Preparation and application of foot and mouth disease virus circular RNA (Ribonucleic Acid) molecule

Abstract

The invention discloses preparation and application of a circular RNA (Ribonucleic Acid) molecule of a foot and mouth disease virus. The circular RNA comprises a coding element for coding any one of foot and mouth disease virus VP1 protein and VP3 protein; preferably, the coding element encodes foot and mouth disease virus VP1 protein. Further, the coding element codes a VP1 wild type protein, a VP1 truncated protein, a VP1 mutant protein and a VP1 truncated mutant protein; preferably, the coding element encodes the VP1 truncated and mutant protein. Further, the encoding element encodes an optimized nucleotide sequence of foot-and-mouth disease virus VP1 truncated and mutant protein. Further, the circular RNA comprises an optimized translation initiation element. Researches show that the circular RNA provided by the invention can induce protein expression in an animal body, generate a high-level virus blocking antibody and successfully activate T cell immunity, especially CD8 + T cell immune response, and a basis is provided for preparing a circular mRNA vaccine for preventing and / or treating foot-and-mouth disease.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to the preparation and application of a circular RNA molecule of foot-and-mouth disease virus, and specifically relates to the preparation and application of a circular RNA encoding a capsid protein of foot-and-mouth disease virus; the invention comprises a circular RNA encoding a truncated and mutant protein sequence of VP1 of foot-and-mouth disease virus, a linear RNA, a recombinant plasmid, a recombinant Escherichia coli engineering bacterium, and a preparation method and application of the circular RNA. Background Art

[0002] Foot-and-mouth disease virus (FMDV) belongs to the Picornaviridae family and the genus FMDV. FMDV virus particles consist of an icosahedral shell, containing four structural proteins (VP1, VP2, VP3 and VP4) and eight non-structural proteins, of which four structural proteins can form virus-like particles (VLPs) alone. There are seven serotypes of FMDV, namely O, A, Asia1, SAT1, SAT2, SAT3 and C, and there is no cross-protection reaction between the types.

[0003] Foot-and-mouth disease vaccine is the main measure to prevent foot-and-mouth disease virus infection in the process of animal husbandry production. It is a vaccine that is compulsory for vaccination during animal husbandry. The existing vaccine technology route is mainly inactivated vaccine, which is made by amplification, inactivation, emulsification and other processes of the strain, and plays an important role in the prevention of foot-and-mouth disease. However, inactivated vaccine has high requirements on production environment and production personnel during the production and preparation process, and there is a risk of virus strain leakage and incomplete inactivation during the production and preparation process. Another vaccine technology route is foot-and-mouth disease recombinant subunit vaccine. Since foot-and-mouth disease virus is a non-enveloped virus, the P1 protein encoded by its genome open reading frame (Open Reading Frame, ORF) is cut by enzyme to form VLP particles. However, since the virus P1 gene is highly toxic to cells during in vitro cell fermentation, the VLP yield is low, and there are purification process difficulties. At present, related products have not yet entered clinical application in mass production. There is still a breakthrough in the development of new vaccines for foot-and-mouth disease virus.

[0004] mRNA vaccines are vaccines that directly introduce mRNA containing antigenic proteins into the body, so that it is directly translated in the body to complete the expression of the target protein, thereby causing a specific immune response in the body. They have played an important role in the prevention of major respiratory infectious diseases in humans. At present, the mRNA used in clinical or preclinical applications is mainly linear mRNA. The structure of linear mRNA includes 5' cap structure (5'Cap), 3' polyadenosine tail (PolyA tail), 5' untranslational sequence (5'untranslational region, 5'UTR), 3' untranslational sequence (3'untranslational region, 3'UTR) and open reading frame (Open reading frame, ORF). The 5' cap structure is a basic feature of eukaryotic mRNA, which is obtained by adding N7-methylguanosine to the 5' end of mRNA. The 5' cap structure and 3' polyadenosine tail are necessary components of linear RNA, which can effectively prevent mRNA degradation and promote the translation of mRNA into protein. The 5' cap structure promotes mRNA translation by binding to the translation initiation complex eIF4E, and can effectively prevent mRNA degradation and reduce the immunogenicity of mRNA. The main function of the 3' polyadenosine tail is to bind to PolyA binding protein (PABP), which interacts with eIF4G and eIF4E, mediates the formation of mRNA into a ring, promotes the translation process, and prevents mRNA degradation.

[0005] Circular RNA (circRNAs) is a common type of RNA in eukaryotes. Currently, the most efficient technology for constructing circular RNA in vitro is the self-cleavage circular system design technology (patent CN 114574483 A). The design principle of this technology is to connect the exon E1 and E2 sequences end to end through molecular cloning to form a continuous circular plasmid. The intron is cut and broken by restriction endonuclease to obtain a linear plasmid. Then, in vitro transcription is performed through the T7 promoter upstream of the inverted 3' intron to obtain a linear RNA containing a 3' intron-E2-E1-5' intron structure. Similar to the natural class I intron system, the specific conserved sequence of the splicing site of exon E1 is broken by the nucleophilic attack of the free guanosine 3' hydroxyl, and exon E1 produces a naked 3' hydroxyl, while guanosine binds to the broken 5' intron. Afterwards, the exposed 3'hydroxyl group of exon E1 attacks the conserved sequence between the 3'intron and exon E2, excises the 3'intron, and exons E2 and E1 undergo a circularization reaction to obtain a circular E1-E2 RNA. Compared with linear mRNA, circular mRNA molecules often have a longer half-life and better stability, and have important application prospects in protein expression and clinical treatment. In addition, the preparation process of circular RNA designed based on the self-cleaving circularization system is simpler and has lower process costs. After transcription, only circularization is performed, and there is no need to use expensive capping enzymes and tailing enzymes to modify additional 5' cap structures and 3' polyadenosine tail structures, nor is there a need for additional circularization processes using T4 RNA ligase as in traditional circular RNA. In addition, it can avoid the introduction of additional exon sequences in circular RNA, thereby improving the sequence accuracy of circular RNA molecules.

[0006] Currently, circular RNA is mainly used in human protein expression research, and there are no reports on the optimized design, preparation and application of foot-and-mouth disease virus circular RNA molecules. Summary of the invention

[0007] In view of the problems existing in the existing inactivated vaccines and recombinant subunit vaccines for foot-and-mouth disease in clinical application, including the incomplete inactivation of inactivated vaccines for foot-and-mouth disease, the risk of virus strain leakage, high production cost, low efficiency of recombinant subprotein production, and difficult purification process, as well as the reported linear RNA vaccines for foot-and-mouth disease that cannot efficiently activate CD8+T cell immune response and have insufficient immune protection efficacy (Development of O-type foot-and-mouth disease mRNA vaccine [D], 2022), the present invention provides a preparation and application of circular RNA molecules of foot-and-mouth disease virus. The circular RNA molecule contains an optimized coding element of the VP1 protein of the foot-and-mouth disease virus and an optimized translation initiation element, which can induce protein expression, produce high levels of virus blocking antibodies, and successfully activate T cell immunity, especially CD8+T cell immune response, when entering the animal body, providing a basis for the preparation of circular mRNA vaccines for the prevention and / or treatment of foot-and-mouth disease.

