KASP molecular marker for identifying sex of channa argus and application of KASP molecular marker

Abstract

The invention belongs to the technical field of biology, and discloses a molecular marker closely linked with a snakehead sex gene, which can accurately identify the genetic sex of snakeheads. The invention also provides a specific KASP primer for amplifying the molecular marker closely linked with the snakehead sex gene, which can be used for detecting the genetic sex of snakeheads, is simple and easy to use, has high analysis flux and high accuracy, and is suitable for detecting a large number of samples. The molecular marker provided by the invention has important practical significance for quickly and accurately screening pseudo-female snakehead and super-male snakehead, shortening the breeding time and improving the breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a KASP molecular marker for identifying the sex of Channa argus and an application thereof. Background Art

[0002] Channa argus belongs to the Channidae family of the Anabantiformes order. It is widely distributed in the water systems of the Yangtze River, Yellow River, Liaohe River and Heilongjiang River in my country, and is commonly found in freshwater bodies such as ponds, rivers, lakes and reservoirs. Channa argus has the characteristics of delicate and delicious meat, high protein, few fish bones, fast growth and high yield. It is a traditional edible farmed fish in my country. Since Channa argus is difficult to tame and eat artificial formula feed, the hybrid Channa argus (C.argus♀×C.maculata♂) and the hybrid Channa maculata (C.maculata♀×C.argus♂) that can eat artificial formula feed and have significant hybrid advantages have become the main breeding objects of Channa fish in my country. However, as one of the parents of hybrid Channa, it is still crucial to continuously improve and innovate the germplasm of Channa argus.

[0003] Both the black snakehead and the hybrid snakehead have significant sexual dimorphism, and there are significant differences between male and female individuals in terms of growth rate, individual size and feed utilization. Male individuals grow faster, are larger, and have a lower feed coefficient, while female fish grow slower, are smaller, and their gonadal development leads to an increased feed coefficient and a low survival rate during transportation. In order to solve the problem of the impact of male-female differences on breeding benefits, the all-male hybrid snakehead "Male Channa No. 1" (C.argus♀XX×C.maculata♂YY) has been successfully bred, with a male rate of more than 93%. Under the same breeding conditions, its growth rate is more than 25% higher than that of the common black-spotted hybrid snakehead (C.argus♀×C.maculata♂), the feed coefficient is reduced by 0.2 to 0.35, the proportion of large-sized high-quality fish over 1kg is increased by more than 20%, and the comprehensive breeding benefits are increased by more than 40%. The successful breeding of the hybrid snakehead "Male Channa No. 1" shows that the all-male hybrid snakehead has excellent growth traits and broad market prospects. However, due to the differences in breeding modes and optimal breeding areas between the black-spotted hybrid snakehead and the spotted black hybrid snakehead, the hybrid snakehead "Male Snakehead No. 1" still cannot fully meet the demand. There is a widespread demand in the industry and the market for the all-male spotted black hybrid snakehead (C.maculata♀XX×C.argus♂YY).

[0004] One of the keys to breeding all-male hybrid Channa argus is to obtain molecular markers for identifying the sex of Channa argus, so as to screen Channa argus with genetic male sex and breed super male Channa argus (YY). At present, there are some molecular markers that can identify the genetic sex of Channa argus, but the existing markers for identifying the genetic sex of Channa argus are either dominant markers with low accuracy and poor stability, and are not suitable for large-scale molecular marker-assisted selection breeding, or they rely on specific instruments and reagents, and have poor versatility, flexibility and ease of use, which seriously affect the purification speed and variety breeding process of all-male and super male lines of Channa argus. Summary of the invention

[0005] The invention aims to develop a simple, accurate, high-throughput identification technology for detecting the sex of Channa argus and super-male sex, which is suitable for a large number of samples.

[0006] The first aspect of the present invention aims to provide an InDel marker that is tightly linked to the sex gene of Channa argus.

[0007] The second aspect of the present invention aims to provide KASP primers for amplifying the InDel markers of the first aspect of the present invention.

[0008] The third aspect of the present invention aims to provide a reagent or a kit.

[0009] The fourth aspect of the present invention aims to provide the use of the InDel marker of the first aspect of the present invention, the KASP primer of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention.

