Molecular marker chro01-43706671 primer combination for identifying low chilling peach varieties and application thereof

Abstract

The application discloses a Chr01-43706671 molecular marker for identifying a peach variety with low chilling requirement, a sequence of which is shown in SEQ ID NO. 4. A set of molecular marker Chr01-43706671 primer combinations for identifying a peach variety with low chilling requirement is also disclosed, which comprises a forward primer shown in SEQ ID NO. 1-2 and a common reverse primer shown in SEQ ID NO. 3. Applications thereof are also disclosed. The molecular marker and the primer provided by the application can be used for identifying a peach chilling requirement trait, can identify a peach with low chilling requirement with a high probability, improve a breeding process of a peach variety with low chilling requirement, significantly improve breeding efficiency, provide a reliable method for breeding a peach variety with low chilling requirement, and meet the needs of sustainable development of a peach industry planted in the south and climate warming.

Description

TECHNICAL FIELD

[0001] The present application relates to a set of molecular markers Chr01-43706671 primer combination for identifying low chilling peach varieties and its application, belonging to the field of molecular biology. BACKGROUND

[0002] Peach (Prunus persica (L.) Batsch) is the third largest deciduous economic fruit tree in the world, mainly distributed in the temperate zone between 30° and 45° north and south latitude. Under the background of rising temperature year by year, peach planting extending to the south and facility cultivation expanding, in order to ensure that peach breaks dormancy smoothly to normal growth and production, it is urgent to speed up the breeding of low chilling peach.

[0003] At present, there are very limited records of SNP markers for low chilling peach. The stability and effectiveness of existing markers in larger populations, more complex genetic backgrounds or different environments are not high. Stable and effective molecular markers for peach chilling requirement are still lacking, which affects the rapid and effective identification of low chilling peach and to some extent restricts the sustainable development of peach industry. SUMMARY

[0004] The purpose of the present application is to provide a set of Chr01-43706671 molecular markers and primer combinations for identifying low chilling peach varieties. The low chilling peach variety refers to a peach variety with chilling requirement < 400 h, and the variety with chilling requirement < 300 h is defined as an extremely low chilling peach variety.

[0005] To achieve the above purpose, the technical solution adopted by the present application is:

[0006] The Chr01-43706671 molecular marker for identifying low chilling peach varieties has the sequence shown in SEQ ID NO. 4.

[0007] The Chr01-43706671 molecular marker described above is used in identifying low chilling peach varieties.

[0008] And a set of molecular markers Chr01-43706671 primer combination for identifying low chilling peach varieties, including the forward primers shown in SEQ ID NO. 1-2 and the common reverse primer shown in SEQ ID NO. 3.

[0009] Preferably, different fluorescent signal tags are added to the 5' ends of the two forward primers.

[0010] Preferably, the fluorescent signal tags are FAM and VIC.

[0011] The application also discloses application of the molecular marker Chr01-43706671 primer combination in identifying peach varieties with low cold requirement.

[0012] Preferably, the steps comprise:

[0013] (1) primer synthesis: synthesizing the molecular marker Chr01-43706671 primer combination;

[0014] (2) DNA extraction: extracting peach genomic DNA to be identified;

[0015] (3) KASP reaction: using the genomic DNA extracted in step (2) as a template, and performing KASP reaction by using the molecular marker Chr01-43706671 primer combination;

[0016] (4) KASP product detection and analysis: detecting the genotyping of the amplification product, and selecting a variety with G:G genotyping for subsequent breeding;

[0017] The steps (1) and (2) are not required to be in sequence.

[0018] The application also discloses application of a molecular marker primer combination in identifying peach varieties with low cold requirement, wherein the molecular marker primer combination comprises the molecular marker Chr01-43706671 primer combination and a molecular marker Chr01:46470090 primer combination.

[0019] Preferably, different fluorescent signal tags are added to the 5' ends of the two forward primers of the molecular marker Chr01:46470090 primer combination.