[0008] Solutions used to solve the problem:

[0009] <circular RNA>

[0010] The present invention provides a circular RNA, the circular RNA comprises a coding element, and the coding element encodes a polypeptide comprising a capsid protein of a foot-and-mouth disease virus. The capsid protein of the porcine foot-and-mouth disease virus comprises any one of a VP1 protein and a VP3 protein; preferably, the coding element encodes a VP1 protein of a foot-and-mouth disease virus. Furthermore, the coding element encodes a VP1 wild-type protein, a VP1 truncated protein, and a VP1 truncated plus mutant protein; preferably, the coding element encodes a VP1 truncated plus mutant protein of a foot-and-mouth disease virus. The circular RNA of the present invention can be prepared by a traditional PIE system, or by a clean PIE system.

[0011] In some embodiments, the coding element encodes any one of (a) to (b):

[0012] (a) the amino acid sequence of the foot-and-mouth disease VP1 protein comprises the sequence shown in SEQ ID NO.3, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.3, and having or partially having the VP1 protein activity;

[0013] (b) The amino acid sequence of the foot-and-mouth disease VP3 protein comprises the sequence shown in SEQ ID NO.7, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.7 and having or partially having VP3 protein activity.

[0014] As a preferred embodiment, the coding element comprises the foot-and-mouth disease virus VP1 protein and has an amino acid sequence as shown in SEQ ID NO.3.

[0015] In some embodiments, the coding element encodes an amino acid sequence comprising any one of the following: an N-terminal truncation of 27 amino acids, an N-terminal truncation of 29 amino acids, an N-terminal truncation of 30 amino acids, a C-terminal truncation of 10 amino acids, an amino acid sequence comprising mutation L61P, an L61A, an K202Q, an K202T, an I48S, an C187Y, an K210R, an V209R, an L61P / K202Q, an L61P / K210R, an L61P / K202Q / K210R, an N-terminal truncation of 27 amino acids / an amino acid sequence comprising mutation L61P / K202Q, an N-terminal truncation of 29 amino acids / an amino acid sequence comprising mutation L61P / K202Q, an N-terminal truncation of 30 amino acids / an amino acid sequence comprising mutation L61P / K202Q, and a wild-type VP1 protein.

[0016] In the present invention, the truncation is continuous truncation.

[0017] As a preferred embodiment, the coding element comprises 29 amino acids truncated at the N-terminus of the foot-and-mouth disease virus VP1 protein / comprising the mutation L61P / K202Q and has an amino acid sequence as shown in SEQ ID NO.16.

[0018] In some embodiments, the coding element encodes any one of the following (a) to (b):

[0019] (a) the nucleotide sequence of the foot-and-mouth disease VP1 protein comprises the sequence shown in SEQ ID NO.4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.4, and encodes a sequence having or partially having the activity of a polypeptide having the activity of the foot-and-mouth disease VP1 protein;

[0020] (b) The nucleotide sequence of the foot-and-mouth disease VP3 protein comprises the sequence shown in SEQ ID NO.8, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.8, and encodes a sequence that has or partially has a polypeptide having foot-and-mouth disease VP3 protein activity.

[0021] As a preferred embodiment, the coding element comprises a nucleotide sequence encoding foot-and-mouth disease VP1 protein and has an amino acid sequence as shown in SEQ ID NO.4.

[0022] In some embodiments, the coding element comprises a nucleotide sequence encoding any one of the following: a nucleotide sequence encoding any one of the following: a nucleotide sequence of foot-and-mouth disease virus VP1 protein with 27 amino acids truncated at the N-terminus, 29 amino acids truncated at the N-terminus, 30 amino acids truncated at the N-terminus, 10 amino acids truncated at the C-terminus, comprising mutation L61P, comprising mutation L61A, comprising mutation K202Q, comprising mutation K202T, comprising mutation I48S, comprising mutation C187Y, comprising mutation K210R, comprising mutation V209R, comprising mutation L61P / K202Q, comprising mutation L61P / K210R, comprising mutation L61P / K202Q / K210R, N-terminal truncation of 27 amino acids / comprising mutation L61P / K202Q, N-terminal truncation of 29 amino acids / comprising mutation L61P / K202Q, N-terminal truncation of 30 amino acids / comprising mutation L61P / K202Q, and a wild-type VP1 protein.

[0023] In some embodiments, the coding element comprises any one of the following nucleotide sequences encoding the N-terminal truncation of 29 amino acids of the foot-and-mouth disease virus VP1 protein / comprising the mutation L61P / K202Q: nucleotide sequence 1 as shown in SEQ ID NO.18, nucleotide sequence 2 as shown in SEQ ID NO.19, nucleotide sequence 3 as shown in SEQ ID NO.20, nucleotide sequence 4 as shown in SEQ ID NO.21, nucleotide sequence 5 as shown in SEQ ID NO.22, and nucleotide sequence 6 as shown in SEQ ID NO.17.

[0024] As a preferred embodiment, the coding element comprises the nucleotide sequence 5 as shown in SEQ ID NO.22 encoding the N-terminal truncated 29 amino acids of the foot-and-mouth disease virus VP1 protein / including the mutation L61P / K202Q.

[0025] In some embodiments, the circular RNA of the present invention is prepared by a traditional PIE system, under which conditions, the circular RNA comprises elements arranged in the order shown in (a) or (b):

[0026] (a) the first exon, the second exon, the 5' spacer, the translation initiation element, the coding element and the 3' spacer;

[0027] (b) The first exon, the second exon, the translation initiation element and the coding element.

[0028] For the first exon, the second exon, the 5' spacer, and the 3' spacer, reference may be made to patent applications CN202011408937.4, CN202210200112.6, and CN202210200186.X, the entire contents of which are incorporated into this application by reference.

[0029] In other embodiments, the circular RNA of the present invention is prepared by a clean PIE system, under which conditions, the circular RNA comprises elements arranged in the order shown in (c) or (d):

[0030] (c) translation initiation elements and coding elements;

[0031] (d) Translation initiation elements, coding elements and insertion elements.

[0032] In some preferred embodiments, the circular RNA of the present invention is prepared by a clean PIE system, and the circular RNA comprises the elements arranged in the order shown in (d) above. The clean PIE system for preparing circular RNA can refer to the contents shown in patents CN202210200112.6 and CN202210200186.X, and the entire contents of the above patents are incorporated into this application by reference.

