Microfluidics-based high-throughput single cell transcriptome sequencing and library building method

Abstract

The invention discloses a high-throughput single cell transcriptome sequencing and library building method based on microfluidics. The method can be expanded to be used for information acquisition of various transcripts. A single cell and RNA, a single-cell molecular tag, a reverse transcription reagent and a PCR reagent carried by the single cell are fixed in a partition through a one-button automatic instrument, labeling of the single cell in the single partition is achieved through the single-cell molecular tag in the partition, reverse transcription of the RNA in the single partition is achieved through the reverse transcription reagent, and cDNA is obtained through PCR. Signal amplification of cDNA of a single cell in a single partition is realized through a PCR reagent. After a cDNA signal in a single partition is amplified, the partitions are broken, cDNA products carrying single-cell molecular tags of the multiple partitions are combined, the cDNA products are subjected to fragmentation and then introduced into a sequencing linker, and library construction is completed. According to the method provided by the invention, the loss of cDNA products is reduced while experimental operation steps are reduced, so that the quantity of gene amplification products is increased by 40% or above.

Description

Technical Field

[0001] The invention relates to an automated method for rapidly constructing a high-throughput single-cell transcriptome library based on microfluidics, and belongs to the field of biotechnology. Background Art

[0002] The heterogeneity between different cells in a cell population plays an important role in the development and progression of the disease, but most of the current traditional genetic analysis methods mask the differences between individual cells. High-throughput single-cell transcriptome sequencing can show the intrinsic heterogeneity of individual cells and reveal complex and rare cell populations. In the past decade, different microfluidic technologies have emerged for high-throughput single-cell research and have become the forefront of the field. The main process of high-throughput single-cell transcriptome sequencing technology includes the following steps: single cell isolation, single cell capture, single cell lysis, RNA capture, RNA reverse transcription, cDNA amplification, library construction, high-throughput sequencing, data processing, and data analysis.

[0003] High-throughput single-cell transcriptome sequencing technology is already very mature. Through the microfluidics-based droplet generation platform, large-scale single-cell transcriptome sequencing can be achieved. Currently, there are four main ways to achieve high-throughput single-cell transcriptome library technology, including (1) microplate technology, (2) combined labeling technology, (3) segmentation pool technology, and (4) droplet microfluidics technology.

[0004] (1) Microwell plate technology: A microwell plate (Microwell chip) is a chip with many small holes with a pore size of about tens of micrometers. A chip can contain tens to hundreds of thousands of microwells. The material is usually agarose or polydimethylsiloxane (PDMS). Based on the capture technology of microwells, microwell chips are usually used together with microspheres with cell labels. According to the concentration of cells and microspheres, the concentration of cells and microspheres is adjusted, such as using a cell pipette or laser capture, limiting dilution method, etc. to separate and dilute cells, and then disperse the cells into the small holes to ensure that each microwell contains only one cell and one microsphere, so as to achieve individual labeling of cells.

[0005] (2) Combination label technology: Using the "split-and-pool" method, each cell in the cell population is given a specific label, and the sequenced fragments are split using the label to obtain cell-specific sequencing data for subsequent analysis. Specifically, all samples are randomly and evenly distributed to different wells, and then different cell labels are added to each well. Then, the cells evenly distributed to different wells are mixed evenly and then evenly distributed to new wells. Different cell labels are added to each well, and finally, all cells are mixed together, and complete cells or cell nuclei are sorted by flow cytometry for library construction and sequencing. For this technology, the ratio of the number of cells to the number of cell labels can be controlled to ensure that the vast majority of cells contain different cell label pairs. Compared with other high-throughput single-cell technologies, this technology does not involve precision instruments and its cost is significantly lower than that of microfluidics technology. However, since this technology has many operation steps and is based on population cell level operations, the loss of intracellular information is relatively serious during the process, and less effective information can be obtained, resulting in low whole genome coverage.

