SNP-C682T associated with wheat grain number per spike and its application

By discovering the SNP-C682T site in the wheat genome, and designing PCR amplification and enzyme cleavage identification methods, the problem of increasing wheat ear grain number was solved, efficient molecular marker-assisted selection was achieved, and wheat yield was improved.

CN119410814BActive Publication Date: 2025-08-12HEBEI NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411581801.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-07
Publication Date
2025-08-12
Estimated Expiration
2044-11-07

AI Technical Summary

Technical Problem

The prior art is difficult to effectively increase the number of wheat ear grains, especially in high-temperature and drought environments, and there is a lack of effective molecular marker-assisted selection methods to improve wheat yield.

Method used

The SNP-C682T site in the wheat genome was discovered and used to design specific primer combinations and enzyme cleavage components, and wheat genotypes were identified through PCR amplification and enzyme cleavage, providing dCAPS markers to assist in the selection of high-spike grain varieties.

Benefits of technology

By detecting the SNP-C682T site, wheat with high ear grains can be accurately identified and selected, providing a new method of molecular marker-assisted selection to improve wheat breeding efficiency and yield potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119410814B_ABST
    Figure CN119410814B_ABST
Patent Text Reader

Abstract

The present invention discloses a SNP‑C682T related to wheat grain number per spike and its application. The SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1. When the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B. The grain number per spike is: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B. The SNP of the present invention has high effectiveness and potential application value. By detecting the SNP, wheat with a larger grain number per spike can be found, which is of great value in the research or application of breeding high-yield wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, in particular to SNP-C682T related to wheat grain number per spike and applications thereof. Background Art

[0002] As an important grain crop in my country, increasing wheat yield is crucial for ensuring food security. Wheat yield is a complex trait comprised of the number of effective ears per unit area, the number of grains per ear, and grain weight. High temperatures and droughts can significantly affect grain number per ear. Therefore, the discovery of QTLs (quantitative trait loci) controlling wheat grain number and their superior alleles provides a theoretical basis for genetic improvement of grain number per ear using molecular marker-assisted selection. This is also crucial for increasing wheat yield potential and achieving high and stable yields.

[0003] Huang Lin et al. created a RIL population by crossing Shumai 126, a white-grain wheat variety approved in Sichuan Province with high yield potential, with Taichang 29 for genotyping analysis. Using a wheat 55K SNP array, they constructed a genetic linkage map. Combined with phenotypic data for yield-related traits from multiple years and environments, they identified a major locus for spike length, QSL.sicau-TS-6D, and a major locus for spikelet number, QSNS.sicau-TS-2D. Furthermore, they located a major QTL for kernel width and another for 1000-kernel weight on chromosome 1B, both located within a 2.73-Mb region between 667.64 and 670.37 Mb on chromosome 1B.

[0004] Lin Yu et al. used H461 and Chinese Spring as parents to construct 300 recombinant inbred line populations, and detected three QTL loci for grain number per ear under multiple environments, located on chromosomes 2B, 2DS and 2DL, respectively. These loci explained 3.07% to 26.57% of the phenotypic variation; among them, the major effect locus QGns.sicau-2D-2 located in the AX-109316972-AX-110906716 interval of chromosome 2D was detectable in all environments, explaining 19.59% to 26.57% of the phenotypic variation; another stable locus QGns.sicau-2B was located in the AX-108770043-AX-108927717 interval of chromosome 2B, which was also detected in all environments and explained 3.32% to 9.36% of the phenotypic variation. Xu et al. constructed 248 recombinant inbred line populations using Bima4 and Aikang 58 as parents and discovered a QTL for grain number per ear on chromosome 4A, which explained an average of 9.78% to 24.24% of the phenotypic variation.

[0005] Deng S. et al. constructed a population by hybridizing the introgression line 05210 with the wheat variety Laizhou953 and identified that the QTLs for the number of ears per plant, ear length and number of grains per ear were co-located on chromosome 4BL, explaining 30.1% to 67.6% of the phenotypic variation and were key QTLs affecting the number of ears and large ear phenotype.

[0006] Yang L. et al. constructed a RIL containing 266 lines using the wheat variety ZM871 and its sister line ZM895. They used the wheat 660KSNP chip to construct a genetic linkage map and combined with phenotypic data to identify a new QTL for grain number per spike on chromosome 5BS. The map was then verified in the BC1F4 population, laying the foundation for genetic positioning research on wheat yield traits. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide SNP-C682T related to wheat grain number and its application.

[0008] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0009] A SNP site associated with wheat grain number per spike, the SNP site corresponding to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1; when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for T / T, the corresponding genotype is B; the grain number per spike is such that wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B.

[0010] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the wheat grain number trait, which is used to detect the SNP site described in claim 1, and the reagent or kit contains a PCR amplification specific primer combination and enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0011] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 561-711 bp at the 5' end of SEQ ID NO.1.

[0012] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0013] As a preferred technical solution of the present invention, the enzyme cutting component is the restriction endonuclease SalⅠ.