[0033] In some embodiments, the translation initiation element described herein can be any type of element that can initiate translation of a coding element in a circular RNA.

[0034] In some specific embodiments, the translation initiation element of the present invention comprises one or more of the following sequences with translation initiation activity: IRES sequence, 5'UTR sequence, Kozak sequence, m 6 A modified (N(6) methyladenosine modification) sequence, complementary sequence of ribosomal 18S rRNA.

[0035] In some preferred embodiments, the translation initiation element of the present invention comprises an IRES sequence. Exemplary, the IRES sequence includes but is not limited to an IRES sequence derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, Turdivirus 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murine kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Humanparechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, and French Guiana picornavirus.

[0036] In some embodiments, the insertion element described in the present invention can be used to regulate the transcription of recombinant nucleic acid molecules, to regulate the translation of circular RNA, to achieve specific expression of circular RNA in different tissues, or to purify circular RNA.

[0037] In some specific embodiments, the insertion element described in the present invention comprises one or more of the following sequences: an untranslated region sequence, a polyN sequence, an adaptor sequence, a ribosome switch sequence, and a sequence that binds a transcriptional regulatory factor; wherein the untranslated region sequence includes a stop codon, and in the polyN sequence, N is selected from at least one of A, T, G, and C.

[0038] In some preferred embodiments, the insertion element of the present invention comprises a stop codon and a polyAC sequence; preferably, the polyAC sequence comprises the sequence shown in SEQ ID NO.9.

[0039] In some preferred embodiments, the circular RNA described in the present invention has a nucleotide sequence as shown in SEQ ID NO.15, as shown in SEQ ID NO.23, as shown in SEQ ID NO.30 and any one of SEQ ID NOs.33 to 37.

[0040] In some preferred embodiments, the circular RNA comprises a nucleotide sequence of any one of the following: a nucleotide sequence as shown in SEQ ID NO.14, a nucleotide sequence as shown in SEQ ID NO.15, a nucleotide sequence as shown in SEQ ID NO.23, a nucleotide sequence as shown in SEQ ID NO.30, a nucleotide sequence as shown in SEQ ID NO.31, a nucleotide sequence as shown in SEQ ID NO.32, a nucleotide sequence as shown in SEQ ID NO.33, a nucleotide sequence as shown in SEQ ID NO.34, a nucleotide sequence as shown in SEQ ID NO.35, a nucleotide sequence as shown in SEQ ID NO.36, or a nucleotide sequence as shown in SEQ ID NO.37.

[0041] In some more preferred embodiments, the circular RNA described in the present invention has a nucleotide sequence as shown in SEQ ID NO.30.

[0042] <Linear RNA>

[0043] The present invention provides a linear RNA, wherein the linear RNA undergoes a self-cleavage reaction and then cyclizes to form the above-mentioned circular RNA. Accordingly, the linear RNA is also called a cyclized precursor RNA.

[0044] In some embodiments, the linear RNA of the present invention is derived from the traditional PIE system, under which conditions, the linear RNA comprises elements arranged in the order shown in (e) or (f) below:

[0045] (e) 5' homology arm, intron fragment II, second exon, 5' spacer, translation initiation element, coding element, 3' spacer, first exon, intron fragment I and 3' homology arm;

[0046] (f) 5' homology arm, intron fragment II, second exon, translation initiation element, coding element, first exon, intron fragment I and 3' homology arm.

[0047] The linear RNA molecule having the above structure can utilize the ribozyme activity of the class I intron to undergo a self-cleavage cyclization reaction in vitro to obtain a circular RNA. Specifically, under the initiation of GTP, the junction between the 5' intron and the first exon is broken; the ribozyme cleavage of the first exon further attacks the junction between the 3' intron and the second exon, causing the junction to break, the 3' intron dissociates, and the first exon and the second exon are connected to obtain a circular mRNA.

[0048] In other embodiments, the linear RNA of the present invention is derived from the clean PIE system, under which conditions, the linear RNA comprises the elements arranged in the order shown in (g), (h) or (i):

[0049] (g) intron fragment II, translation initiation element truncation fragment II, coding element, translation initiation element truncation fragment I, intron fragment I;

[0050] (h) intron fragment II, translation initiation element truncation fragment II, coding element, insertion element, translation initiation element truncation fragment I, intron fragment I;

[0051] (i) Intron fragment II, translation initiation element truncation fragment II, coding element, stop codon, polyAC, translation initiation element truncation fragment I, intron fragment I.

[0052] When the linear RNA molecule having the above structure is used to prepare circular RNA, the ribozyme recognizes the connection position between the translation initiation element truncated fragment I (IRES fragment I) and the intron fragment I and breaks it first, releasing the intron fragment I; then the ribozyme recognizes the connection position between the translation initiation element truncated fragment II (IRES fragment II) and the intron fragment II and breaks it, releasing the intron fragment II. The 3' end of the translation initiation element truncated fragment I and the 5' end of the translation initiation element truncated fragment II are connected to form a circular molecule.

[0053] In some preferred embodiments, the linear RNA of the present invention is derived from the clean PIE system, and the linear RNA comprises the elements arranged in the order shown in (i) above.

[0054] In some specific embodiments, the intron fragment II of the present invention comprises a sequence as shown in SEQ ID NO. 1. In some specific embodiments, the intron fragment I of the present invention comprises a sequence as shown in SEQ ID NO. 11. The nucleotide sequence of the intron fragment I is connected with the nucleotide sequence of the intron fragment II to obtain an intron sequence.

[0055] In some specific embodiments, the translation initiation element truncated fragment II of the present invention comprises a sequence as shown in any one of SEQ ID NO.2, SEQ ID NO.12, SEQ ID NO.24, SEQ ID NO.26, and SEQ ID NO.28. In some specific embodiments, the translation initiation element truncated fragment I of the present invention comprises a sequence as shown in any one of SEQ ID NO.10, SEQ ID NO.13, SEQ ID NO.25, SEQ ID NO.27, and SEQ ID NO.29. The nucleotide sequence of the translation initiation element truncated fragment I is connected to the nucleotide sequence of the translation initiation element truncated fragment II to obtain a translation initiation element sequence.

[0056] In some preferred embodiments, the translation initiation element truncated fragment II of the present invention is the sequence shown in SEQ ID NO.24; the translation initiation element truncated fragment I of the present invention is the sequence shown in SEQ ID NO.25.

[0057] In some specific embodiments, the coding element of the present invention comprises a sequence as shown in any one of SEQ ID NOs. 17-22.

[0058] In some specific embodiments, the stop codon of the present invention is represented by (TAA)x(TAG)y(TGA)z, wherein x+y+z≥1, x, y, z are each independently an integer greater than or equal to 0, and the preferred sequence is TGA.

[0059] In some specific embodiments, the polyAC of the present invention is a sequence as shown in SEQ ID NO.9.