[0006] (3) Split Pool Ligation-based Transcriptome sequencing (SPLiT-seq) can classify and track different types of cells in tissue samples. This method can reliably track gene activity in tissue samples at the single-cell level. This technology allows technicians to perform single-cell RNA sequencing without isolating individual cells. Using SPLiT-seq, it is possible to measure the gene activity of a single cell, even if there are thousands of different cells in a tissue sample. SPLiT-seq is based on the principle of "split-and-pool" to label individual cells with unique DNA barcodes (in the first round, cells are distributed into 96-well plates. In the next round, all cells are pooled together and redistributed into new 96-well plates, and the cells are labeled with the first round of labels; then the cells in the 96-well plates are merged and collected and evenly distributed into 96-well plates, and the cells are labeled with the second round of labels; after another round of cell merging and distribution, labeling is added; and finally, after another round of library label distribution. In the end, each cell is labeled with 4 barcodes, and the 4 rounds of labels are unique after combination.). In each round, the RNA in each pool forms its own unique DNA "barcode" tag. At the end of this process, the RNA from each cell contains its own unique barcode combination.

[0007] (4) Droplet microfluidics: Droplet microfluidics is based on the principle of oil-in-water. When generating oil droplets, different reaction solutions are packaged into nanoliter droplets. A cell and a microsphere with a molecular label are packaged together to separate different cells and prevent contamination. After the information of a single cell is labeled, these small droplets are fused through biochemical reactions, thereby achieving unified and efficient processing of samples and being able to accurately control the single-cell micro-reaction system.

[0008] At present, the high-throughput single-cell transcriptome sequencing technology based on microfluidics has the following defects. This sequencing technology does not integrate the two important reactions required for single-cell transcriptome library construction in the droplet: reverse transcription of RNA and amplification of cDNA. The conventional experimental process often requires the completion of RNA reverse transcription in the droplet, and then the droplet demulsification and reverse transcription product collection, and then purification before PCR amplification, and purification again after amplification before interruption and library construction. This operation step before nucleic acid amplification often causes a large loss of the product, resulting in a decrease in the number of genes, and there are many operation steps, and consumables are time-consuming and labor-intensive. For single-cell transcriptome sequencing technology based on microplate technology, although some platforms can realize reverse transcription of RNA and amplification of cDNA in the same partition unit (microwell or droplet) to achieve a high gene capture rate, its cell throughput is often greatly limited. For example, SMART-seq3 can complete reverse transcription and amplification in the same well and has good gene capture performance, but this method requires secondary addition of reagents, and the cell throughput is often limited by the number of wells (such as 96), and it is impossible to achieve high-throughput single-cell transcriptome sequencing in the true sense. Summary of the invention

[0009] Problem that the invention aims to solve In view of the problems existing in the prior art, the present invention provides an automated method for rapidly constructing a high-throughput single-cell transcriptome library based on microfluidics.

[0010] Solutions for solving problems In view of the problems existing in the above-mentioned prior art, the inventors have conducted in-depth research. Through research, the inventors have adjusted and optimized the components of the PCR reagents in the traditional microfluidics-based high-throughput single-cell transcriptome sequencing library construction method, obtained a PCR reagent with both mRNA reverse transcription and cDNA amplification functions, and at the same time provided a new microfluidics-based high-throughput single-cell transcriptome sequencing library construction method based on the PCR reagent, thereby completing the present invention.

