Molecular marker of heat tolerance gene tafad8 in wheat and application thereof
The identification of wheat heat tolerance through InDel molecular markers and PCR technology has solved the problem of accurate identification of wheat heat tolerance, and improved breeding efficiency and the accuracy of wheat heat tolerance selection.
Patent Information
- Application Number
- CN202411528579.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-30
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-10-30
AI Technical Summary
Wheat is sensitive to high temperature stress. Existing technologies make it difficult to accurately identify and utilize heat-resistant genes, which affects yield and quality. Traditional breeding methods are greatly affected by gene expression and environmental factors.
Develop InDel molecular markers, detect the insertion or deletion of specific nucleotide sequences in the wheat genome, use PCR and other technologies to identify wheat heat tolerance, and combine breeding methods to select highly heat-resistant parents for breeding.
It has improved the accuracy of wheat heat tolerance identification and breeding efficiency, reduced the linkage drag effect, and promoted the application of heat-resistant genes in practical breeding.
Smart Images

Figure CN119410811B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a molecular marker of a heat-tolerant gene TaFAD8 of wheat and application thereof, and belongs to the technical field of biotechnology. BACKGROUND
[0002] Wheat is very sensitive to environmental temperature, and high temperature stress can cause its growth and development to be damaged, thereby affecting yield and quality. In particular, in the Huanghuai winter wheat region, high temperature weather above 32℃ often occurs during the middle and late stages of wheat filling, and even extreme high temperature as high as 40℃ can occur, accompanied by dry and hot wind disasters. This situation easily leads to the phenomenon of "green and ripe" of wheat, which seriously restricts the stability of wheat grain production. Cultivating and popularizing heat-tolerant wheat varieties is one of the effective ways to solve this problem, which requires researchers to identify heat-tolerant genes as soon as possible, develop molecular markers closely related to heat-tolerant genes, and realize effective utilization of heat-tolerant genes. The heat tolerance of wheat is regulated by multiple genes and belongs to a complex quantitative trait. At the same time, the identification of heat tolerance phenotype is difficult, and the related mechanism needs to be further studied. In previous studies, researchers decomposed heat tolerance into quantifiable traits such as heat sensitivity index and canopy temperature, or used important factors affecting heat tolerance such as chlorophyll fluorescence parameters and fatty acid content as standards, and found a large number of QTLs related to heat tolerance on 21 chromosomes of wheat. Although the current research is mostly still in the initial positioning stage of QTL, the QTL interval obtained is large, and it is difficult to accurately predict the heat tolerance phenotype, but molecular marker-assisted selection is still considered an important strategy to improve the efficiency of genetic improvement of wheat heat tolerance. Compared with traditional breeding methods, molecular marker-assisted selection can directly select target genes accurately and is not affected by gene expression and environmental factors, which can greatly improve the accuracy of selection and accelerate the breeding process. Therefore, the development of molecular markers highly linked to wheat heat tolerance genes will help to reduce the linkage drag effect in the selection process and improve the application effect of heat tolerance genes in actual breeding. SUMMARY
[0003] The technical problem solved by the present application is to provide a method for identifying or assisting in identifying the heat tolerance of wheat by molecular markers and applications.
[0004] In order to solve the above problems, the present application provides the application of any one of the following:
[0005] A1) in identifying or assisting in identifying the heat tolerance of wheat;
[0006] A2) in preparing products for identifying or assisting in identifying the heat tolerance of wheat;
[0007] A3) in preparing wheat breeding products;
[0008] The InDel molecular marker is a molecular marker that can identify whether the DNA molecule of nucleotide sequence 84-3617 in sequence 2 and / or the DNA molecule of sequence 3 exists.
[0009] In the present application, the index of heat tolerance can be a chlorophyll fluorescence parameter. The chlorophyll fluorescence parameter can be F v / F m .
[0010] The substance can be a product. The detection substance can include reagents, kits and instruments for detecting the above-mentioned InDel molecular marker. Specifically, primers and / or other reagents and instruments required for in vitro amplification of nucleic acids for detecting the above-mentioned InDel molecular marker.
[0011] To solve the above-mentioned problems, the present application also provides a product.
[0012] The product is a substance containing the above-mentioned detection of the InDel molecular marker, and is any one of the following G1)-G4):
[0013] G1) a product for detecting the InDel molecular marker;
[0014] G2) for use in identifying or assisting in identifying the heat tolerance of wheat;
[0015] G3) for use in preparing a product for identifying or assisting in identifying the heat tolerance of wheat;
[0016] G4) for use in preparing a wheat breeding product.
[0017] To solve the above-mentioned problems, the present application also provides a method for identifying or assisting in identifying the heat tolerance of wheat.
[0018] The method comprises detecting the genotype of the above-mentioned InDel molecular marker in the wheat genome, and identifying or assisting in identifying the heat tolerance of wheat according to the genotype of the above-mentioned InDel molecular marker in the wheat genome:
[0019] The genotype of the inserted type of wheat is higher or candidate higher in heat tolerance than the genotype of the deleted type of wheat, and the inserted type is homozygous for the insertion of sequence 3 between positions 83-84 of sequence 1, and the deleted type is homozygous for the absence of insertion of sequence 3 between positions 83-84 of sequence 1.