[0060] <Recombinant Nucleic Acid Molecule>

[0061] The present invention provides a recombinant nucleic acid molecule, which forms the above-mentioned linear RNA after transcription.

[0062] In some embodiments, the recombinant nucleic acid molecule of the present invention may contain a regulatory sequence in addition to the elements contained in the linear RNA described above. Exemplarily, the regulatory sequence is a T7 promoter.

[0063] <Recombinant Escherichia coli engineered bacteria>

[0064] The present invention provides a recombinant Escherichia coli engineering bacterium, wherein the engineering bacterium is obtained by transforming E. coli with the above-mentioned recombinant nucleic acid molecule.

[0065] <Nucleic acid lipid nanoparticle composition>

[0066] The present invention provides a nucleic acid lipid nanoparticle composition, which comprises lipid nanoparticles and the above-mentioned circular RNA.

[0067] By encapsulating the above circular RNA into lipid nanoparticles, the body's uptake efficiency of circular RNA can be improved, while the storage stability of circular RNA is improved, providing assistance for the development and application of foot-and-mouth disease vaccines.

[0068] <Medical Use>

[0069] The circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition provided by the present invention can be used to prevent and / or treat foot-and-mouth disease.

[0070] The invention provides use of the circular RNA, linear RNA, recombinant nucleic acid molecule, recombinant Escherichia coli engineered bacteria, and / or nucleic acid lipid nanoparticle composition in the preparation of a drug for preventing and / or treating foot-and-mouth disease.

[0071] The present invention provides a method for preventing and / or treating foot-and-mouth disease, comprising administering an effective amount of the above-mentioned circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition to a subject; preferably, the administration is performed by injection.

[0072] Compared with the prior art, the present invention has the following beneficial effects:

[0073] 1) The present invention provides a preferred VP1 truncated and mutant protein sequence (amino acid sequence shown in SEQ ID NO.16) and a circular RNA molecule encoding the protein (numbered EVE-VP1-1375, nucleotide sequence shown in SEQ ID NO.15). The vaccine corresponding to the preferred RNA molecule successfully increases the foot-and-mouth disease virus blocking antibody titer in mice.

[0074] 2) Furthermore, for the truncated and mutant VP1 protein, the present invention provides a preferred nucleotide sequence (see SEQ ID NO. 22) and a circular RNA molecule encoding the preferred nucleotide sequence (numbered EVE-VP1-5147, nucleotide sequence see SEQ ID NO. 23), and the preferred RNA molecule significantly increases the expression level of the target protein in 293T cells.

[0075] 3) Furthermore, with respect to the preferred nucleotide sequence of VP1 truncated and mutant protein (see SEQ ID NO.22), the present invention provides a circular RNA molecule constructed with a preferred translation initiation element (numbered PPV-VP1-5147, nucleotide sequence see SEQID NO.30). The vaccine corresponding to the preferred RNA molecule successfully increases the foot-and-mouth disease virus blocking antibody titer in pigs.

[0076] 4) Compared with the linear RNA molecule encoding foot-and-mouth disease virus (numbered linear-VP1-1051) and the commercial inactivated vaccine, the LNP-encapsulated circular RNA vaccine prepared using the above-mentioned preferred circular RNA molecule (numbered PPV-VP1-5147, nucleotide sequence see SEQ ID NO.30) successfully activated the CD8+T cell immune response in pigs, providing a basis for the preparation of foot-and-mouth disease virus circular RNA vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0078] Figure 1 A schematic diagram of a precursor sequence and a schematic diagram of a circular mRNA sequence for generating circular mRNA of foot-and-mouth disease virus;

[0079] Figure 2 This is the ratio of CD4+ and CD8+ T lymphocytes in blood PBMC cells after pig immunization. DETAILED DESCRIPTION

[0080] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, provide detailed implementation methods and specific operation processes, and will help those skilled in the art to further understand the present invention. It should be pointed out that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made under the premise of the concept of the present invention all belong to the protection scope of the present invention.

[0081] In the present invention, the term "a" or "an" or "the" may mean "one", and may also mean "one or more", "at least one" and "one or more than one".

[0082] In the present invention, the terms "comprising", "having", "including" or "containing" may mean inclusive or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising", "having", "including" or "containing" may also mean closed, excluding additional, uncited elements or method steps.

[0083] In the present invention, the word "may" includes both performing a certain process and not performing a certain process.

[0084] In the present invention, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and the description includes instances where the event occurs and instances where it does not occur.

[0085] In the present invention, the term "about" may mean that a value includes the standard deviation of the error of the device or method used to determine the value. Unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in the present invention are modified by "about".

[0086] In the present invention, the terms "polypeptide", "peptide" and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0087] In the present invention, the term "circular RNA" refers to an RNA molecule in a closed circular shape. In the present invention, the circular RNA used has protein translation activity and can also be called "circular mRNA".

[0088] In the present invention, the term "linear RNA" refers to an RNA precursor that can be circularized to form a circular RNA, which is generally transcribed from a linear DNA molecule and can also be called "linear mRNA".

[0089] In the present invention, the term "linear RNA" refers to RNA with translation function including a 5' cap structure (5' Cap), a 3' polyadenosine tail (PolyA tail), a 5' untranslational region (5' UTR), a 3' untranslational region (3' UTR) and an open reading frame (Open reading frame, ORF) and other structures, which can also be called "linear mRNA".

[0090] In the present invention, the term "recombinant nucleic acid molecule" refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide may be included in a suitable vector, and the vector may be used to transform into a suitable host cell. The polynucleotide is then expressed in a recombinant host cell to produce, for example, a "recombinant polypeptide", "recombinant protein", "fusion protein", etc. In the present invention, the recombinant nucleic acid molecule comprises a coding element encoding a target polypeptide, and a translation initiation element connected upstream of the coding element.

[0091] In the present invention, the term "translation initiation element" refers to any sequence that can recruit ribosomes and initiate the translation process of RNA molecules. Exemplary, the translation initiation element includes an IRES sequence, an m6A modification sequence, or a rolling circle translation initiation sequence, etc.

[0092] In the present invention, the term "IRES" (Internal ribosome entry site, IRES) is also called internal ribosome entry site, "internal ribosome entry site" (IRES) belongs to the translation control sequence, which is usually located at the 5' end of the gene of interest and enables the translation of RNA in a cap-independent manner. The transcribed IRES can directly bind to the ribosomal subunit so that the mRNA start codon is properly oriented in the ribosome for translation. The IRES sequence is usually located in the 5'UTR of the mRNA (just upstream of the start codon). IRES functionally replaces the need for various protein factors that interact with the eukaryotic translation machinery.

[0093] In the present invention, the term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0094] In the present invention, the term "wild type" is synonymous with "naturally occurring", and refers to an object that can be found in nature and has not been modified by humans.