[0011] In a first aspect, the present invention provides an automated method for rapidly constructing a high-throughput single-cell transcriptome library based on microfluidics, characterized in that the method comprises the following steps: (1) Use a one-button automated instrument to generate droplets containing cells, microspheres carrying molecular labels, reverse transcription reagents, and PCR reagents to form a single partition; (2) Using the lysis component in the reverse transcription reagent in the droplet to lyse the cells encapsulated in the droplet and release the RNA in the cell; (3) Use UV irradiation to release the single-cell molecular tags on the microspheres in the droplets; (4) Using single-cell molecular tags to capture the released RNA and label the RNA in a single partition, while using the fixed sequence at the 5' end of the single-cell molecular tag as the PCR forward primer binding region; (5) Reverse transcription of the labeled RNA in a single partition to obtain cDNA, and the fixed sequence at the 3' end of the cDNA becomes the binding region of the PCR reverse primer; (6) using the cDNA obtained in step (5) as a template, performing PCR amplification using PCR reagents and PCR primers to amplify the cDNA signal; (7) Use demulsification reagents to release the aqueous phase components in the droplets, merge the PCR products in all individual partitions, and remove the oil phase; (8) Filter the microspheres using a filter element to collect the aqueous phase containing the PCR product; (9) Purify and recover PCR products in the aqueous phase using magnetic beads; (10) Use the purified PCR product to construct a transcriptome sequencing library.

[0012] In some specific embodiments, the diameter of the microsphere is in the micrometer level, the molecular labels carried on each microsphere are consistent, and the molecular labels carried on every two microspheres are inconsistent; and in each reaction, the total number of microspheres is greater than the total number of droplets; The sequence on the microsphere is ABiCjD, i is the microsphere number, j is the oligo number on the microsphere, A and D are fixed sequences, A is the subsequent PCR forward primer binding sequence, and D is the poly T sequence for capturing RNA; the sequence B on different microspheres is different and is used to mark cells; the C on the same microsphere is different and is used to mark different RNA molecules in a single cell.

[0013] For example, the sequence characteristics of microsphere 1 are A1B1C1D1, AB1C2D, AB1C3D, ...AB1CjD.

[0014] In some specific embodiments, the reverse transcription reagent comprises the following components: CA630 (10% v / v), reverse transcriptase, 5× reverse transcription buffer, reverse transcription primer, dNTPs, dCTP, DTT, betaine, PEG8000, MgCl2.

[0015] In some specific embodiments, the PCR reagents comprise the following components: KAPA HiFi Hot-Start ReadyMix and pre-amplification primers.

[0016] In some preferred embodiments, the reverse transcription reagent and the PCR reagent are mixed and prepared in one tube, and the contents of each component are respectively: The contents of the components in the reverse transcription reagent are: 0.5~5µl CA630 (10% v / v), 2~20µl 25mM dNTPs, 0.1~10µl reverse transcriptase 1, 0.1~10µl reverse transcriptase 2, 0.1~10µl 100mM DTT, 1~40µl 10M betaine, 1-2µl PEG8000 (20% w / v), 0.1~10µl 100mM dCTP, 0.1~50µl reverse transcription primer, 0.1~20µl 1MMgCl2; The contents of the components in the PCR reagent are: 3~500µl 2×KAPA HiFi Hot-StartReadyMix, 0.1~30µl pre-amplification primer; In some more preferred embodiments, the contents of the components in the reverse transcription reagent are: 1.3µl CA630 (10% v / v), 8.8µl 25mM dNTPs, 1.8µl reverse transcriptase 1, 1µl reverse transcriptase 2, 1.3µl 100mM DTT, 19.1µl 10M betaine, 1µl PEG8000 (20% w / v), 3.3µl 100mM dCTP, 1.7µl 1M MgCl2, 3.3µl reverse transcription primer; The contents of the components in the PCR reagent are: 44 µl 2×KAPA HiFi Hot-Start ReadyMix, 2.4 µl pre-amplification primers; The sequences of the reverse transcription primers are shown in SEQ ID NOs: 1-4 respectively; The sequences of the pre-amplification primers are shown in SEQ ID NOs: 5-8, respectively.

[0017] In some specific embodiments, the conditions for reverse transcription reaction and PCR amplification in steps (5) and (6) are respectively: Reverse transcription program: 50°C, 60 minutes; PCR program: 98°C, 3 minutes; 98°C, 20 seconds; 67°C, 20 seconds; 72°C, 6 minutes; 15 cycles of annealing and extension; 8°C, insulation.