[0020] To solve the above-mentioned problems, the present application also provides a method for breeding wheat.
[0021] The method comprises selecting wheat with the genotype of the above-mentioned inserted type as a parent for breeding.
[0022] In the above, the above method is applied in wheat breeding.
[0023] In the above-mentioned applications, products and methods, the purpose of the breeding includes cultivating or breeding wheat with high or low heat tolerance.
[0024] In the above applications, products and methods, the substance for detecting the InDel molecular marker is the following D1), D2), D3) or D4):
[0025] D1) in vitro nucleic acid amplification primers containing specific amplification InDel molecular markers;
[0026] D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1);
[0027] D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);
[0028] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).
[0029] The in vitro nucleic acid amplification technology can be polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR) and nucleic acid sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal amplification technology (HDA) or Qβ replication technology.
[0030] The present application uses polymerase chain reaction (PCR) as an amplification method to perform polymorphism detection.
[0031] The specific amplification in D1) can detect the nucleotide sequence of the InDel site by the presence or absence of an amplification product or by the presence or absence of an amplification product combined with an auxiliary reagent such as a probe.
[0032] In the above applications, methods and products, the in vitro nucleic acid amplification primer can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected without a label.
[0033] In the above applications, products or methods, the in vitro nucleic acid amplification primer comprises the primer pair TAM-TaFAD8-7:
[0034] The primer pair TAM-TaFAD8-7 consists of TAM-TaFAD8-7F and TAM-TaFAD8-7R;
[0035] TAM-TaFAD8-7F is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 6 in the sequence listing;
[0036] TAM-TaFAD8-7R is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 7 in the sequence listing.
[0037] To solve the above problems, the present application also provides a method for wheat breeding.
[0038] The method comprises replacing the sequence 1 region in the wheat genome of interest with sequence 2, to obtain wheat with stronger heat resistance than the wheat of interest.
[0039] To solve the above problems, the present application also provides the following applications.
[0040] The application of the 84th-3617th nucleotide of sequence 2 or sequence 1 in the wheat genome corresponding to different heat resistance in any of the following:
[0041] A1) for identifying or assisting in identifying the heat resistance of wheat;
[0042] A2) for preparing a product for identifying or assisting in identifying the heat resistance of wheat;
[0043] A3) for preparing a wheat breeding product.
[0044] To solve the above problems, the present application also provides a DNA molecule.
[0045] The DNA molecule is a DNA molecule with the nucleotide sequence of SEQ ID NO: 3.
[0046] In the above, the wheat can be at least one of the following:
[0047] The wheat can be a hybrid of A wheat and B wheat, the A wheat being wheat with genotype of insertion type, and the B wheat being wheat with genotype of deletion type. The hybrid can be F2 generation and the following generations, such as F2 generation, BC1F2, RIL population, etc.
[0048] The insertion type is a homozygous type with insertion of SEQ ID NO: 3 between 83rd-84th of SEQ ID NO: 1, and the deletion type is a homozygous type without insertion of SEQ ID NO: 3 between 83rd-84th of SEQ ID NO: 1.
[0049] The breeding purposes include breeding wheat with strong heat tolerance.
[0050] The A wheat can be TAM107. The B wheat can be Luzi 238.
[0051] In the above application, method and product, the substance can be reagents and / or kits and / or instruments required for determining the InDel molecular marker or genotype by at least one of the following methods: in vitro nucleic acid amplification, DNA sequencing, restriction enzyme digestion fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and InDel chip. Among them, the InDel chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele-specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.
[0052] Beneficial effects
[0053] Firstly, the present application provides a molecular marker capable of identifying the heat tolerance of different varieties of wheat, specifically an InDel molecular marker, which is a DNA molecule with the nucleotide sequence of 84th-3617th of SEQ ID NO: 2 or SEQ ID NO: 3.
[0054] Furthermore, the present application provides specific use methods of InDel molecules: by detecting the genotype of wheat InDel molecular marker, identifying or assisting in identifying the heat tolerance of wheat according to the genotype of wheat:
[0055] The heat tolerance of the genotype with the insertion type is higher than or is candidate to be higher than the heat tolerance of the genotype with the deletion type, the insertion type is a homozygous type with the insertion of sequence 3 between the 83rd-84th of sequence 1, and the deletion type is a homozygous type without the insertion of sequence 3 between the 83rd-84th of sequence 1.
[0056] Finally, the application provides a method for breeding using the above InDel molecule. In the process of hybrid breeding, the offspring wheat with high heat tolerance is screened by the InDel molecular marker. BRIEF DESCRIPTION OF DRAWINGS
[0057] Figure 1 It is a schematic diagram of BSA-seq result of RIL population derived from wheat variety Luzi 238 and TAM107.