[0095] In the present invention, the terms "variant" and "mutant" are used interchangeably and refer to nucleotides or amino acids that contain changes (i.e., substitutions, insertions and / or deletions) at one or more (e.g., several) positions relative to a "wild-type" polynucleotide or polypeptide. Substitution refers to replacing a nucleotide / amino acid occupying a position with a different nucleotide / amino acid. Deletion refers to the removal of a nucleotide / amino acid occupying a position. Insertion refers to the addition of a nucleotide / amino acid adjacent to and immediately following the nucleotide / amino acid occupying the position.

[0096] In the present invention, the terms "sequence identity" and "percentage of identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by the following method: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides is scored, and compared with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. The polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). The sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the identical nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0097] In the present invention, the term "individual", "patient" or "subject" includes mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0098] In the present invention, "treatment" means: after suffering from a disease, the subject is exposed to (e.g., administered) the RNA molecule described in the present invention, thereby alleviating the symptoms of the disease compared to when the subject is not exposed, and does not necessarily mean that the symptoms of the disease are completely suppressed. Suffering from a disease means: the body has symptoms of the disease.

[0099] In the present invention, "prevention" means that before contracting a disease, by exposing a subject to the RNA molecule described in the present invention, the probability of contracting a disease and / or the symptoms after contracting a disease are reduced compared to when the subject is not exposed, and it does not mean that the disease must be completely suppressed.

[0100] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. Unless otherwise specified, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include inevitable systematic errors.

[0101] In the examples, if the specific conditions are not specified, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for all reagents or instruments, they are all conventional products that can be purchased commercially. In order to better illustrate the present invention, numerous specific details are provided in the specific embodiments below. It should be understood by those skilled in the art that the present invention can be implemented equally without certain specific details. In other embodiments, methods, means, equipment and steps well known to those skilled in the art are not described in detail to highlight the gist of the present invention.

[0102] Example 1 Target selection of foot-and-mouth disease virus circular RNA vaccine

[0103] Selecting a suitable antigen target is the first step and one of the difficulties in designing a circular RNA vaccine, which determines the effectiveness of the vaccine. The study of recombinant protein vaccines is an important reference for selecting RNA vaccine targets. So far, the recombinant protein vaccines for foot-and-mouth disease approved at home and abroad include virus-like particle vaccines, which express foot-and-mouth disease virus P1 protein in vitro and cleave and assemble to form virus particles, which can simulate the natural virus structure. However, the preparation of this vaccine requires the expression and cleavage of four structural proteins (VP1-VP4) and the correct assembly. Its production and purification process is difficult, and the relevant products have not yet been mass-produced and entered clinical application. The recombinant protein vaccines under development also often use VP1 protein or VP1 neutralizing B cell epitope peptides, but recent studies have shown that neutralizing B cell epitopes exist on VP1, VP2 and VP3 of foot-and-mouth disease virus (doi:10.1371 / journal.ppat.1009507), providing more possibilities for the selection of vaccine targets. Therefore, this study first screened the targets for designing circular RNA vaccines for foot-and-mouth disease virus.

[0104] 1.1 Gene design and synthesis

[0105] In this study, we first designed the vector DNA of circular RNA corresponding to the wild-type protein of the major capsid protein VP1, VP2 or VP3 of foot-and-mouth disease virus. The design of each element of circular RNA mainly referred to patent CN 114574483 A, among which the translation initiation element was selected from the Caprine kobuvirus IRES sequence in which the 80th G mutated to T, the 81st A mutated to C, and the 82nd G mutated to T to obtain a mutant sequence (numbered CKV) or the Echovirus E29 IRES sequence in which the 13th G mutated to T, the 19th T mutated to C, and the 20th G mutated to T to obtain a mutant sequence (numbered EVE).

[0106] Specifically, each DNA vector in this study contains the following elements arranged in the following order from 5' to 3': intron fragment II, translation initiation element truncation fragment II (numbered CKV-II or EVE-II, respectively), protein coding element, insertion element, translation initiation element truncation fragment I (numbered CKV-I or EVE-I, respectively), intron fragment I. Among them:

[0107] The nucleotide sequence of intron fragment II is shown in SEQ ID NO.1;

[0108] The nucleotide sequence of the translation initiation element truncation fragment II (CKV-II) is shown in SEQ ID NO. 2;

[0109] The protein coding element comprises: a nucleotide sequence encoding the VP1 protein of foot-and-mouth disease type O virus (as shown in SEQ ID NO.4) or the VP2 protein (as shown in SEQ ID NO.6) or the VP3 protein (as shown in SEQ ID NO.8), and a stop codon (as shown in (TAA)x(TAG)y(TGA)z, wherein x+y+z≥1, x, y, z are independently integers greater than or equal to 0, and the stop codon is preferably TGA);

[0110] The nucleotide sequence of the insertion element (polyAC) is shown in SEQ ID NO.9;

[0111] The nucleotide sequence of the translation initiation element truncation fragment I (CKV-I) is shown in SEQ ID NO.10;

[0112] The nucleotide sequence of intron fragment I is shown in SEQ ID NO.11.

[0113] The corresponding vectors designed with the above elements for VP1 protein, VP2 protein or VP3 protein are numbered pCKV-VP1-1051, pCKV-VP2-973, and pCKV-VP3-554 respectively.

[0114] The amino acid sequence of VP2 protein is shown in SEQ ID NO.5.

[0115] The above CKV translation initiation element is replaced with the EVE translation initiation element, and the corresponding vectors designed for VP1 protein, VP2 protein or VP3 protein are numbered pEVE-VP1-1051, pEVE-VP2-973, and pEVE-VP3-554, respectively, wherein the nucleotide sequence of the translation initiation element truncated fragment II (EVE-II) is shown in SEQ ID NO.12; the nucleotide sequence of the translation initiation element truncated fragment I (EVE-I) is shown in SEQ ID NO.13;

[0116] The above vectors are transcribed to obtain linear RNA molecules with corresponding structures. The mechanism of forming circular RNA from linear RNA molecules is as follows: ribozyme recognizes the connection position between translation initiation element truncated fragment I (IRES fragment I) and intron fragment I to generate a break, releasing intron fragment I; then ribozyme recognizes the connection position between translation initiation element truncated fragment II (IRES fragment II) and intron fragment II to generate a break, releasing intron fragment II. The 3' end of translation initiation element truncated fragment I and the 5' end of translation initiation element truncated fragment II are connected to form a circular molecule ( Figure 1 ).

[0117] The above genes pCKV-VP1-1051, pCKV-VP2-973, pCKV-VP3-554 and pEVE-VP1-1051, pEVE-VP2-973, pEVE-VP3-554 were commissioned to be synthesized and cloned by Suzhou Genewise Biotechnology Co., Ltd. The obtained gene fragments were connected to the pUC57 vector and verified to be correct by gene sequencing.