[0018] In some specific embodiments, the specific operation of step (9) is: using SPRIselect magnetic beads to perform 0.6× recovery to remove primer dimers and residual primers to obtain purified PCR products.

[0019] In some specific embodiments, in step (10), 20-100 ng of PCR product is taken to construct the transcriptome library, and the specific operation is as follows: (i) The PCR product was sheared at 37°C for 5 min, 65°C for 30 min, and 8°C for insulation. (ii) Linker ligation reaction, the program is: 20°C, 15 minutes; 8°C, keep warm; (iii) 0.5× SPRIselect magnetic beads were used to purify the ligation product; (iv) Performing a library index PCR reaction on the purified ligation product, using P5 and P7 primers with index information for PCR, and the PCR amplification program is 98°C, 30 seconds; 98°C, 10 seconds, 65°C, 75 seconds, including 9-16 annealing and extension cycles; 65°C, 5 minutes; 8°C, insulation; (v) The library products after PCR were purified by double selection using 0.5× and 0.65× SPRIselect magnetic beads to obtain a single-cell transcriptome library.

[0020] In some specific embodiments, the primers in (iv) are: P5:AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 9) and P7: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 10).

[0021] Effects of the Invention It can be seen from the technical solution of the present invention that the technical solution of the present invention has the following beneficial effects compared with the prior art: 1. The present invention provides a new formula of a PCR reagent, which is precisely blended with a variety of chemical reagents, and has both mRNA reverse transcription and cDNA amplification functions. The PCR reagent can be used to generate tens of thousands of droplets through a microfluidic platform, and then complete the reverse transcription reaction and PCR amplification reaction in the droplets without adding other reagents in the middle. The performance of the two reactions does not interfere with each other, and both can be completed efficiently.

[0022] 2. Using the new PCR reagent formula provided by the present invention, mRNA reverse transcription and cDNA amplification can be completed in the droplets generated by the microfluidic platform without the need for purification in the middle, reducing product loss and increasing the amount of gene amplification products by more than 40%.

[0023] 3. The method provided by the present invention can ensure that the amplified products in the droplets do not need further PCR amplification after demulsification and purification, and can directly proceed to the subsequent interruption library construction step, making the operation simpler and more cost-effective. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 , Figure 2 The conventional method (see Figure 1 ) and the method provided by the present invention (see Figure 2 ) Comparison of the contamination efficiency of mouse PBMC cells and human PBMC cells. In the figure, one point represents one cell, where green points (points near the vertical axis) represent mouse PBMC cells, blue points (points near the horizontal axis) represent human PBMC cells, and gray points represent contaminated dual-species cells.

[0025] Figure 3 , 4 The conventional method (see Figure 3 ) and the method provided by the present invention (see Figure 4 ) shows the distribution of the number of genes in a single cell, where the horizontal axis is the compared species and the vertical axis is the number of genes measured in each cell.

[0026] Figure 5 and Figure 6 The flowcharts of the traditional method and the flowchart of the method provided by the present invention are respectively shown. DETAILED DESCRIPTION

[0027] Various exemplary embodiments, features and aspects of the present invention will be described in detail below. The word "exemplary" used here means "used as an example, embodiment or illustrative". Any embodiment described here as "exemplary" is not necessarily interpreted as being superior or better than other embodiments.

[0028] In addition, in order to better illustrate the present invention, numerous specific details are provided in the following specific embodiments. It should be understood by those skilled in the art that the present invention can be implemented without certain specific details. In other examples, methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the subject matter of the present invention.

[0029] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0030] In this specification, the word "may" means both performing a certain process and not performing a certain process.

[0031] In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", etc., mean that the specific elements (e.g., features, structures, properties and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0032] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoint numerical values ​​A and B.

[0033] In this specification, when "normal temperature" or "room temperature" is used, the temperature may be 10-40°C.