[0010] The fifth aspect of the present invention aims to provide a method.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is:

[0012] The first aspect of the present invention provides an InDel marker tightly linked to the sex gene of Channa argus, wherein the InDel marker is located on chromosome 16 of the Channa argus genome, and contains a nucleotide sequence of the polymorphism "AGCTCTGATCACAGAAACAAGT / ----------------------" site at 11556701-11556723; wherein - represents the absence of the InDel.

[0013] The physical location of the InDel markers in the present invention is based on the Channa argus genome (Channa argus Genomeassembly ASM1899790v1).

[0014] In some embodiments of the present invention, the homozygous genotype of the polymorphic site base "---------------------" corresponds to a female black snakehead, the heterozygous genotype of the polymorphic site base "AGCTCTGATCACAGAAACAAGT / ----------------------" corresponds to a male black snakehead, and the homozygous genotype of the polymorphic site base "AGCTCTGATCACAGAAACAAGT" corresponds to a super male black snakehead.

[0015] The second aspect of the present invention provides KASP primers for amplifying the InDel marker of the first aspect of the present invention, comprising a forward primer X, a forward primer Y and a reverse primer;

[0016] Wherein, the forward primer X contains the nucleotide sequence shown in SEQ ID NO: 10 (5'-ATGACTGTTGCTACCACTACACAA-3');

[0017] The forward primer Y contains the nucleotide sequence shown in SEQ ID NO:11 (5'-ATGACTGTTGCTACCACTACACAG-3');

[0018] The nucleotide sequence of the reverse primer is shown in SEQ ID NO: 7 (5'-CACAATCTTTACCAAACCACCATCAAACAACT-3').

[0019] In some embodiments of the present invention, the forward primer X and the forward primer Y contain a tag sequence of a fluorescent group, and the fluorescent groups of the forward primer X and the forward primer Y are different.

[0020] In some embodiments of the present invention, the tag sequence of the fluorescent group is located at the 5' end of the forward primer X and the forward primer Y.

[0021] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.

[0022] In some embodiments of the present invention, the 5' end of the forward primer X is added with a FAM fluorescent tag sequence as shown in SEQ ID NO:8.

[0023] In some embodiments of the present invention, the nucleotide sequence of the forward primer X is shown in SEQ ID NO:5.

[0024] In some embodiments of the present invention, the 5' end of the forward primer Y is added with a HEX fluorescent tag sequence as shown in SEQ ID NO:9.

[0025] In some embodiments of the present invention, the nucleotide sequence of the forward primer Y is shown in SEQ ID NO:6.

[0026] The third aspect of the present invention provides a reagent or a kit, comprising the KASP primer of the second aspect of the present invention.

[0027] In some embodiments of the present invention, the reagent or kit further contains DNA polymerase, dNTP and MgCl2.

[0028] In some embodiments of the present invention, the kit further comprises a TRET cassette fluorescent primer and a ROX internal reference dye.

[0029] The fourth aspect of the present invention provides the use of the InDel marker of the first aspect of the present invention, the KASP primer of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention in any of the following aspects:

[0030] 1) Identify the sex of the snakehead;

[0031] 2) Molecular marker-assisted breeding related to the sex of Channa argus;

[0032] 3) Genotyping of Channa argus;

[0033] 4) Construct a DNA fingerprint of Channa argus.

[0034] A fifth aspect of the present invention provides a method, comprising the step of using the KASP primers of the second aspect of the present invention and the reagent or kit of the third aspect of the present invention to detect the InDel marker of the first aspect of the present invention in the genome of the Channa argus to be tested;

[0035] The method comprises any one of 1) to 4):

[0036] 1) A method for identifying the sex of Channa argus;

[0037] 2) A method for assisted breeding of Channa argus;

[0038] 3) A method for genotyping Channa argus;

[0039] 4) A method for constructing a DNA fingerprint of Channa argus.

[0040] In some embodiments of the present invention, the method comprises the following steps:

[0041] (1) extracting genomic DNA of the tested Channa argus;

[0042] (2) using DNA as a template and performing PCR amplification using the KASP primers of the second aspect of the present invention or the reagent or kit of the third aspect of the present invention;

[0043] (3) Analyze the PCR amplification products to obtain the polymorphism of the InDel markers in the genome of the tested Channa argus.