[0058] Figure 2 It is the physical location of TAM-TaFAD8-7 on wheat 2D chromosome; the physical location refers to the genome of Chinese Spring IWGSCRefSeqv1.0 version.
[0059] Figure 3 It is the electrophoresis result of PCR amplification products of Luzi 238 and TAM107 using TAM-TaFAD8-7 marker.
[0060] Figure 4 It is the heat tolerance detection result of wheat; black is the control group, and gray is the treatment group. The significant difference is detected by Student's t test, P<0.05 indicates significant difference, P<0.01 indicates extremely significant difference, and P<0.001 indicates extremely significant difference.
[0061] Figure 5 It is the result graph of CDS sequence alignment of TaFAD8-2D gene of TAM107 and Luzi 238, and the black background indicates that the sequences are the same.
[0062] Figure 6 It is the result graph of amino acid sequence alignment of TaFAD8-2D gene of TAM107 and Luzi 238, and the black line part is the histidine-rich motif.
[0063] Figure 7 It is the result graph of promoter sequence alignment of TAM107 and Luzi 238. DETAILED DESCRIPTION
[0064] The application will be further described in conjunction with the specific embodiments, the examples given are only for illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not constitute any limitation on the application.
[0065] The experimental methods in the following examples are all routine methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.
[0066] The following examples use SPSS 11.5 statistical software to process data, and the experimental results are expressed as mean ± standard deviation, Student's t test is used for inspection, P<0.05 indicates significant difference, P<0.01 indicates extremely significant difference, and P<0.001 indicates extremely significant difference.
[0067] The term "gene" refers to a segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer regions) involved in the transcription / translation of the gene product and the intervening sequences (introns) between individual coding regions (exons).
[0068] The term "allele" refers to one of the multiple alternative forms of a gene or non-coding region of DNA that occupy the same position on a chromosome. The term allele can be used to describe DNA from any organism, including but not limited to bacteria, viruses, fungi, protozoa, molds, yeasts, plants, humans, non-humans, animals, and archaea.
[0069] The term "genotype" refers to the total combination of all genes of a biological individual. Biological individuals include but are not limited to diploids, tetraploids, or other possible polyploids. For example, in diploids, the genotype can be homozygous or heterozygous. Homozygous genotype refers to two alleles that are exactly the same, such as AA or aa. Heterozygous refers to two alleles that are different, such as Aa. Other polyploid genotypes can appear and be described according to the actual situation of the alleles.
[0070] The term "InDel molecular marker" refers to an InDel marker (short for Insertion and Deletion marker) that is an insertion or deletion event that occurs in a genome, which is based on the insertion or deletion of nucleotides at a particular location in the genome. There can be multiple InDel molecular marker genotypes for an allele. For example, in a diploid, the InDel molecular marker genotype can be homozygous or heterozygous. A homozygous genotype means that the two alleles are identical, such as AA or aa. A heterozygous genotype means that the two alleles are different, such as Aa. Other polyploid genotypes can occur and be described depending on the actual alleles.
[0071] The term "template" refers to any nucleic acid molecule that can be used for amplification as described herein. Non-native double-stranded RNA or DNA can be made double-stranded DNA and used as double-stranded DNA. Any double-stranded DNA or preparation containing multiple different double-stranded DNA molecules can be used as template DNA to amplify one or more loci contained within the template DNA.
[0072] The term "primer" refers to an oligonucleotide that can be used in an amplification method, such as polymerase chain reaction (PCR), for amplifying a nucleotide sequence from a polynucleotide sequence that corresponds to a particular genomic sequence. At least one PCR primer used to amplify a polynucleotide sequence is sequence-specific for the sequence.
[0073] The term "amplification reaction" refers to a process for making one or more copies of a nucleic acid. In embodiments, the amplification method includes, but is not limited to, polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase and ligase chain reaction, Q-beta phage amplification, strand displacement amplification, or overlap extension splice polymerase chain reaction. In some embodiments, a single molecule of nucleic acid is amplified, for example, by digital PCR.
[0074] The terms "comprise," "comprising," "include," "including," and "has," "having," their variants, and / or the like, are open-ended transitional phrases or words that are intended to convey a possibility that elements, items, components, members, etc., that are listed thereafter can be present or comprised in the item, object, etc., that the phrase or word modifies, but that not all possibilities of such elements, items, components, members, etc., are present or comprised in the item, object, etc., that the phrase or word modifies.
[0075] The terms "first," "second," and the like, merely mean "one" or "a" and do not indicate or imply relative importance or a quantity of the indicated features. Thus, a feature defined with "first," "second," etc., can include one or more of the features. Further, in the description of the application, the meaning of "a," "an," and "the" includes plural references unless the context clearly dictates otherwise.
[0076] The term "identity" when used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence is determined by the percent of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences by routine methods, see, e.g., Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, D.C.). There are a number of algorithms that are used to align sequences and determine sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the search for similarity method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 70:173-187 (1997); and the BLAST family of algorithms (see Altschul et al. (1990) J. Mol. Biol. 215:403-410). Computer programs are also available that utilize these algorithms to compare sequences, including, but not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program from Intelligenetics, Mountain View, California.