[0034] Example The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0035] Example 1. Screening and optimization of PCR reagent formulation The inventors screened and optimized the formula and content of PCR reagents in PCR amplification through repeated research, and finally obtained the most preferred reagent formula: "1.3 µl CA630 (10% v / v), 8.8 µl dNTP mix (25mM), 1.8 µl reverse transcriptase 1 (Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SPS051104 or SPS051304), 1 µl reverse transcriptase 2 (Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SPS051105 or SPS051305), 1.3 µl DTT (100mM), 19.1 µl betaine (10M), 3.3 µl dCTP (100mM), 1.7 µl magnesium chloride (1M), 44 µl 2×KAPA HiFi Hot-Start ReadyMix (KK2601, KAPA Biosystems), 3.3 The sequences of the four sets of reverse transcription primers and pre-amplification primers are shown in Table 1. Among them, the product numbers SPS051108 and SPS051308 are primer kits containing 4 reactions and 16 reactions respectively; the product numbers SPS051108 and SPS051308 are primer kits containing 4 reactions and 16 reactions respectively.

[0036] Table 1: Sequence information of reverse transcription primers and pre-amplification primers Reverse transcription primer Pre-amplification primers 5'-AAGCAGTGGTATCAACGCAGAGTACATGGG (Cat. No. SPS051108 or SPS051308, SEQ ID NO: 1, wherein G represents the G in RNA and G represents the G in LNA) 5'-AAGCAGTGGTATCAACGCAGAGTAC (Cat. No. SPS051110 or SPS051310, SEQ ID NO: 5) 5'-AGAGACAGATTGCGCAATGGGG (Cat. No. SPS051108 or SPS051308, SEQ ID NO: 2, where G represents G in RNA) 5'-AGAGACAGATTGCGCAATG (Cat. No. SPS051110 or SPS051310, SEQ ID NO: 6) 5'-AAGCAGTGGTATCAACGCAGAGTACGGG (Cat. No. SPS051108 or SPS051308, SEQ ID NO: 3, where G represents G in RNA) 5'-AAGCAGTGGTATCAACGCAGAGTAC (Cat. No. SPS051110 or S051310, SEQ ID NO: 7) 5'-GTGAGTGATGGTTGAGGTAGTGTGGGGG (Cat. No. SPS051108 or SPS051308, SEQ ID NO: 4, where G represents G in RNA) 5'-GTGAGTGATGGTTGAGGTAGTGTGG (Cat. No. SPS051110 or S051310, SEQ ID NO: 8) Example 2. Microfluidics-based high-throughput single-cell transcriptome sequencing library construction method Generating droplets on a microfluidic machine: (1) Prepare PCR reagents according to the screening and optimization results of Example 1, the specific composition of which is: 1.3 µl CA630 (10% v / v), 8.8 µl dNTP mix (25 mM), 1.8 µl reverse transcriptase 1 (Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SPS051104 or SPS051304), 1 µl reverse transcriptase 2 (Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SPS051105 or SPS051305), 1.3 µl DTT (100 mM), 19.1 µl betaine (10 M), 3.3 µl dCTP (100 mM), 1.7 µl magnesium chloride (1 M), 44 µl 2× KAPA HiFi Hot-StartReadyMix, 3.3 µl reverse transcription primer (Mozhuo Biotechnology (Zhejiang) Co., Ltd., catalog number SPS051108 or SPS051308), 2.4 µl pre-amplification primer (Mozhuo Biotechnology (Zhejiang) Co., Ltd., catalog number SPS051110 or SPS051310), (2) prepare cell suspension and microspheres, and prepare droplet generation oil (Mozhuo Biotechnology (Zhejiang) Co., Ltd., catalog number: SPS051403); Among them, the cell suspension contains cells, cell suspension additives (Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SSPS051206), and reverse transcription enhancers (Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SPS051324); the microspheres are purchased from Mozhuo Biotechnology (Zhejiang) Co., Ltd., product number SPS051301.