[0044] In some embodiments of the present invention, when the base of the polymorphic site is "----------------------", the homozygous genotype corresponding to the black snakehead is female; the heterozygous genotype of the polymorphic site base is "AGCTCTGATCACAGAAACAAGT / ----------------------" corresponding to the black snakehead is male, and the homozygous genotype of the polymorphic site base is "AGCTCTGATCACAGAAACAAGT" corresponding to the black snakehead is super male.

[0045] The beneficial effects of the present invention are:

[0046] The invention provides a molecular marker which is closely linked to the sex gene of Channa argus and can accurately identify the genetic sex of Channa argus.

[0047] The present invention also provides a specific KASP primer for amplifying a molecular marker closely linked to the sex gene of the Channa argus, which can detect the genetic sex of the Channa argus, is simple and easy to use, has high analysis throughput, high accuracy, and is suitable for the detection of a large number of samples. The molecular marker provided by the present invention has important practical significance for quickly and accurately screening pseudo-female Channa argus and super male Channa argus, shortening breeding time, and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The results of Cmhen 5 marker detection in 83 Channa argus. DETAILED DESCRIPTION

[0049] The present invention is further described in detail below through specific examples.

[0050] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0051] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0052] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0053] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions. Example 1 Development of molecular markers tightly linked to the sex gene of Channa argus

[0054] 1. High-multiplier resequencing of female and male Channa argus

[0055] The tail fins of 20 female and 20 male Channa argus were taken, and DNA was extracted by phenol-chloroform extraction. The extracted DNA samples were subjected to double-end resequencing by BGI Biotechnology Co., Ltd. using the Illumina Xten platform, with a read length of 150 bp and a sequencing depth of 10×.

[0056] 2. Female and male specific sequence analysis

[0057] The sequencing data of 20 female and 20 male Channa argus were aligned to the reference genome of Channa argus (Channa argus Genome assembly ASM1899790v1) using bwa (v0.7.17-r1188) software. Based on the results of sequence alignment, the male Channa argus-specific sequence (Chr 16:11556701-11556723) was screened out. Since the Y chromosome has an additional sequence than the X chromosome genome, the high-multiplier sequencing method was used to find the sequence by comparing the reads coverage. This sequence is a sequence specific to the Y gene. Based on this sequence, markers co-linked with this sequence were found around it.

[0058] 3. Development of KASP markers

[0059] Based on the location of the male-specific sequence on the chromosome, the Indel site (Chr 16: 11556701-11556723) with differences between females and males was searched around it. The sequence copy number and sequence GC content of this development site were analyzed to ensure that this site met the high success rate of KASP markers, and then this site was designed as a KASP marker.

[0060] The Indel site information of Cahen 5 is as follows:

[0061] >C.agrus female

[0062] GTGCAACTCACAGCTGCTCCTCTCTTGTTTCCCGCTGCTTGGGGTGTGTGTGT TTGTGCGTGTGTGTGTGTGTGTGTGTCTGTGACAGTGTCATACTCCCAAATCAAAG ATGACTGTTGCTACCACTACAC(SEQ ID NO:1) ------------------ AAAGTTTATACAAAGAGAGTAAACATGAGTTTATATTCTACCTTTTAT GATTTAGTTGTTTGATGGTGGTTTGGTAAAGATTGTGAG(SEQ ID NO:2)。

[0063] >C.agrus male

[0064] GTGCAACTCACAGCTGCTCCTCTCTTGTTTCCCGCTGCTTGGGGTGTGTGTGT TTGTGCGTGTGTGTGTGTGTGTGTGTCTGTGACAGTGTCATACTCCCAAATCAAAG ATGACTGTTGCTACCACTACAC AGCTCTGATCA CAGAAACAAG (SEQ ID NO:3) / ------------------ AAAGTTTATACAAAGAGAGTAAACATGAGTTTATATTCTACCTTTTAT GATTTAGTTGTTTGATGGTGGTTTGGTAAAGATTGTGAG(SEQ ID NO:2)。