[0077] Obtainment and development of molecular markers co-segregating with the heat tolerance gene TaFAD8 of wheat of Example 1
[0078] I. Alignment of TaFAD8-2D gene CDS sequences in TAM107 and Luzzi 238
[0079] TAM107 and Luzzi 238 are common wheat varieties, but there is a difference in heat tolerance between the two. Therefore, the TaFAD8-D gene related to heat tolerance in the genomes of TAM107 and Luzzi 238 was cloned, and the differences between the two were compared. The CDS sequence of the TaFAD8-D gene of Luzzi 238 is sequence 8. The CDS sequence of the TaFAD8-D gene of TAM107 is sequence 9.
[0080] The CDS sequences of the TaFAD8-D genes of TAM107 and Luzzi 238 are both 1320 bp in length. Sequence alignment of the CDS sequences of the TaFAD8-D genes of TAM107 and Luzzi 238 and the translated amino acid sequences showed that there were only 4 SNP differences in the CDS sequences, and the sequence similarity was high. TaFAD8-D encodes a protein with 439 amino acids. The amino acid sequence of the TaFAD8-D protein in Luzzi 238 is sequence 10 in the sequence list, and the amino acid sequence of the TaFAD8-D protein in TAM107 is sequence 11 in the sequence list. There are two amino acid mutations in the translated amino acid sequence. The functional domain in the TaFAD8-D protein is the three histidine-rich motifs of fatty acid dehydrogenase, and this structure is complete in the TaFAD8-D protein sequences of TAM107 and Luzzi 238, indicating that the protein function is normal. The sequence alignment results are shown in Figure 5 and Figure 6 Figure 5 is the CDS sequence alignment result of the TaFAD8-D genes of TAM107 and Luzzi 238, and the black background indicates that the sequences of the two are the same. Figure 6 is the amino acid sequence alignment result of the TaFAD8-D genes of TAM107 and Luzzi 238, and the black line part is the histidine-rich motif, indicating that the histidine-rich motif structure of the TaFAD8-D protein in TAM107 and Luzzi 238 is complete, and the protein function is normal.
[0081] Sequence 8 is as follows:
[0082]
[0083] Sequence 9 is specified as follows:
[0084]
[0085] Sequence 10 is specified as follows:
[0086] MARLLLPQCCCGLTPLPLPRRAVALPPPALFPSSSGAAASRRALSLRVAVAAPARLATAEDDGSGSRAAGAQGGDEGPADGFDPGAPPPFGLADIRAAIPKHCWVKDPWRSMGYVVRDVVVVLALAAAAARLDSWLAWPVYWAAQGTMFWALFVLGHDCGHGSFSNNAKLNSVVGHILHSSILVPYNGWRISHRTHHQNHGHVENDESWHPLPEKLYRSLDSSTRKLRFALPFPMLAYPFYLWSRSPGKSGSHFHPSSDLFQPNEKKDIVTSTTCWLAMAGLLAGLTVVMGPLQILKLYAVPYWIFVMWLDFVTYLHHHGHNDKLPWYRGKAWSYLRGGLTTLDRDYGWLNKIHHDIGTHVIHHLFPQIPHYHLVEATEAAKPVLGKYYREPDKSGPFPFHLFGALARSMKSDHYVSDTGDIIYYQTDPKLAAGAHTSD
[0087] Sequence 11 is specified as follows:
[0088] MARLLLPQCCCGLTPLPLPRRAVALPPPALFPSSSGAAASRRALSLRVAVAAPARLATAEDDGSGSRAAGAQGGDEGPADGFDPGAPPPFGLADIRAAIPKHCWVKDPWRSMGYVVRDVVVVLALAAAAARLDSWLAWPVYWAAQGTMFWALFVLGHDCGHGSFSNNAKLNSVVGHILHSSILVPYNGWRISHRTHHQNHGHVENDESWHPLPEKLYRSLDSSTRKLRFALPFPMLAYPFYLWSRSPGKSGSHFHPSSDLFQPNEKKDIVTSTTCWLAMAGLLAGLTVVMGPLQILKLYAVPYWIFVMWLDFVTYLHHHGHNNKLPWYRGKAWSYLRGGLTTLDRDYGWLNNIHHDIGTHVIHHLFPQIPHYHLVEATEAAKPVLGKYYREPDKSGPFPFHLFGALARSMKSDHYVSDTGDIIYYQTDPKLAAGAHTSD
[0089] II. Obtaining and sequence alignment of TaFAD8-D gene promoter in TAM107 and Luzi 238
[0090] Using resequencing information, the promoter sequence upstream of the start codon of TaFAD8-D gene in TAM107 and Luzi 238 was obtained, respectively.
[0091] The promoter nucleotide sequence upstream of the start codon of TaFAD8-D gene in Luzi 238 is sequence 12;
[0092] The promoter nucleotide sequence upstream of the start codon of TaFAD8-D gene in TAM107 is sequence 13;
[0093] The promoter sequences of TAM107 and Luzi 238 were aligned, and the results are shown in Figure 7 The underlined indicates the position of the start codon ATG.