[0037] The water-in-oil droplets were generated using the chip and MobiNova-100 instrument independently developed by Mozo Biotech (Zhejiang) Co., Ltd. The specific operation of generating water-in-oil droplets is as follows: 0. Place the chip on the chip holder 1. Slowly aspirate 50-65 μL of 3' transcriptome microspheres and slowly push them out (about 15 seconds) into the cup marked B. Avoid bubbles during the addition process. 2. Slowly add 45-60 μL of cell phase reagent into the cup marked C, avoiding bubbles. 3. Slowly add 80-100 μL of reverse transcription reagent into the cup marked D, avoiding bubbles. 4. Add 150-170 μL of droplet formation oil into the cup marked E; 5. Press the silicone gasket over the chip cup; 6. Click "Open Door" on the instrument screen; 7. Slowly place the chip holder into the chip compartment, and gently press the four corners with your hands to ensure that the chip holder is placed smoothly in the chip compartment; 8. Click "Close the door" on the screen to complete the chip holder placement; 9. Click to start the experiment After droplet generation, the droplets were pretreated in a UV preconditioner for 5 min; Perform reverse transcription (RT) and PCR amplification reactions on the droplets: transfer the pre-treated droplets to a PCR tube and place it in a PCR instrument; The RT program was: 50°C, 60 minutes; the PCR program was: 98°C, 3 minutes, 98°C, 20 seconds, 67°C, 20 seconds, 72°C, 6 minutes, including 15 annealing and extension cycles; 8°C, insulation.

[0038] Demulsification and purification of the droplets: Add an appropriate amount of 1% perfluorooctanol (PFO) to the droplets to break the droplets and separate the oil phase, water phase and gel beads; Use a filter element to filter the gel beads, discard the filter element, and collect the water phase containing the PCR product in the tube, wherein the specification of the filter element is 0.45 μm; SPRIselect magnetic beads were used for 0.6× recovery to remove primer dimers and residual primers to obtain purified PCR products; Take an appropriate amount of PCR product, specifically 50 ng of PCR product to continue to construct the transcriptome library. The specific construction method is as follows; 1) The PCR product was interrupted at 37°C for 5 minutes, 65°C for 30 minutes, and 8°C for insulation. 2) Then, the linker ligation reaction was carried out, the procedure was 20°C, 15 minutes; 8°C, insulation; 3) Purify the ligation product with 0.5× SPRIselect magnetic beads; 4) Perform index PCR reaction on the purified ligation products, using P5 and P7 primers with index information for PCR. The PCR amplification program is 98°C, 30 seconds; 98°C, 10 seconds, 65°C, 75 seconds, including 9-16 annealing and extension cycles; 65°C, 5 minutes; 8°C, insulation; The sequence of the P5 primer is: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 9) The sequence of the P7 primer is: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 10) 5) The library product after PCR is purified by double selection with 0.5× and 0.65× SPRIselect magnetic beads to obtain the single-cell transcriptome library, which is then sent to a sequencing company for sequencing.

[0039] Example 3: Application of high-throughput single-cell transcriptome sequencing library construction method based on microfluidics 1. Prepare human PBMC (peripheral blood mononuclear cells) and mouse PBMC mixed cell line samples, resuscitate frozen human PBMC and mouse PBMC, take out the PBMC samples from the liquid nitrogen where the PBMC samples are stored, quickly place them in a 37°C water bath, and thaw them quickly. After thawing, wash the PBMC cells three times with warm PBS buffer (Thermo Fisher, Cat. No. 10010049), and finally resuspend about five million mixed cells of human PBMC and mouse PBMC with 3 ml PBS solution. Use a cell counter to measure the viability and concentration of the mixed cells. The cell viability before loading is about 92% and the concentration is about 1350 cells / µl.

[0040] 2. Divide the mixed cell sample into two parts and use the traditional method (i.e., complete "RNA reverse transcription to cDNA" in the droplet, and then perform "cDNA amplification" after demulsification). For detailed operations, see "MobiCube ® High-throughput single-cell 3' transcriptome reagent v1.0 instruction manual") and the method of the present invention (i.e., completing "RNA reverse transcription to cDNA" and "cDNA amplification" in droplets) for single-cell sequencing experiments.