[0020] The application also discloses a kit comprising the molecular marker Chr01-43706671 primer combination or comprising the molecular marker Chr01-43706671 primer combination and the molecular marker Chr01:46470090 primer combination.

[0021] The KASP molecular marker and the KASP primer for low chilling requirement peach provided by the application have the following advantages: since the juvenile period of peach is 3-4 years, the chilling requirement evaluation must be evaluated for many years after adulthood and the traditional evaluation method is cumbersome, therefore, it is very important to determine the chilling requirement in the seedling stage. The Chr01-43706671 molecular marker associated with the chilling requirement of peach is screened out, and the corresponding identification primer is designed by using the same, which can be used for identifying the chilling requirement trait of peach, avoiding the high chilling requirement peach, and accelerating the breeding process of low chilling requirement peach, significantly improving the breeding efficiency, and especially having a very high success rate of identifying the extremely low chilling requirement peach variety. Compared with the traditional field natural observation, the application can quickly identify the low chilling requirement peach. And the operation is convenient, which lays a foundation for the directional breeding of low chilling requirement peach, especially the extremely low chilling requirement peach, accelerates the breeding process, significantly improves the breeding efficiency, and promotes the development of the peach industry. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 GWAS analysis Manhattan plot of SNP sites in the application.

[0023] Figure 2 Gene sequence comparison results of the molecular marker site in the application.

[0024] Figure 3 KASP genotyping detection results of 287 peaches by using the KASP primer in the application.

[0025] Figure 4 Distribution diagram of chilling requirement of different genotypes.

[0026] Figure 5 One generation sequencing genotyping diagram of two positive controls. DETAILED DESCRIPTION

[0027] The specific embodiments of the application will be further described in conjunction with the accompanying drawings, but the description of the embodiments does not produce any limitation on the protection scope of the application.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0029] The substances or instruments used in the following examples, if not specially stated, can be obtained from conventional commercial channels.

[0030] Example 1 Development of KASP molecular marker primer

[0031] Firstly, 213 peach natural populations with rich chilling requirement diversity were locked, and the chilling requirement traits of the 213 peach were phenotypically evaluated; then, based on resequencing, combined with the phenotype, GWAS analysis was performed to mine significant SNPs, and the Chr01-43706671 SNP site was successfully located to be significantly related to the chilling requirement, and the Manhattan plot of the GWAS location thereof is shown in Figure 1 The SNP site is shown at the arrow, which is located at the position of 43706671 bp on the reference genome of the first chromosome of peach, and the information of the Chr01-43706671 SNP site is G / T. The sequence of the Chr01-43706671 molecular marker is shown in SEQ ID NO. 4, and K in SEQ ID NO. 4 represents G / T. The gene sequence of the site where the Chr01-43706671 molecular marker is located and the primer design idea are shown in Figure 2 According to the KASP primer design principle, the Primer software is used to design the primer. The forward primer of the designed Chr01-43706671 has two, which are named Chr01-43706671-F1 and Chr01-43706671-F2, respectively, and the reverse primer is Chr01-43706671-R. The nucleotide sequences of the three primers are as follows:

[0032] The KASP primer sequences are as follows (5'→3'):

[0033] Chr01-43706671-F1 (SEQ ID NO. 1): CCATTCTCTGCTTTTTGCTTTATAT;

[0034] Chr01-43706671-F2 (SEQ ID NO. 2): CCATTCTCTGCTTTTTGCTTTATAG;

[0035] Chr01-43706671-R (SEQ ID NO. 3): TTTTCTGTTTAAAAACTCCATTCATC.

[0036] In order to distinguish different genotypes, FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO. 5) modification is further added to the 5' end of Chr01-43706671-F1, and VIC (GAAGGTCGGAGTCAACGGATT, SEQ ID NO. 6) modification is further added to the 5' end of Chr01-43706671-F2.