[0065] >C.agrus super-male

[0066] GTGCAACTCACAGCTGCTCCTCTCTTGTTTCCCGCTGCTTGGGGTGTGTGTGTTTGTGCGTGTGTGTGTGTGTGTGTGTCTGTGACAGTGTCATACTCCCAAATCAAAGATGACTGTTGCTACCACTACAC AGCTCTGATCACA GAAACAAG AAAGTTTATACAAAGAGAGTAAACATGAGTTTATATTCTACCTTTTATGATTTAGTTGTTTGATGGTGGTTTGGTAAAGATTGTGAG(SEQ ID NO:4)。

[0067] The Indel positions in the sequence were determined based on the publicly released Channa argus complete genome sequence GCA_018997905.1 (Channa argus Genome assembly ASM1899790v1).

[0068] According to the characteristics of Indel mutation information, a set of competitive allele-specific PCR primers were designed, including Primer X, Primer Y and reverse primer. The two forward primers ended with allelic variant bases AGCTCTGATCACAGAAACAAGT / ------------------, and the sequence of the reverse primer was selected to ensure that the amplified fragment was 60-120bp.

[0069] The sequences of Primer X, Primer Y and reverse primer are as follows:

[0070] Primer X:

[0071] 5'- GAAGGTGACCAAGTTCATGCT ATGACTGTTGCTACCACTACACAA-3' (SEQ ID NO: 5);

[0072] Primer Y:

[0073] 5'- GAAGGTCGGAGTCAACGGATT ATGACTGTTGCTACCACTACACAG-3' (SEQ ID NO: 6);

[0074] Reverse primer: 5'-CACAATCTTTACCAAACCACCATCAAACAACT-3' (SEQ ID NO: 7).

[0075] A fluorescent label sequence is added to the 5' end of the forward primer, wherein the 5' end of Primer X is connected to the FAM fluorescent label sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 8), and the 5' end of Primer Y is connected to the HEX fluorescent label sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO: 9).

[0076] The above primer sequences were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping provided by the present invention has a large throughput and is easy to operate. It only needs to add the specific KASP Primer mix and the universal KASP Master mix to the PCR microwell reaction plate containing the DNA sample to perform PCR amplification. The final result can be analyzed using a fluorescence detector.

[0077] The KASP Master mix comprises the following components: universal TRET cassette fluorescent primer, ROX internal reference dye, KlearTaq DNA polymerase, dNTP and MgCl2. The KASP Master mix is ​​a product of LGC Company of the United Kingdom, and the product catalog number is KBS-1016-002.

[0078] Example 2 InDel marker Cmhen 5 used for marker-assisted selection breeding

[0079] This example is used to verify whether the molecular markers in Example 1 can achieve assisted selection breeding of Channa argus. The specific experimental process is as follows:

[0080] 1. Extract genomic DNA from 83 Channa argus;

[0081] 2. Dilute DNA concentration: DNA to 18-22 ng / μL (preferably 20 ng / μL) as a template;

[0082] 3. PCR amplification reaction system: template DNA 5μL, KASP Primer mix 5μL (the concentration of Primer X and Primer Y is 1μM, the concentration of reverse primer is 3μM), KASP Master mix 0.14μL;

[0083] 4. PCR reaction program is as follows: 94°C for 15 minutes; 94°C for 20 seconds, 65°C-56°C for 60 seconds, annealing extension temperature decreased by 0.8°C in each cycle, 10 cycles; 94°C for 20 seconds, 57°C for 60 seconds, 30 cycles;

[0084] 5. Fluorescence scanning of PCR amplification products: Use ARAYA to scan the fluorescence signal of the reaction system; then use INTELLICS for data analysis and genotyping.

[0085] 6. Result analysis: The genotype of female Channa argus is XX, the genotype of male Channa argus is XY, and the genotype of super male Channa argus is YY.