[0094] The promoter sequences upstream of the start codon of TaFAD8-D gene in TAM107 and Luzi 238 have many SNP differences, and it is also found that a 3534 bp DNA fragment is inserted in the promoter region of TaFAD8-D gene in TAM107.
[0095] Sequence 12 is specifically as follows:
[0096]
[0097] Sequence 13 is specified as follows:
[0098]
[0099] III. Molecular marker development
[0100] Using the DNA resequencing results of TAM107 and Luzi 238, the primers were designed near the discovered Indel difference sites by BatchPrimer3 v1.0 to develop specific marker TAM-TaFAD8-7 (physical position as shown in SEQ ID NO. 1). Figure 2 TAM-TaFAD8-7 was composed of primer pair TAM-TaFAD8-7F and TAM-TaFAD8-7R; wherein TAM-TaFAD8-7F was a single-stranded DNA molecule as shown in SEQ ID NO. 6, and TAM-TaFAD8-7R was a single-stranded DNA molecule as shown in SEQ ID NO. 7.
[0101] Sequence 6 (SEQ ID NO. 6) is as follows: AGGAGGAGGGAAATAGGGCC.
[0102] Sequence 7 (SEQ ID NO. 7) is as follows: AGAAGATACCACACCAACACC.
[0103] Using the DNA of TAM107 and Luzi 238 as templates, PCR amplification was performed using primer pair TAM-TaFAD8-7.
[0104] The PCR amplification procedure was as follows: pre-denaturation at 98℃ for 5 min; denaturation at 98℃ for 15 s, annealing at 59℃ for 15 s, extension at 68℃ for 2 min, for 34 cycles; and extension at 68℃ for 10 min.
[0105] The PCR amplification system was 10 μL, and the components were as follows: 1 μL of 100 ng / μL genomic DNA, 5 μL of 2x Gflex PCR Buffer (Mg2+, dNTP plus), 1.0 μL of 10 ng / μL upstream primer, 1.0 μL of 10 ng / μL downstream primer, 0.5 μL of TksGflex DNA Polymerase (Takara, Dalian), and 1.5 μL of dd H2O.
[0106] The amplification product was separated on a 2% agarose gel at a voltage of 150 V for 10 min. The results were recorded by a gel imaging system and sequenced. DNA fragments of 300 bp and / or 3834 bp were obtained by amplification. The band of 300 bp obtained by amplification is also referred to as A band, the band of 3834 bp obtained by amplification is also referred to as B band, and the bands of 300 bp and 3834 bp obtained by amplification are also referred to as AB band.
[0107] The amplified product of Lu Zhi 238 was A band type, and the amplified product of TAM107 was B band type (PCR results of TAM107 and Lu Zhi 238 are shown in Figure 3
[0108] The sequence of the amplified product of only 300 bp is sequence 4, which is as follows:
[0109] AGAAGATACCACACCAACACCACCAAGTTGTGTGAGCCACACAGACGGAAAGGAGCCCTCGTGTCCGGCTCGTGGTCGCGGGATGGCGAGGCCCACGCAGCCCGGCCCACCGCGCCGTGGCCACCCACTATTATATGCTCGGATACGGCCGCCTCACCCCACCCGCCGGCGCAGCAAGCAGAGCGGCAGCAGCAGCAATGGCGCGCCTGCTCCTCCCCCAATGCTGCTGCGGCCTCACGCCCCTGCCCCTCCCGCGCCGCGCCGTCGCGCTCCCTCCCCCGGCCCTATTTCCCTCCTCCT.
[0110] The sequence of the amplified product of only 3834 bp is sequence 5, which is as follows:
[0111]
[0112] If the amplified product is only a 300bp band, the wheat to be tested is a deletion type, if the amplified product is only a 3834bp band, the wheat to be tested is an insertion type, and if the amplified product contains both 300bp and 3834bp bands, the wheat to be tested is a hybrid type.
[0113] The insertion haplotype is a sequence 3 (SEQ ID No. 3) in the genome, that is, there is an insertion of 3534 nucleotides of SEQ ID No. 3 between the 84th-3617th of sequence 2; the deletion haplotype is that there is no insertion in the genome sequence 2 (SEQ ID No. 2 at the 84th-3617th position.
[0114] The genome of the deletion type (also known as deletion genotype or deletion type) has the following characteristics: the two homologous chromosomes of the genome have the following characteristics: the nucleotide between the 84th-3617th of sequence 2 (SEQ ID No. 2) is not an insertion of 3534 nucleotides of SEQ ID No. 3. The genotype of the wheat is a deletion type single plant.
[0115] The genome of the insertion type (also known as insertion genotype or insertion type) has the following characteristics: the two homologous chromosomes of the genome have the following characteristics: the nucleotide between the 84th-3617th of sequence 2 (SEQ ID No. 2) is an insertion of 3534 nucleotides of SEQ ID No. 3. The genotype of the wheat is an insertion type single plant.