[0041] Test results: Test results: Figure 1 , 2 The conventional method (see Figure 1 ) and the method provided by the present invention (see Figure 2 ) Comparison of the contamination efficiency of mouse PBMC cells and human PBMC cells. In the figure, one point represents one cell, where green points (points near the vertical axis) represent mouse PBMC cells, blue points (points near the horizontal axis) represent human PBMC cells, and gray points represent contaminated dual-species cells.

[0042] Figure 3 , 4 The conventional method (see Figure 3 ) and the method provided by the present invention (see Figure 4 ) The distribution diagram of the number of genes in a single cell is measured, where the horizontal axis is the species compared and the vertical axis is the number of genes measured in each cell. The method of the present invention has a lower cell contamination rate and can effectively increase the number of genes.

[0043] Example 4: Comparison of the high-throughput single-cell transcriptome sequencing library construction method based on microfluidics provided by the present invention and the traditional single-cell transcriptome sequencing method based on droplet microfluidics Traditional single-cell transcriptome sequencing methods based on droplet microfluidics cannot integrate the two steps of "RNA reverse transcription to cDNA" and "cDNA amplification" in droplets. Instead, it is necessary to complete "RNA reverse transcription to cDNA" in droplets first, then perform droplet demulsification and reverse transcription collection, and then purification before PCR amplification. After amplification, purification is performed again before interruption and library construction. This operation step before nucleic acid amplification often causes a large loss of the product, resulting in a decrease in the number of genes, and there are many operation steps, and consumables are time-consuming and labor-intensive ( Figure 5 ).

[0044] The present invention develops a PCR reagent with both mRNA reverse transcription and cDNA amplification functions. The PCR reagent can be used to generate tens of thousands of droplets through a microfluidic platform, and then complete the reverse transcription reaction and PCR amplification reaction in the droplets. No other reagents need to be added in the middle, and the performance of the two reactions does not interfere with each other. Both reactions can be completed efficiently, and no purification is required in the middle, which reduces product loss, increases the amount of gene amplification products, and is simpler to operate and has lower costs ( Figure 6 ).

[0045] By comparing the effects of the two schemes, the dual-species contamination rate of the traditional method (9.68%) is greater than the contamination rate of the method developed by the present invention (0.89%). More importantly, the median number of genes captured by this method on human and mouse cells is 2000, which is also much higher than the number of genes captured by the traditional method (about 1700). This also proves that the method developed by the present invention can obtain better data performance.

[0046] It should be noted that, although the technical solution of the present invention is introduced with specific examples, those skilled in the art will appreciate that the present invention should not be limited thereto.

[0047] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A high-throughput single-cell transcriptome sequencing library construction method based on microfluidics, characterized in that: The method comprises the following steps: (1) Use a one-button automated instrument to generate droplets containing cells, microspheres carrying molecular labels, reverse transcription reagents, and PCR reagents to form a single partition; (2) Using the lysis component in the reverse transcription reagent in the droplet to lyse the cells encapsulated in the droplet and release the RNA in the cell; (3) Use UV irradiation to release the single-cell molecular tags on the microspheres in the droplets; (4) Using single-cell molecular tags to capture the released RNA and label the RNA in a single partition, while using the fixed sequence at the 5' end of the single-cell molecular tag as the PCR forward primer binding region; (5) Reverse transcription of the labeled RNA in a single partition to obtain cDNA, and the fixed sequence at the 3' end of the cDNA becomes the binding region of the PCR reverse primer; (6) using the cDNA obtained in step (5) as a template, performing PCR amplification using PCR reagents and PCR primers to amplify the cDNA signal; (7) Use demulsification reagents to release the aqueous phase components in the droplets, merge the PCR products in all individual partitions, and remove the oil phase; (8) Filter the microspheres using a filter element to collect the aqueous phase containing the PCR product; (9) Purify and recover PCR products in the aqueous phase using magnetic beads; (10) Use the purified PCR product to construct a transcriptome sequencing library.