[0014] On the other hand, the present invention also includes a primer combination for detecting the single nucleotide polymorphism of the following SNP site in the wheat genome, wherein the SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1. When the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

[0015] On the other hand, the present invention also includes a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment containing the SNP site of claim 1 in the wheat genomic DNA to be tested is PCR amplified, and the PCR amplification product is subjected to enzyme digestion and identification.

[0016] As a preferred technical solution of the present invention, the DNA fragment amplified by PCR is 561-711bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0017] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template, and amplifying the PCR product with primers 2F and 2R as a primer pair to obtain a PCR product; using the restriction endonuclease SalⅠ to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is T / T and the genotype is B; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is A; the size of the number of grains per ear is: the wheat homozygous for genotype A is larger than, or the candidate is larger than, the wheat homozygous for genotype B.

[0018] In the final aspect, the present invention also includes the use of the SNP site in identifying or assisting in identifying the wheat grain number trait.

[0019] The beneficial effect of adopting the above technical solution is that: the research and development team of the present invention discovered a SNP through genetic variation analysis of genes in a natural variation population of wheat, corresponding to position 682 from the 5' end of Sequence Table 1. This SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis has shown that in the homozygous types of these two genotypes, the number of grains per ear is as follows: wheat homozygous for genotype A is greater than, or is candidate greater than, wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of grains per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research for breeding high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a schematic diagram of the gene structure pattern and SNP site of the present invention;

[0021] Figure 2 This is the electrophoresis detection result of the SNP development dCAPS labeling enzyme digestion product of the present invention; wherein, M is used as a molecular weight standard; lane T is the band cut by SalⅠ, and lane C is the band that cannot be cut by SalⅠ;

[0022] Figure 3 This is a schematic diagram of the correlation analysis of grain number per ear according to the present invention;

[0023] Figure 4 It is a schematic diagram of gene SNP sites and typing in the wheat population material of the present invention. DETAILED DESCRIPTION

[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through commercial purchase. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial channels. It should be understood that when used in this specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in this specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0025] As used in this specification and the appended claims, the term "if" can be interpreted as "when..." or "upon..." or "in response to determining..." or "in response to detecting," depending on the context. Similarly, the phrases "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "upon determination," "in response to determining," or "upon detecting [the described condition or event]," or "in response to detecting [the described condition or event]," depending on the context. In addition, in the description of this specification and the appended claims, the terms "first," "second," "third," etc. are used solely to distinguish descriptions and are not to be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in one or more embodiments of the present application. Thus, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in other embodiments," etc., appearing at different locations in this specification, do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "include", "comprising", "having" and variations thereof mean "including but not limited to", unless specifically emphasized otherwise.

[0026] Example 1. Detection of SNPs Related to Wheat Grain Number and Their PCR-enzyme Digestion Polymorphisms

[0027] 1. Specific primers for amplifying the genomic fragment containing the wheat SNP and sequence analysis

[0028] A SNP was found in the wheat genome, corresponding to position 682 from the 5' end of Sequence Listing 1, see Figure 1 ; This locus has two genotypes in the natural variation population of wheat:

[0029] Genotype A: C

[0030] Genotype B: T

[0031] Based on the sequence differences of different wheat genomes, specific primers were designed to PCR amplify DNA fragments containing the SNP sites:

[0032] F1: CCATTGAACGGCGAGCTCCAGTTGTTGGAGTACC (SEQ ID NO. 2);

[0033] R1: GGTTAGATCTTCTATATATATGTTGCCCTATGG (SEQ ID NO.3)

[0034] F2: CCTCTGGATGATCAGCGACCTCCTTGGGGCGCCTCG (SEQ ID NO.4)

[0035] R2: TACGACATCGCGGCGATCAAGTTCCGTCG (SEQ ID NO.5)

[0036] The target sequence amplified by PCR using primers F1 and R1 is shown in the sequence listing as positions 8-1049 of SEQ ID NO: 1; the target sequence amplified by PCR using primers F2 and R2 is shown in the sequence listing as positions 561-711 of SEQ ID NO: 1. Enzyme digestion analysis showed that the polymorphisms were recognized by Sal I.

[0037] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping methods

[0038] 1) Extracting genomic DNA from the wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (10 μL) was as follows: ddH2O μL, 1 μL 10× PCR Buffer, 0.3 μL each of primer F1 (5 μmol / L) and primer R1 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0040] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s, for 32 cycles; 72°C for 10 min, and storage at 16°C.

[0041] 3) The PCR product from step 2) was diluted 100-fold and used as a template for PCR amplification using primers F2 and R2. The PCR amplification system (10 μL) was as follows: ddH2O μL, 1 μL 10× PCR Buffer, 0.3 μL each of primers F2 (5 μmol / L) and R2 (5 μmol / L), 0.6 μL dNTPs (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0042] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 10 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0043] 4) The PCR product obtained in step 3) was digested with Sal I to obtain the digestion product, which was detected by 4% agarose gel electrophoresis. It was recorded whether the PCR product was cut into two fragments. The status of the wheat to be tested at the site was determined and recorded according to the following method:

[0044] If the enzyme digestion product is 121 bp, the wheat to be tested is T homozygous (expressed as T / T) at the site (e.g. Figure 2 Lane T in the middle);

[0045] If the enzyme digestion product is 151 bp, the wheat to be tested is C homozygous (expressed as C / C) at the site (e.g. Figure 2 Lane C in the figure).