[0037] Example 2: Genotyping measurement and analysis of peach Chr01-43706671 molecular marker related gene

[0038] A total of 287 peach natural populations with rich genetic background (including cultivated varieties, local varieties and wild resources from China, the United States, Thailand and other countries, and belonging to Prunus persica, P. davidiana, P. mira and P. humilis germplasm types) were used as test materials to determine the phenotypes of chilling requirement. There were 39 low chilling requirement peaches with chilling requirement < 400 h, among which 22 were very low chilling requirement peaches with chilling requirement < 300 h, and 248 were non-low chilling requirement peaches with chilling requirement ≥ 400 h. The DNA of 287 peach materials was extracted by CTAB method, and the whole batch of DNA samples was diluted to a concentration of 1-9 ng / μL in proportion. KASP genotyping was performed using the KASP primer of Chr01-43706671 molecular marker developed in Example 1.

[0039] PCR amplification was performed using the above 3 KASP primers.

[0040] PCR reaction system:

[0041]

[0042] Among them, the primer combination is to dilute the primers to 10 μM with TE (pH 8.0) respectively, and then mix them according to the ratio of Chr01-43706671-F1-FAM: Chr01-43706671-F2-VIC: Chr01-43706671-R = 1:1:3. Among them, 1.25 μl of buffer TE is used to replace sample DNA in the negative control; the positive control is selected from peach materials that are SNP genotyped by first-generation sequencing (included in the 287 peaches, including G:G genotype peach ‘Flordaglo’ and T:T genotype peach ‘Feichengbaili’ (SNP genotyping chart see Figure 5 PCR analysis was performed according to the instrument usage instructions of CFX ConnectTM Real-Time System (Bio-Rad, USA).

[0043] The PCR amplification program is: 95℃ pre-denaturation, 10min, 1 cycle; 95℃ denaturation for 20s; 61-55℃ annealing and extension for 60s, a total of 10 cycles; 95℃ denaturation for 20s, 55℃ annealing and extension for 60s, a total of 27 cycles; 25℃ reading for 30s, 1 cycle.

[0044] After the PCR reaction was completed, the CFX Manager TMSoftware (Bio-Rad, USA) reads the fluorescence signal intensity and determines the genotype based on the relative proportions of FAM and VIC fluorescence signals. Using KASP primer Chr01-43706671, a total of three genotypes were detected: G:G, G:T, T:T, and undetermined. Specifically, if the base G is detected at the site, it is the allele type connected to the FAM fluorescent tag sequence. At this time, the FAM fluorescence signal accounts for a high proportion, and the peach configuration to be tested is determined to be the homozygous genotype G:G; if the base T is detected, it is the allele type connected to the VIC fluorescent tag sequence. The VIC fluorescence signal accounts for a high proportion, and the peach configuration to be tested is determined to be the homozygous genotype T:T; if the bases G and T are detected at the same time, it is an intermediate type that is connected to the FAM fluorescent tag sequence and the VIC fluorescent tag sequence at the same time, and the peach configuration to be tested is determined to be the heterozygous genotype G:T; if no signal is detected, it is undetermined.

[0045] Related classification results can be found in Figure 3 and Table 1. Figure 3 It can be seen that the genotype is determined by detecting the two fluorescence intensities in the KASP product. Figure 3 Each point represents a piece of material to be tested. Figure 3 The genotypes represented by the various points are labeled. Blue points represent the homozygous G:G genotype, red points represent the homozygous T:T genotype, green points represent the heterozygous G:T genotype, black squares represent negative controls, and black crosses represent undetermined genotypes. Among the 287 samples, 36 strains had the G:G genotype, 249 strains had the T:T genotype, 1 strain had the G:T genotype, and 1 strain had the undetermined genotype.