[0118] 1.2 Preparation of circular RNA

[0119] The DNA vector obtained in step 1.1 of this example is prepared into circular RNA.

[0120] (1) Test method

[0121] a) Preparation of bacterial strains: The synthesized DNA vectors were transformed into DH5α competent cells, spread on LB medium plates containing 100 μg / ml ampicillin, and cultured at 37°C. When the colonies on the plates were clearly visible, single colonies were picked and placed in 3 ml LB liquid culture medium containing 100 μg / ml ampicillin, cultured at 37°C, and 1 ml of the bacterial solution was added to glycerol with a final concentration of 8%, and stored at -80°C to obtain engineered bacteria as seeds for subsequent experiments.

[0122] b) Plasmid extraction: Activate the externally constructed puncture bacteria at 37°C / 220rpm for 3-4h; take the activated bacterial solution for expansion culture, culture conditions: shake overnight culture at 37°C / 220rpm; extract the plasmid using a commercial kit (Tiangen Endotoxin-Free Plasmid Extraction Kit).

[0123] c) Plasmid digestion and purification: The plasmid was digested by restriction endonuclease BsaI (nearshore protein) / BsaI (Takara), and the digestion system was as follows: 10× buffer: 100 μl, plasmid: 5 mg, BsaI: 150 μl (5000 U), water was added to 1000 μl, and digestion was carried out at 37°C overnight. After digestion, the digestion product was purified by column using a commercial DNA recovery kit (TIANGEN) to obtain a linearized plasmid.

[0124] d) In vitro transcription: The transcription system is configured as shown in Table 1 below:

[0125] Table 1

[0126] Reagents volume 10× Reaction Buffer 2ml ATP(100mM) 2ml CTP (100 mM) 2ml UTP(100mM) 2ml GTP (100 mM) 2ml Linearized plasmid (1.5 mg / ml) 600μl T7 RNA Polymerase (25U / μl) 2ml RNase inhibitor (10U / μl) 2ml Nuclease free water Total 20ml

[0127] Reaction conditions: Constant temperature shaking reaction at 37°C / 220rpm for 2-4h, then add 2ml of deoxyribonuclease I (DNaseI) to the transcription system, and constant temperature shaking reaction at 37°C / 220rpm for 15min.

[0128] e) Precipitation of transcription product mRNA: Add LiCl solution to the transcription product obtained in a) above, and place at -20°C for overnight precipitation; centrifuge the overnight treatment solution to obtain mRNA precipitate, dry at room temperature, and resuspend the precipitate in enzyme-free water to obtain a linear mRNA aqueous solution.

[0129] f) mRNA cyclization and concentration: The cyclization system and conditions are shown in Table 2 below

[0130] Table 2

[0131]

[0132] The above solutions were mixed thoroughly and heated at 55°C for 15 min. The circularized mRNA product was concentrated by ultrafiltration tube centrifugation, and the filtrate was discarded; and the ultrafiltration liquid was transferred to a new centrifuge tube.

[0133] g) Circular mRNA HPLC purification: A certain amount of circular mRNA was separated by chromatographic column SEC-1000 (SEPAX) in 150 mM phosphate buffer mobile phase, and the main peak component was collected.

[0134] h) Ultrafiltration and concentration of the purified circular mRNA: The circular mRNA tube is subjected to ultrafiltration centrifugation and concentration, and the filtrate is discarded; enzyme-free water is added to the ultrafiltration tube, and the circular mRNA is repeatedly washed twice, and the circular mRNA is concentrated to a desired concentration; the ultrafiltration liquid is transferred to a new centrifuge tube.

[0135] (2) Test results

[0136] Through the above process, the circular mRNA molecules shown in Table 3 were successfully prepared.

[0137] Table 3 Circular mRNA molecules

[0138]

[0139] 1.3 In vitro expression verification

[0140] Each circular mRNA prepared in step 1.2 of this example was transfected into 293T cells respectively. 48 hours after transfection, a His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) was used to quantitatively detect each antigen in the cell supernatant to evaluate the expression of each circular mRNA in each cell.

[0141] (1) Test method

[0142] 1) Cell culture: 293T cells were cultured at 1×10 5 Cells were inoculated into 24-well cell culture plates, and cultured in a 37°C, 5% CO2 incubator using DMEM high-glucose medium containing 10% fetal bovine serum and 1% double antibody. Cell transfection was performed when the cells reached 70% confluence.

[0143] 2) Cell transfection: 0.75-1.5 μL of MessengerMax (Thermo Fisher Scientific) was diluted to 25 μL with Opti-MEM (Thermo Fisher Scientific) per well and reacted at room temperature for 10 min. 0.5 μg of each circular RNA was diluted to 25 μL with Opti-MEM per well. 25 μL of MessengerMax / Opti-MEM diluted solution reacted at room temperature was mixed with 25 μL of circular mRNA / Opti-MEM diluted solution in a 1:1 ratio and incubated at room temperature for 5 min.

[0144] Add 50 μL of the incubated mixed reagent to each 24-well cell culture plate and culture in a 37°C, 5% CO2 incubator. Collect the cell supernatant after 48 hours of culture and freeze at -80°C.

[0145] The supernatant of 293T cells not transfected with circular mRNA was used as the negative control group (NC group).

[0146] 3) Detection of antigen content using His tag ELISA detection kit: A His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) was used to quantitatively detect the antigen content in the supernatant of each cell in step 2) according to the instructions to evaluate the expression of each circular mRNA in the cell.

[0147] (2) Test results

[0148] The results are shown in Table 4. After 48 hours of transfection, all optimized groups expressed, but the expression efficiency was different. The expression levels of the groups containing the EVE translation initiation element were slightly higher overall. Therefore, the group containing the EVE translation initiation element was initially selected for further screening and design research.

[0149] Table 4 In vitro expression level / ng / ml

[0150] Group Mean SD value Group Mean SD value CKV-VP1-1051 15.4 6.5 EVE-VP1-1051 20.3 5.4 CKV-VP2-973 12.3 4.9 EVE-VP2-973 13.6 9.1 CKV-VP3-554 10.7 5.3 EVE-VP3-554 22.4 6.5 Untransfected control 1.5 0.3 \ \ \

[0151] 1.4 LNP-mRNA preparation

[0152] The circular RNA molecules (EVE-VP1-1051, EVE-VP2-973, and EVE-VP3-554) obtained in step 1.3 were prepared into LNP-encapsulated RNA using commercial LNPs, which were numbered LNP / EVE-VP1-1051, LNP / EVE-VP2-973, and LNP / EVE-VP3-554, respectively, to prepare for further animal experiments.