[0116] The sequence of the amplified product is only 300bp, which is sequence 1, and is as follows:
[0117] AGAAGATACCACACCAACACCACCAAGTTGTGTGAGCCACACAGACGGAArGGAGCCCTCGTGTCCGGCTCGTGGTCGCGGGATGsCGAGGCCCACkyAGCCCGGCCCACCGCGCCGTGGCCACCCACTATTATATGCTCGGATACGGCCGCCTCACCCCACCCGCCGGCGCAGCAAGCAGAGCGGCAGCAGCAGCAATGGCGCGCCTGCTCCTCCCCCAATGCTGCTGCGGCCTCACGCCCCTGCCCCTCCCGCGCCGCGCCGTCGCGCTCCCTCCCCCGGCCCTATTTCCCTCCTCCT.
[0118] The sequence of the amplified product is only 3834bp, which is sequence 2, and is as follows:
[0119]
[0120] As described above, the present application develops a molecular marker related to heat tolerance of wheat, which is an Indel molecular marker. The Indel molecular marker can identify two haplotypes, namely insertion haplotype and deletion haplotype.
[0121] The insertion sequence is sequence 3 (SEQ ID No. 3), that is, sequence 3 is inserted between the 83rd-84th of sequence 1. The insertion of sequence 3 makes sequence 1 on the genome mutate into sequence 2. Among them, sequence 3 is the 84th-3617th of sequence 2, that is, the nucleotide sequence between the 84th-3617th of sequence 2 is an insertion of 3534 nucleotides of sequence 3 (SEQ ID No. 3); the deletion haplotype is that there is no insertion of sequence 3 at the 83rd-84th of sequence 1 (SEQ ID No. 1) in the genome.
[0122] Sequence 3 is as follows:
[0123]
[0124] The two homologous chromosomes of the genome of the deletion type (also referred to as deletion genotype or deletion type) are characterized in that the absence of nucleotides between the 83rd and 84th positions of sequence 1 (SEQ ID No. 1) in the genome is an insertion of 3534 nucleotides of sequence 3 (SEQ ID No. 3). The wheat with the genotype of the deletion type is a deletion type single plant.
[0125] The two homologous chromosomes of the genome of the insertion type (also referred to as insertion genotype or insertion type) are characterized in that the presence of nucleotides between the 83rd and 84th positions of sequence 1 (SEQ ID No. 1) in the genome is an insertion of 3534 nucleotides of sequence 3 (SEQ ID No. 3). The wheat with the genotype of the insertion type is an insertion type single plant.
[0126] The two homologous chromosomes of the genome of the hybrid type (also referred to as hybrid genotype or hybrid type) are characterized in that one of the homologous chromosomes is characterized in that the presence of nucleotides between the 83rd and 84th positions of sequence 1 (SEQ ID No. 1) in the genome is an insertion of 3534 nucleotides of sequence 3 (SEQ ID No. 3); the other homologous chromosome is characterized in that the absence of nucleotides between the 83rd and 84th positions of sequence 1 (SEQ ID No. 1) in the genome is an insertion of 3534 nucleotides of SEQ ID No. 3. The wheat with the genotype of the hybrid type is a hybrid type single plant.
[0127] The heat resistance of the genotype of the insertion type wheat is higher than or is expected to be higher than that of the genotype of the deletion type wheat.
[0128] Example 2 Verification of molecular markers
[0129] 1. Source of materials
[0130] A RIL population constructed using heat-resistant wheat material TAM107 and heat-sensitive wheat material Luzi 238 is used for detection. Luzi 238 is described in the non-patent document "Wang Xiaowei et al., Development and application of wheat AFLP-SCAR markers [J]. Journal of Cereal Science and Technology, 2008 (05): 738-744." TAM107 is described in the non-patent document "Wang Fei et al., Differences in membrane permeability and membrane lipid components of heat-resistant and heat-sensitive genotypes of wheat under high temperature stress [J]. Journal of Agricultural Biotechnology, 2013. DOI: 10.3969 / j.issn.1674-7968.2013.08.003." The public can obtain it from the applicant to repeat the test, and it cannot be used for other purposes.