[0086] If the fluorescence corresponding to Primer X is detected in the amplified product, the base of this site is a homozygous genotype of "----------------------" (denoted as A:A), and the corresponding Channa argus is female; if two different fluorescences are detected in the amplified product, the base of this site is a heterozygous genotype of "AGCTCTGATCACAGAAACAAGT / ----------------------" (denoted as A:G), and the corresponding Channa argus is male. If the fluorescence corresponding to Primer Y is detected in the amplified product, the base of this site is a homozygous genotype of "AGCTCTGATCACAGAAACAAGT" (denoted as G:G), and the corresponding Channa argus is super male.

[0087] The identification results of Cahen 5 are shown in Table 1. Among the 83 Channa argus, 31 female Channa argus, 31 male Channa argus and 21 super male Channa argus were identified. Combined with the sampling results of male and female Channa argus and super male Channa argus, the marker typing of Cahen 5 ( Figure 1 ) The results were completely consistent with the results of gonad examination, with a detection accuracy of 100%. The results showed that the Cahen5 marker can accurately distinguish female, male and super male Channa argus, and it is fast and accurate, so it can be used for molecular marker-assisted selection breeding.

[0088] Table 1 Identification results of Cahen 5

[0089]

[0090]

[0091] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. An InDel marker closely linked to the sex gene of Channa argus, the InDel marker being located on chromosome 16 of the Channa argus genome, and containing a nucleotide sequence at the polymorphism of "AGCTCTGATCACAGAAACAAGT / ----------------------" site at 11556701-11556723; wherein, - indicates the absence of InDel.

2. The InDel marker according to claim 1, characterized in that The homozygous genotype of the polymorphic site base "----------------------" corresponds to female black snakehead, the heterozygous genotype of the polymorphic site base "AGCTCTGATCACAGAAACAAGT / ----------------------" corresponds to male black snakehead, and the homozygous genotype of the polymorphic site base "AGCTCTGATCACAGAAACAAGT" corresponds to super male black snakehead.

3. KASP primers for amplifying the InDel-labeled protein according to claim 1 or 2, comprising a forward primer X, a forward primer Y and a reverse primer; in, The forward primer X contains the nucleotide sequence shown in SEQ ID NO: 10; The forward primer Y contains the nucleotide sequence shown in SEQ ID NO:11; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:

7.

4. The KASP primer according to claim 3, characterized in that The forward primer X and the forward primer Y contain a label sequence of a fluorescent group, and the fluorescent groups of the forward primer X and the forward primer Y are different; Preferably, the tag sequence of the fluorescent group is located at the 5' end of the forward primer X and the forward primer Y.

5. The KASP primer according to claim 4, characterized in that The fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.

6. A reagent or kit comprising the KASP primer according to any one of claims 3 to 5; Preferably, the reagent or kit further contains DNA polymerase, dNTP and MgCl2.

7. Use of the InDel marker according to claim 1 or 2, the KASP primer according to any one of claims 3 to 5, or the reagent or kit according to claim 6 in any of the following aspects: 1) Identify the sex of the snakehead; 2) Molecular marker-assisted breeding related to the sex of Channa argus; 3) Genotyping of Channa argus; 4) Construct a DNA fingerprint of Channa argus.

8. A method comprising the step of using the KASP primers according to any one of claims 3 to 5, the reagent or the kit according to claim 6 to detect the InDel marker according to claim 1 or 2 in the genome of a Channa argus to be tested; The method comprises any one of 1) to 4): 1) A method for identifying the sex of Channa argus; 2) A method for assisted breeding of Channa argus; 3) A method for genotyping Channa argus; 4) A method for constructing a DNA fingerprint of Channa argus.

9. The method according to claim 8, characterized in that The method comprises the following steps: (1) extracting genomic DNA of the tested Channa argus; (2) using DNA as a template and performing PCR amplification using the KASP primers described in claim 4 or 5 or the reagent or kit described in claim 6; (3) Analyze the PCR amplification products to obtain the polymorphism of the InDel markers in the genome of the tested Channa argus.

10. The method according to claim 9, characterized in that When the polymorphic site base is "----------------------", the homozygous genotype corresponds to female snakehead; when the polymorphic site base is "AGCTCTGATCACAGAAACAAGT / ----------------------", the heterozygous genotype corresponds to male snakehead; when the polymorphic site base is "AGCTCTGATCACAGAAACAAGT", the homozygous genotype corresponds to super male snakehead.

Images