[0046] Table 1 Typing results of 287 peach varieties

[0047]

[0048]

[0049]

[0050]

[0051] The cooling requirement distribution of different genotypes was statistically analyzed. The results are as follows: Figure 4 As shown, from Figure 4It can be seen that the peach with genotype G:G requires 381 ± 199 h of cold, the peach with genotype T:T requires 678 ± 153 h of cold, the peach with genotype G:T requires 556 h of cold, and the peach with genotype undetermined requires 591 h of cold. As can be seen from Table 1, there are 36 peaches with genotype G:G, including 27 peaches with low chilling requirement (chilling requirement < 400 h) (including 19 peaches with very low chilling requirement (chilling requirement < 300 h)), and 9 peaches with non-low chilling requirement (chilling requirement ≥ 400 h). There are 251 peaches with genotype T:T, including 12 peaches with low chilling requirement (chilling requirement < 400 h) (including 3 peaches with very low chilling requirement (chilling requirement < 300 h)), and 239 peaches with non-low chilling requirement (chilling requirement ≥ 400 h). There are 1 peach with genotype G:T and 1 peach with genotype undetermined, both of which are peaches with non-low chilling requirement (chilling requirement ≥ 400 h).

[0052] The data in Table 1 were analyzed and statistically processed to obtain Table 2, which clearly shows the identification effect of genotyping based on the KASP molecular marker Chr01-43706671 on peaches with low chilling requirement.

[0053] Table 2: Identification effect of Chr01-43706671 molecular marker on peaches with low chilling requirement

[0054]

[0055] Note: The proportion refers to the proportion of the number of peaches with various chilling requirements (including peaches with low chilling requirement (chilling requirement < 400 h) and peaches with non-low chilling requirement (chilling requirement ≥ 400 h), among which peaches with chilling requirement < 300 h are peaches with very low chilling requirement) identified by a certain genotype marker in the total number of peaches identified by the marker, which is equal to the number of peaches with various chilling requirements identified by a certain genotype marker / total number of peaches identified by the marker * 100%; the identification success rate refers to the success probability of identifying peaches with various chilling requirements by a certain genotype marker, which is equal to the number of peaches with various chilling requirements identified by a certain genotype marker / total number of peaches with the chilling requirement * 100%.

[0056] From Table 2, it can be seen that in the sample of G:G genotype of Chr01-43706671 marker, the low chilling requirement peach (chilling requirement < 400h) accounts for 75%, the identification success rate is 69.2%, among which the very low chilling requirement peach (chilling requirement < 300h) accounts for 52.8%, and the identification success rate of this type of peach is 86.4%; the non-low chilling requirement peach (chilling requirement ≥ 400h) accounts for 25%, and the identification success rate is 3.6%. The T:T genotype sample, G:T genotype sample and undetermined sample are mostly locked non-low chilling requirement peaches (chilling requirement ≥ 400h). Therefore, in general, the identification effect of G:G genotype of Chr01-43706671 marker is mainly concentrated in low chilling requirement peach trees, and the marker is very suitable for the assisted breeding of low chilling requirement peaches.

[0057] In addition, the Chr01-43706671 marker can be combined with the marker Chr01:46470090 (primer sequence: Chr01:46470090-forward primer 1 AAAATAAATCGTATCGCCGGGCAGT, SEQ ID NO. 7; Chr01:46470090-forward primer 2 AAAATAAATCGTATCGCCGGGCAGC, SEQ ID NO. 8; Chr01:46470090-common reverse primer AAAACACAGAGTATAGCCGGTTGG, SEQ ID NO. 9) in the patent (application number: CN2024114286008) applied by the inventor to further improve the identification and selection efficiency of low chilling requirement peaches. When used, FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO. 5) modification is added to the 5' end of Chr01:46470090-forward primer 1, and VIC (GAAGGTCGGAGTCAACGGATT, SEQ ID NO. 6) modification is added to the 5' end of Chr01:46470090-forward primer 2 for easy reading of data. At the same time, Chr01-43706671 and Chr01:46470090 are used to screen low chilling requirement peaches in the sample group to be tested, and the final locked sample group is identified as the union of G:G genotype of Chr01-43706671 marker and C:C and T:C genotypes of Chr01:46470090 marker. In the locked sample group, the identification success rate of low chilling requirement peaches (chilling requirement < 400h) can be as high as 80%, the proportion of this type of peach can be as high as 66%, the identification success rate of very low chilling requirement peaches (chilling requirement < 300h) in them can be as high as 100%, and the proportion of this type of peach is 47%, close to half; and the proportion of non-low chilling requirement peaches (chilling requirement ≥ 400h) is only 34%.