[0153] (1) Test method

[0154] The main reference for LNP-mRNA preparation is DOI: 10.1016 / j.cell.2022.03.044. The specific process is as follows:

[0155] a) Dilute the circular RNA to a final concentration of 170 μg / mL using PNI formulation buffer (Precision NanoSystems, Cat. No. NWW0043).

[0156] b) On a NanoAssembler Ignite (Precision NanoSystems), commercial LNP (Precision NanoSystems) and circular RNA were mixed at a volume ratio of 1:3 using Ignite NxGenCartridge (Precision NanoSystems, Catalog No. NIT0002).

[0157] c) Using tangential flow technology, the buffer environment was replaced with PBS at pH 7.4 to remove ethanol and prepare LNP-mRNA.

[0158] d) Using Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen TMThe particle size, PDI and surface potential of LNP particles were measured by dynamic light scattering method on a Zeta potential laser particle size analyzer Malvern Zetasizer Nano-ZEN 3600 (Malvern).

[0159] (2) Test results

[0160] The mRNA-encapsulated LNP prepared in this step has a small particle size and uniform distribution, good encapsulation effect, and an encapsulation rate of more than 90%; the surface potential is electronegative, avoiding cytotoxicity caused by positive charge on the surface of the nanoparticles, and has good biosafety.

[0161] 1.5 Mouse immunization and O-type antibody determination

[0162] (1) Experimental methods

[0163] Female BABL / c mice aged 6 to 8 weeks were randomly divided into 7 groups, 4 mice in each group, and the three LNP-encapsulated circular mRNAs prepared in step 1.4 of this example (LNP / EVE-VP1-1051, LNP / EVE-VP2-973, LNP / EVE-VP3-554, respectively) were immunized with mice at a dose of 30 μg / mouse. At the same time, mice inoculated with LNP were used as negative controls, and booster immunization was performed once on the 21st day after the initial immunization. Blood was collected 14 days after the second immunization to separate serum, and antibody detection was performed using a liquid phase blocking ELISA detection kit for foot-and-mouth disease type O antibodies purchased from Lanzhou Veterinary Research Institute.

[0164] (2) Experimental results

[0165] The results are shown in Table 5. Although neutralizing B cell epitopes exist on VP1, VP2, and VP3, in this study, only the circular RNA vaccine encoding VP1 and VP3 proteins successfully induced antibodies that can block type O viruses, while the one encoding VP2 protein did not, indicating that the differentiated mechanism of RNA vaccine design and preparation cannot simply call the research information of protein vaccines for circular RNA vaccine target design. Furthermore, in this study, the circular RNA vaccine encoding VP1 protein (numbered EVE-VP1-1051, the nucleotide sequence of EVE-VP1-1051 circular mRNA is shown in SEQ ID NO.14) had the highest level of type O antibodies in mice, so VP1 protein was selected as the preferred target for designing circular RNA vaccines for foot-and-mouth disease virus. The research results on VP1 and VP3 can provide a basis for further design of multi-target combined circular RNA vaccines.

[0166] Table 5 Induction of virus blocking antibody titers in mice

[0167] Group Mean SD value LNP / EVE-VP1-1051 96.4 38.7 LNP / EVE-VP2-973 none none LNP / EVE-VP3-554 65.8 41.2 LNP none none

[0168] Example 2 VP1 protein design and optimization

[0169] Using the complete VP1 wild-type protein as a design unit may have defects: including the presence of uncertain decoy epitopes on the surface of viral proteins, which consume immune resources and lead to insufficient effective immunity, and further lead to antibody-dependent infection enhancement (ADE) effect; on the other hand, wild-type proteins are often prone to insufficient vaccine effect due to insufficient structural stability, toxicity, or the formation of non-natural aggregates during expression. This study analyzed the spatial structure and antigenicity of the VP1 protein of foot-and-mouth disease virus through molecular simulation, molecular dynamics, dominant B cell epitope prediction, and T cell epitope prediction, so as to make the correct amino acid sequence selection.

[0170] 2.1 Gene design and optimization, preparation of circular RNA

[0171] According to the prediction, a total of 18 DNA molecules were designed for VP1 protein, including 18 different protein mutations. DNA vectors were designed according to the method of step 1.1 in Example 1. The translation initiation element used in each vector was EVE, and the protein coding element contained 18 mutations of VP1 protein, as shown in Table 6. Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning.

[0172] The circular RNA was prepared according to the method of step 1.2 of Example 1, specifically, the nucleotide sequence of the VP1 wild protein (see SEQ ID NO.4) in the circular mRNA molecule (numbered EVE-VP1-1051, the mRNA nucleotide sequence is shown in SEQ ID NO.14) was replaced with the nucleotide sequence corresponding to Table 6, and finally the circular mRNA molecules shown in Table 6 were obtained.

[0173] Table 6 Optimization of circular mRNA molecules and VP1 protein design

[0174]

[0175]

[0176] 2.2 In vitro expression verification

[0177] Each circular mRNA prepared in step 2.1 of this example was transfected into 293T cells, and the cell supernatant was quantitatively detected for antigen using a HIS tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) 48 hours after transfection to evaluate the expression, with the circular RNA (number EVE-VP1-1051) against the VP1 wild-type protein prepared in step 1.2 of Example 1 and the untransfected group as controls. Specific cell culture and transfection, His tag ELISA detection kit detection methods are shown in step 1.3 of Example 1.

[0178] The results are shown in Table 7. The optimization of protein amino acids has a great influence on protein expression efficiency: compared with the wild type, the protein expression of EVE-VP1-1366 (mutation K202T), EVE-VP1-1370 (mutation V209R), and EVE-VP1-1373 (mutation L61P / K202Q / K210R) groups was greatly reduced, indicating that the mutation was harmful. The protein expression of the remaining groups increased to varying degrees and can be further studied.

[0179] Table 7 In vitro expression level / ng / ml

[0180]

[0181]

[0182] 2.3 LNP-mRNA preparation

[0183] The circular mRNAs prepared in step 2.1 of this example and the circular RNA encoding the VP1 wild protein (numbered EVE-VP1-1051) prepared in step 1.2 of example 1 were respectively prepared into lipid nanoparticle / RNA compositions using commercial LNPs (Precision NanoSystems). The compositions were found to meet the requirements after testing: the LNPs encapsulating the mRNA had a small particle size and uniform distribution, and had a good encapsulation effect, with an encapsulation rate greater than 90%; the surface potential was electrically neutral or electronegative, thus avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and had good biosafety.