[0131] 2. Phenotypic identification of chlorophyll fluorescence parameters of RIL population
[0132] The RIL populations derived from Lujiz238 and TAM107 were sowed in the greenhouse (Lujiz238 and TAM107 were sowed normally, Lujiz238 was used as the female parent and TAM107 was used as the male parent to hybridize and harvest seeds, the F7 generation population was obtained by single-seed descent method for subsequent research, and the specific process was shown in Table 2). After normal growth for 7 days under the conditions of day / night: 12h / 12h, 22℃ / 18℃, each RIL line was divided into two groups on average, and 3cm leaves were taken as samples from each group. One group was used as the control group, and the chlorophyll fluorescence parameters were detected by FluorCam closed chlorophyll fluorescence imaging system (Photon Systems Instruments, Czech) after 30 minutes of dark adaptation at room temperature. The other group was used as the treatment group, and the chlorophyll fluorescence parameters of the leaves were detected by the above method after 1h of lightless and 42℃ water bath treatment. The results of heat tolerance detection of the parents were shown in Table 1, and the data of single plant were shown in Table 2. The data results were processed by SPSS11.5 statistical software, and the experimental results were expressed as mean ± standard deviation. Student's t test was used, P<0.05 represented significant difference, P<0.01 represented extremely significant difference, and P<0.001 represented extremely significant difference. The results were shown in Table 1. Figure 4
[0133] F v / F m The detection was carried out in the FluorCam chlorophyll fluorescence imager. The measurement light pulse (PPFD 0.09μmol m -2 ) provided the measurement value of the minimum chlorophyll fluorescence (F0), and the subsequent saturation light pulse (PPFD 5500μmol m -2 ) provided the measurement value of the maximum chlorophyll fluorescence (F m ). The variable fluorescence (F v ) was calculated as F m -F0, and the chlorophyll fluorescence parameter was calculated as F v / F m . All the fluorescence parameters measured in this way were averaged on the whole leaf sample.
[0134] The decrease rate (%)=(F v / F m of the control group-F v / F m of the treatment group)*100%.
[0135] 3. Verification of TAM-TaFAD8-7 marker
[0136] The genomic DNA of the leaves of the wheat material in step 2 was extracted.
[0137] After the above RIL populations derived from TAM107 and Lujiz238 were tested for chlorophyll fluorescence parameters in the greenhouse, genomic DNA was extracted, and about 1 cm of leaves from each RIL line was taken as a sample for extraction of genomic DNA:
[0138] 1) Take an appropriate amount of wheat leaves and place them in a 2.0 mL centrifuge tube with a 6 mm steel ball. Cover the tube and cool it in liquid nitrogen. Then, put it in a sample grinder for grinding;
[0139] 2) Add 800 uL of CTAB extraction solution to the sample and mix well. Place it in a 65°C water bath and invert and mix every 10 min for a total of three times;
[0140] 3) After taking out the sample, add 600 uL of 24:1 (chloroform: isopropyl alcohol ratio) extraction solution. Invert and mix for 5 min, then stand at room temperature for 5 min;
[0141] 4) After standing and layering, centrifuge at 12000 rpm for 10 min;
[0142] 5) After centrifugation, transfer 500 uL of supernatant to a 1.5 mL centrifuge tube. Add an equal volume of pre-cooled isopropyl alcohol, invert and mix, then place in a refrigerator at -20°C for 30 min;
[0143] 6) Cool the centrifuge to 4°C in advance, and centrifuge at 12000 rpm for 10 min. Discard the supernatant and add 1 mL of 75% ethanol. Suspend gently and centrifuge at 12000 rpm for 2 min, repeat once;
[0144] 7) Discard the supernatant and dry at room temperature. Dissolve with deionized water;
[0145] 8) Adjust the concentration to make the DNA concentration of each RIL line 200 ng / uL and store at -20°C.
[0146] In the treatment group, 23 RIL lines with high and 23 RIL lines with low chlorophyll fluorescence parameters were selected, and the DNA of the above population was mixed into 2 extreme pools. The DNA samples of the extreme pools were resequenced by Shenzhen Huada Gene Technology Co., Ltd. Through bioinformatics analysis, the genetic interval associated with wheat heat tolerance was determined. BSA-seq results showed that among the 21 chromosomes of wheat, a strong differential signal peak appeared at 34Mb-44Mb of the short arm of 2D chromosome, indicating that this interval is a candidate interval that may affect wheat heat tolerance (results shown in Figure 1 According to the annotation information of the Chinese Spring reference genome, the candidate interval contains the gene TaFAD8 that affects wheat heat tolerance (results shown in Figure 2 .
[0147] 4. Genotype identification of RIL population
[0148] The DNA template obtained above was amplified using primer pair TAM-TaFAD8-7 (primer pair TAM-TaFAD8-7 consists of TAM-TaFAD8-7F and TAM-TaFAD8-7R; wherein TAM-TaFAD8-7F is a single-stranded DNA molecule represented by SEQ ID NO. 6, and TAM-TaFAD8-7R is a single-stranded DNA molecule represented by SEQ ID NO. 7).
[0149] The PCR amplification procedure was as follows: pre-denaturation at 98℃ for 5 min; denaturation at 98℃ for 15 s, annealing at 59℃ for 15 s, elongation at 68℃ for 2 min, for 34 cycles; and elongation at 68℃ for 10 min.
[0150] The PCR amplification system was 10 μL, and the components thereof were as follows: 1 μL of 100 ng / μL genomic DNA, 5 μL of 2×Gflex PCR Buffer (Mg2+, dNTP plus), 1.0 μL of 10 ng / μL upstream primer, 1.0 μL of 10 ng / μL downstream primer, 0.5 μL of TksGflex DNA Polymerase (Takara, Dalian), and 1.5 μL of dd H2O.
[0151] The amplification product was separated on a 2% agarose gel at a voltage of 150 V for 10 min. The results were recorded by using a gel imaging system. DNA fragments with lengths of 300 bp and / or 3834 bp were obtained by amplification.
