to the size of the amplified fragment and the number of bands.

[0057] 3.1 Results

[0058] Tetra primer ARMS PCR amplification system includes 1 pair of outer primers and 1 pair of inner primers. The target fragment amplified by the outer primer pair (SEQ ID NO.2-3) is used as a positive reference, and the amplified fragment size is the largest (744bp). Among them, the letter R at position 501 in SEQ ID NO.1 represents the A or T allele mutation of rs340400902. The inner primers are primers that specifically bind to the mutant site A (SEQ ID NO.4) and the wild-type site T (SEQ ID NO.5). SEQ ID NO.4 and the outer primer SEQ ID NO.3 can amplify the target band with a fragment size of 499bp, and SEQ ID NO.5 and the outer primer SEQ ID NO.2 can amplify the target band with a fragment size of 299bp. According to the size and presence of the electrophoresis band, it can be judged whether the mutation occurs and the genotype of the individual.

[0059] Method for determining the results of the SNP site polymorphism detection of rs340400902:

[0060] If there are three amplified fragments, namely the amplified bands of the outer primer pair (SEQ ID NO.2-3), the inner primer SEQ ID NO.5 and the outer primer SEQ ID NO.4, and the inner primer SEQ ID NO.4 and the outer primer SEQ ID NO.3, and the size is consistent with the expected fragment size (744bp+499bp+299bp), then the individual genotype is determined to be heterozygous AT;

[0061] If there are two amplified fragments, namely the amplified bands of the outer primer pair (SEQ ID NO.2-3), the inner primer SEQ ID NO.4 and the outer primer SEQ ID NO.3, and the size is consistent with the expected fragment size (744+499bp), the individual genotype is determined to be homozygous AA;

[0062] If there are two amplified fragments, namely the amplified bands of the outer primer pair (SEQ ID NO.2-3), the inner primer SEQ ID NO.5 and the outer primer SEQ ID NO.2, and their sizes are consistent with the expected fragment size (744+299bp), the individual genotype is determined to be homozygous TT.

[0063] For the DNA extracted from the pig ear tissue samples of the three genotypes (three samples for each), nine DNA samples were tested respectively according to the amplification system and PCR reaction procedure for PCR amplification of the target fragments mentioned above.

[0064] For the electrophoresis test results of rs340400902, Figure 3As shown, band M in the figure is 2000Marker, number: 1-3 is TT genotype, 4-6 is AA genotype, 7-9 is AT genotype, 10 is water control; the test results are consistent with expectations. It can be seen that the primer pair SEQ ID NO.2-5 provided above can be used to identify the genotype of the 501st nucleotide in the sequence of SEQ ID NO.1, to screen sows with a large total number of teats, and to select sows with homozygous AA genotype for breeding.

[0065] Compared with the prior art, the present invention discovered for the first time a SNP molecular marker in the pig TTC17 gene that is related to the total teat number trait of the pig, and used it for screening and breeding for the improvement of the total teat number trait of the pig; and the present invention uses the Tetraprimer ARMS PCR technology to simultaneously detect multiple genotypes (TT, AA, AT) in a single PCR reaction, which is not only simple to operate and low in cost, but also has high specificity and accuracy.

Claims

1. A SNP molecular marker associated with the total nipple number trait of pigs, characterized in that: The SNP molecular markers are located at bases 18782565 of chromosome 2 of the reference sequence of the pig genome version 11.1, and the bases 18782565 are A or T, and the mutation leads to polymorphism.

2. A SNP molecular marker associated with the total nipple number trait of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein W at the 501 bp position is A or T, and the mutation leads to the A / T polymorphism of the SNP molecular marker.

3. The use of the SNP molecular marker according to claim 2 in sow assisted breeding, characterized in that: The total number of nipples of sows whose genotype at the polymorphic site is AA or TA is significantly higher than that of sows whose genotype is TT.

4. A primer for detecting the SNP molecular marker associated with the total nipple number trait of pigs as claimed in claim 2, characterized in that: The nucleotide sequence of the primer is shown in SEQ ID NO.2-5.

5. A kit for detecting the SNP molecular marker associated with the total nipple number trait of pigs as claimed in claim 2, characterized in that: The kit includes primers with nucleotide sequences as shown in SEQ ID NO.2-5.

6. A method for detecting the SNP molecular marker associated with the total nipple number trait of pigs as claimed in claim 2, characterized in that: It includes the following steps: 1) using the primers shown in SEQ ID NO.2-5 to perform PCR amplification on sow genomic DNA; 2) Typing and identifying the polymorphic sites of the amplified product obtained in step 1).

7. The method according to claim 6, characterized in that In step 1), the sow genomic DNA can be extracted from sow blood DNA or sow ear tissue DNA.

8. The method according to claim 6, characterized in that In step 2), when the amplified product shows three bands of 744 bp, 499 bp and 299 bp in size, the genotype of the sow is determined to be AT type; When the amplified product showed two bands of 744 bp and 499 bp, the genotype of the sow was determined to be AA; When two bands of 744 bp and 299 bp appeared in the amplified product, the genotype of the sow was determined to be TT type.

9. Use of the primers for detecting SNP molecular markers associated with the total nipple number trait of pigs as described in claim 4, the kit for detecting SNP molecular markers associated with the total nipple number trait of pigs as described in claim 5, or the method for detecting SNP molecular markers associated with the total nipple number trait of pigs as described in any one of claims 6 to 8 in sow assisted breeding.

10. The use according to claim 9, characterized in that Used to select sow breeds with more nipples, when the genotype of the polymorphic site is AA or TA, the total number of nipples of the sows is significantly higher than that of the TT type.

Images