[0058] In addition, the Chr01-43706671 marker can be combined with the marker Chr01:46470090 (primer sequence: Chr01:46470090-forward primer 1 AAAATAAATCGTATCGCCGGGCAGT, SEQ ID NO. 7; Chr01:46470090-forward primer 2 AAAATAAATCGTATCGCCGGGCAGC, SEQ ID NO. 8; Chr01:46470090-common reverse primer AAAACACAGAGTATAGCCGGTTGG, SEQ ID NO. 9) in the patent (application number: CN2024114286008) applied by the inventor to further improve the identification and selection efficiency of low chilling requirement peaches. When used, FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO. 5) modification is added to the 5' end of Chr01:46470090-forward primer 1, and VIC (GAAGGTCGGAGTCAACGGATT, SEQ ID NO. 6) modification is added to the 5' end of Chr01:46470090-forward primer 2 for easy reading of data. At the same time, Chr01-43706671 and Chr01:46470090 are used to screen low chilling requirement peaches in the sample group to be tested, and the final locked sample group is identified as the union of G:G genotype of Chr01-43706671 marker and C:C and T:C genotypes of Chr01:46470090 marker. In the locked sample group, the identification success rate of low chilling requirement peaches (chilling requirement < 400h) can be as high as 80%, the proportion of this type of peach can be as high as 66%, the identification success rate of very low chilling requirement peaches (chilling requirement < 300h) in them can be as high as 100%, and the proportion of this type of peach is 47%, close to half; and the proportion of non-low chilling requirement peaches (chilling requirement ≥ 400h) is only 34%.

[0059] Although the present application has been disclosed with reference to various implementations, it is understood that equivalents can be employed and substitutions made herein without departing from the spirit and scope of the application as defined in the following claims.

Claims

1. Use of the molecular marker Chr01-43706671 in the assisted selection of low chilling peach varieties, characterized in that The sequence of the molecular marker is shown as SEQ ID NO. 4, and the polymorphism at position 301 is G / T.

2. Use of the primer combination for detecting the molecular marker Chr01-43706671 according to claim 1 for assisting the selection of low chilling peach varieties, characterized in that, The primer combination comprises the forward primer shown as SEQ ID NO. 1-2 and the common reverse primer shown as SEQ ID NO.

3.

3. Use according to claim 2, characterized in that, Different fluorescent signal tags are added to the 5' ends of the two forward primers.

4. The application according to claim 3, wherein the fluorescent signal tags are FAM and VIC.

5. Use according to any one of claims 2 to 4, characterized in that, The steps include: (1) Primer synthesis: synthesizing the primer combination for detecting the molecular marker Chr01-43706671; (2) DNA extraction: extracting the peach genomic DNA to be identified; (3) KASP reaction: using the genomic DNA extracted in step (2) as a template, and performing KASP reaction using the primer combination; (4) KASP product detection and analysis: detecting the genotyping of the amplification product, and selecting the variety with G:G genotyping for subsequent breeding; Steps (1) and (2) have no order requirement.

6. The application of the combination of the molecular marker primer combination in the assisted breeding of low cold requirement peach varieties, wherein the molecular marker primer combination comprises the primer combination for detecting the molecular marker Chr01-43706671 according to any one of claims 2-4, and the primer combination for detecting the molecular marker Chr01: 46470090, wherein the primer combination for detecting the molecular marker Chr01: 46470090 comprises the forward primers shown as SEQ ID NO. 7-8 and the reverse primer shown as SEQ ID NO.

9.

7. Use according to claim 6, characterized in that Different fluorescent signal tags are added to the 5' ends of the two forward primers of the primer combination for detecting the molecular marker Chr01: 46470090.

Images