[0152] If the amplification product is only a band of 300 bp, the wheat to be tested is a deletion type; if the amplification product is only a band of 3834 bp, the wheat to be tested is an insertion type; and if the amplification product contains both bands of 300 bp and 3834 bp, the wheat to be tested is a hybrid type.
[0153] The amplification band of the deletion type (also referred to as a deletion genotype or a deletion type) of wheat is an A band, the amplification band of the insertion type (also referred to as an insertion genotype or an insertion type) of wheat is a B band, and the amplification band of the hybrid type (also referred to as a hybrid genotype or a hybrid type) of wheat is an AB band.
[0154] The heat tolerance of the genotype of the insertion type wheat is higher than or is a candidate for being higher than the heat tolerance of the genotype of the deletion type wheat.
[0155] The amplification product of Lusi 238 is an A band type, and the amplification product of TAM107 is a B band type, and part of the RIL population derived from the two is of the A band type, and part of the RIL population derived from the two is of the B band type.
[0156] The chlorophyll fluorescence parameters of the treatment group and the control group were statistically analyzed with the genotypes, and the results are shown in Table 1 and Table 2. The results show that the chlorophyll fluorescence parameters of the RIL population of the two types of bands in the control group have no significant difference; the chlorophyll fluorescence parameters of the RIL population of the treatment group have significant difference, and the average value of the chlorophyll fluorescence parameters of the RIL population of the B type is significantly higher than that of the RIL population of the A type.
[0157] Table 1 is the statistical results of the chlorophyll fluorescence parameters of the RIL lines of the control group and the treatment group
[0158]
[0159] The above data show that the heat tolerance of the RIL line of the TAM107 genotype is higher than or higher than that of the RIL line of the Luzi 238 genotype, which is consistent with the genotype identification results.
[0160] Table 2 Genotype and related phenotype of 136 samples of Luzi 238 and TAM107 and RIL population derived therefrom
[0161]
[0162]
[0163]
[0164]
[0165] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.
Claims
1. Use of any one of the following of the InDel molecular marker: A1) in identifying heat tolerance of wheat; A2) in heat tolerance breeding of wheat; The InDel molecular marker is a DNA molecule with a nucleotide sequence of positions 84-3617 in SEQ ID No.
2.
2. Use of any one of the following of the substance for detecting the InDel molecular marker: A1) in identifying heat tolerance of wheat; A2) in preparing a product for identifying heat tolerance of wheat; A3) in preparing heat tolerance breeding product of wheat; The InDel molecular marker is a DNA molecule with a nucleotide sequence of positions 84-3617 in SEQ ID No.
2.
3. Use according to claim 2, characterized in that, The substance for detecting the InDel molecular marker is the following D1), D2), D3) or D4): D1) contains specific amplification of InDel molecular marker in vitro nucleic acid amplification primer; D2) contains D1) in vitro nucleic acid amplification reagent of the in vitro nucleic acid amplification primer; D3) contains D1) the in vitro nucleic acid amplification primer or D2) the in vitro nucleic acid amplification reagent of the kit; D4) contains D1) the in vitro nucleic acid amplification primer, D2) the in vitro nucleic acid amplification reagent or D3) the detection instrument of the kit.
4. Use according to claim 3, characterized in that, The in vitro nucleic acid amplification primer comprises primer pair TAM-TaFAD8-7: The primer pair TAM-TaFAD8-7 consists of TAM-TaFAD8-7F and TAM-TaFAD8-7R; TAM-TaFAD8-7F is a single-stranded DNA with a nucleotide sequence of SEQ ID No. 6 in the sequence listing; TAM-TaFAD8-7R is a single-stranded DNA with a nucleotide sequence of SEQ ID No. 7 in the sequence listing.
5. A method for identifying heat tolerance in wheat, characterized in that, The method comprises detecting the genotype of the InDel molecular marker in claim 1 in the wheat genome, identifying the heat tolerance of wheat according to the genotype of the InDel molecular marker in claim 1 in the wheat genome: The genotype of the insertion type wheat is higher or candidate higher than the genotype of the deletion type wheat in heat tolerance, the insertion type is homozygous type of the insertion of SEQ ID No. 3 between positions 83-84 of SEQ ID No. 1, and the deletion type is homozygous type of the absence of the insertion of SEQ ID No. 3 between positions 83-84 of SEQ ID No.
1.
6. A method for heat tolerance breeding of wheat, comprising selecting wheat with the genotype of the insertion type in claim 5 as a parent for breeding.
7. A method for breeding wheat for heat tolerance, characterized in that: Substituting the region of SEQ ID No. 1 in the wheat genome of interest with SEQ ID No. 2, a wheat with stronger heat tolerance than the wheat of interest is obtained.
Citation Information
Patent Citations
Molecular marker primer of wheat heat resistance major gene locus TaHST1 and application of molecular marker primer
CN112195259A
Functional marker for detecting wheat high-temperature-resistant gene TaBZR2-3B
CN118685554A