[0046] According to the results of step 4), the wheat is divided into two types, I and II, as follows:

[0047] I: C / C (i.e., homozygous for genotype A);

[0048] II: T / T (i.e., homozygous for genotype B);

[0049] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0050] 3. Use dCAPs markers to genotype natural populations and conduct association analysis with the trait of grain number per spike

[0051] Each wheat in a natural population of 320 hexaploid wheats was used as the test wheat, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0052] Table 1 The situation of the polymorphic sites in natural wheat populations

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 2

[0059] Our technical team conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials, including genotype A homozygous C / C and genotype B homozygous T / T. Figure 4 Among all 385 materials, 373 materials could be clearly distinguished as homozygous C / C genotype A or homozygous T / T genotype B, and the remaining 12 materials could not complete genotyping.

[0060] In addition, 320 of these 385 materials have multi-year and multi-point agronomic trait data, while the remaining 65 materials cannot meet the requirements of subsequent analysis due to insufficient data. Figure 3 As shown in the figure, only these 320 data points were used in the association analysis between the status of gene polymorphism sites in natural populations and the number of ears per plant.

[0061] In 2018, the above natural population wheat was planted in arid and hot land, dry land, hydrothermal land and water land at the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei); in 2019, it was planted in water land and dry land at the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Hengshui, Hebei); in 2020, it was planted in arid and hot land, dry land, hydrothermal land and water land at the Institute of Crop Sciences of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of grains per ear of each wheat variety was investigated, and the association analysis between the number of grains per ear and the polymorphic loci was performed using Tassel2.1 software. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2 and Table 2. Figure 3 shown.

[0062] Table 2 Results of association analysis between gene polymorphisms in natural populations and grain number per spike

[0063]

[0064]

[0065] The results of the association analysis in Table 2 indicate that the difference in grain number per spike between the two types of wheat from the natural population of 320 hexaploid wheat accessions shown in Table 1 reached a significant level (P < 0.05) in eight environments. Specifically, the grain number per spike of wheat in Type I was higher than that of wheat in Type II. Across these eight environments, the grain number per spike of wheat in Type I was 2.74, 2.42, 1.58, 1.96, 3.10, 3.25, 3.24, and 3.31 higher than that of wheat in Type II, respectively. Studies of natural populations indicate that Type I is an excellent genotype for increasing grain number per spike in wheat.

[0066] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0067] From the above examples, it can be seen that the present invention has discovered a SNP through genetic variation analysis of genes in a natural variation population of wheat, corresponding to position 682 from the 5' end of Sequence Table 1. This SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis has shown that in the homozygous types of these two genotypes, the number of grains per ear is: wheat homozygous for genotype A > wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of grains per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research.

[0068] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. A reagent or kit for identifying or assisting in identifying the wheat grain number trait, characterized in that: The reagent or kit is used to detect a single nucleotide polymorphism (SNP) site, which corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for T / T, the corresponding genotype is B. The number of grains per ear is such that wheat homozygous for genotype A is greater than, or potentially greater than, wheat homozygous for genotype B. The reagent or kit comprises a PCR amplification specific primer combination and an enzyme digestion component corresponding to the SNP site, as well as template DNA, a buffer, dNTPs, and other necessary components for gene detection. The target DNA fragment amplified by PCR with this reagent or kit is designed to be 561-711 bp from the 5' end of SEQ ID NO.1; The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; The enzyme cutting component is the restriction endonuclease SalⅠ.

2. A primer combination, characterized in that: Used to detect the single nucleotide polymorphism of the following SNP site in the wheat genome, the SNP site corresponds to the 682nd base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

3. A method for identifying or assisting in identifying wheat genotypes, characterized in that: Performing PCR amplification on any DNA fragment containing the SNP site according to claim 1 in the wheat genomic DNA to be tested, and performing enzyme digestion identification on the PCR amplification product; The DNA fragment amplified by PCR is 561-711 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; The enzyme digestion comprises the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using the restriction endonuclease SalⅠ to digest the PCR product; if the PCR product can be digested, the nucleotide polymorphic site is T / T and the genotype is B; if the PCR product cannot be digested, the nucleotide polymorphic site is C / C and the genotype is A; the size of the number of grains per ear is: the wheat homozygous for genotype A is larger than, or the candidate is larger than, the wheat homozygous for genotype B.

4. The use of the SNP site according to claim 1, characterized in that: The wheat grain number trait is identified or assisted in identifying based on the detection of the SNP site genotype.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) site related to grain number per ear of wheat and application of SNP site

    CN118600098A

  • Plants Having Enhanced Yield-Related Traits And A Method For Making The Same

    US20120124702A1