2. The method according to claim 1, characterized in that The diameter of the microspheres is in the micrometer level, the molecular labels carried on each microsphere are consistent, and the molecular labels carried on every two microspheres are inconsistent; and in each reaction, the total number of microspheres is greater than the total number of droplets; Among them, the sequence on the microsphere is AB i C j D, i is the microsphere number, j is the oligo number on the microsphere, where A and D are fixed sequences, A is the subsequent PCR forward primer binding sequence, and D is the poly T sequence for capturing RNA; the sequence B on different microspheres is different and is used to mark cells; the C on the same microsphere is different and is used to mark different RNA molecules in a single cell.

3. The method according to claim 1, characterized in that: The reverse transcription reagent comprises the following components: CA630 (10% v / v), reverse transcriptase, 5× reverse transcription buffer, reverse transcription primer, dNTPs, dCTP, DTT, betaine, PEG8000, MgCl2.

4. The method according to claim 1, characterized in that: The PCR reagents contain the following components: KAPA HiFi Hot-Start ReadyMix and pre-amplification primers.

5. The method according to claim 1, wherein the reverse transcription reagent and the PCR reagent are mixed and prepared in one tube, and the contents of each component are respectively: The contents of the components in the reverse transcription reagent are: 0.5~5µl CA630 (10% v / v), 2~20µl 25mM dNTPs, 0.1~10µl reverse transcriptase 1, 0.1~10µl reverse transcriptase 2, 0.1~10µl 100mM DTT, 1~40µl 10M betaine, 1-2µl PEG8000 (20% w / v), 0.1~10µl 100mM dCTP, 0.1~50µl reverse transcription primer, 0.1~20µl 1MMgCl2; The contents of the components in the PCR reagent are: 3~500µl 2×KAPA HiFi Hot-Start ReadyMix, 0.1~30µl pre-amplification primer; The sequences of the reverse transcription primers are shown in SEQ ID NOs: 1-4 respectively; The sequences of the pre-amplification primers are shown in SEQ ID NOs: 5-8, respectively.

6. The method according to claim 1, wherein the conditions for reverse transcription reaction and PCR amplification in steps (5) and (6) are respectively: Reverse transcription program: 50°C, 60 minutes; PCR program: 98°C, 3 minutes; 98°C, 20 seconds; 67°C, 20 seconds; 72°C, 6 minutes; among them, Annealing and extension cycles were performed for 12-15 times; incubation was performed at 8°C.

7. The method according to claim 1, wherein the specific operation of step (7) is: adding an appropriate amount of 1% PFO to the droplets, breaking the droplets, and separating the oil phase, the water phase and the microspheres.

8. The method according to claim 1, wherein the specific operation of step (9) is: using SPRIselect magnetic beads to perform 0.6× recovery to remove primer dimers and residual primers to obtain a purified PCR product.

9. The method according to claim 1, wherein in step (10), 20-100 ng of PCR product is taken to construct a transcriptome library, and the specific operation is: (i) The PCR product was sheared at 37°C for 5 min, 65°C for 30 min, and 8°C for insulation. (ii) Linker ligation reaction, the program is: 20°C, 15 minutes; 8°C, keep warm; (iii) 0.5× SPRIselect magnetic beads were used to purify the ligation product; (iv) Performing a library index PCR reaction on the purified ligation product, using P5 and P7 primers with index information for PCR, and the PCR amplification program is 98°C, 30 seconds; 98°C, 10 seconds, 65°C, 75 seconds, including 9-16 annealing and extension cycles; 65°C, 5 minutes; 8°C, insulation; (v) The library products after PCR were purified by double selection using 0.5× and 0.65× SPRIselect magnetic beads to obtain a single-cell transcriptome library.

10. The method according to claim 9, wherein the primers in (iv) are: P5:AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 9) and P7: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 10).

Images