[0184] 2.4 Mouse immunization and O-type antibody determination

[0185] Each circular RNA molecule encapsulated by LNP prepared in step 2.3 of this example was used to immunize mice, and mice inoculated with only LNP and circular RNA encoding VP1 wild protein (number EVE-VP1-1051) encapsulated by LNP were used as controls. The other operations were the same as step 1.5 of Example 1, and booster immunization was performed once on the 21st day after the initial immunization. Blood was collected 14 days after the second immunization to separate serum, and antibody detection was performed using a liquid phase blocking ELISA detection kit for foot-and-mouth disease O-type antibodies purchased from Lanzhou Veterinary Research Institute. At the same time, the antibody titer against VP1 in each group was detected using a commercial foot-and-mouth disease virus VP1 structural protein antibody enzyme-linked immunosorbent assay diagnostic kit (Shenlian Biopharmaceutical (Shanghai) Co., Ltd.), and the antibody titer was expressed as mean ± SD value.

[0186] The results are shown in Table 8. The titers of type O blocking antibodies in each group were significantly different, further indicating the necessity of amino acid sequence optimization for foot-and-mouth disease virus: in terms of truncation, truncation of 29 amino acids at the N-terminus effectively reduced VP1 antibodies and increased antibody titers, while truncation of 30 amino acids at the N-terminus significantly reduced antibodies, and there was no significant change in C-terminal truncation. In terms of single-point mutations, L61P, K202Q, and K210R effectively increased antibody titers, K202T and V209R mutations resulted in the inability to produce blocking antibodies, and the remaining mutations were ineffective. In terms of multiple-point mutations, L61P / K202Q / K210R mutations resulted in reduced antibodies, and L61P / K202Q mutations made the antibody titer better than the L61P / K210R group, which may be related to changes in antigenic structure and exposure of effective antigenic epitopes. The above factors were further screened, and the optimal molecule EVE-VP1-1375 (the nucleotide sequence of EVE-VP1-1375 circular mRNA is shown in SEQ ID NO.15, encoding VP1 truncation mutation 2 (VP1 protein N-terminal truncation of 29 amino acids / L61P / K202Q (amino acid sequence is shown in SEQ ID NO.16, nucleotide sequence 6 is shown in SEQ ID NO.17)) was successfully obtained. Compared with the wild-type molecule (numbered EVE-VP1-1051, mRNA nucleotide sequence is shown in SEQ ID NO.14), the VP1 antibody titer was reduced by 83.1%, and the O-type virus blocking antibody titer was increased by 2.6 times. The optimization of the VP1 protein amino acid sequence successfully reduced the ineffective immune consumption and successfully improved the vaccine effect.

[0187] Table 8 VP1 antibody titers and virus blocking antibody titers induced in mice

[0188]

[0189] Example 3 Nucleotide sequence design and optimization

[0190] In theory, a protein can be encoded by countless nucleotides, but it is difficult to select the optimal nucleotide sequence from them. This study analyzed the high-level structure of RNA through molecular dynamics calculations and other methods, and thus made a correct design of the nucleotide sequence encoding the target protein.

[0191] 3.1 Gene design and circular RNA preparation

[0192] For the VP1 truncation mutation 2 obtained in Example 2 (N-terminal truncation of 29 amino acids / L61P / K202Q, amino acid sequence SEQ ID NO.16, nucleotide sequence 6 (see SEQ ID NO.17)), 5 different nucleotide sequences were screened according to the calculation results: nucleotide sequence 1 (SEQ ID NO.18), nucleotide sequence 2 (SEQ ID NO.19), nucleotide sequence 3 (SEQ ID NO.20), nucleotide sequence 4 (SEQ ID NO.21), nucleotide sequence 5 (SEQ ID NO.22), and the corresponding DNA vectors were designed according to the method of step 1.1 in Example 1. The translation initiation element used in each vector was EVE, and the protein coding element contained 5 nucleotides of VP1 truncation plus mutant protein (N-terminal truncation of 29 amino acids / L61P / K202Q). Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning, and the corresponding circular RNA was prepared according to the method of step 1.2 in Example 1, and finally the circular mRNAs shown in Table 9 were obtained.

[0193] Table 9 Circular mRNA molecules and nucleotide sequence optimization

[0194]

[0195] Among them, the nucleotide sequence of EVE-VP1-5143 circular mRNA is shown in SEQ ID NO.34, the nucleotide sequence of EVE-VP1-5144 circular mRNA is shown in SEQ ID NO.35, the nucleotide sequence of EVE-VP1-5145 circular mRNA is shown in SEQ ID NO.36, and the nucleotide sequence of EVE-VP1-5146 circular mRNA is shown in SEQ ID NO.37.

[0196] 3.2 In vitro expression verification

[0197] Each circular mRNA molecule prepared in step 3.1 of this example and step 2.2 of example 2 was transfected into 293T cells, and each antigen in the cell supernatant was quantitatively detected using a His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) on day 1, 2, 3, 4, and 5 of transfection to evaluate the expression of each circular mRNA in each cell, with the untransfected group as a negative control. Specific cell culture and transfection, His tag ELISA detection kit detection methods are shown in step 1.3 of example 1.

[0198] The results are shown in Table 10. The nucleotide changes have a significant impact on the expression level and duration of expression:

[0199] Compared with the control EVE-VP1-1375, EVE-VP1-5143, EVE-VP1-5145, and EVE-VP1-5147 all significantly increased the target protein expression and expression duration, among which the EVE-VP1-5147 group (mRNA nucleotide sequence see SEQ ID NO.23) was preferred, with the target protein expression increased by 2.6 times at 48h. The optimization of the nucleotide sequence successfully improved the expression efficiency of the target antigen.

[0200] Table 10 In vitro expression level / ng / ml

[0201]

[0202] Example 4 Preparation of control RNA

[0203] To further compare the effects of circular RNA and linear RNA, this study used a kit to prepare linear RNA encoding foot-and-mouth disease virus (number linear-VP1-1051), which encodes the wild-type protein of foot-and-mouth disease virus VP1 (amino acid sequence see SEQ ID NO.3, nucleotide sequence see SEQ ID NO.4). The specific method and the kit used mainly refer to the research paper (Development of O-type foot-and-mouth disease mRNA vaccine [D], 2022).

[0204] To further compare the effects of the circular RNA prepared in this study with commercial circular RNA, this study used a commercially available circular RNA cloning and construction kit (Shanghai Kewei Chuang) to prepare a control circular RNA molecule (No. HM-VP1-5147), which encodes the foot-and-mouth disease virus VP1 truncated mutant protein 2 (amino acid sequence see SEQ ID NO.16, nucleotide sequence see SEQ ID NO.22). The preparation method refers to the kit instructions.

[0205] Example 5 Optimization of circular RNA molecular backbone

[0206] The circular RNA molecular skeleton disclosed in the prior art (patent CN 114574483 A) uses the preferred translation initiation elements of the Caprine kobuvirus IRES sequence (numbered CKV in the present invention) and the Echovirus E29 IRES sequence (numbered EVE in the present invention). The circular RNA containing these translation initiation elements is highly expressed in human cell lines (lung cancer human alveolar basal epithelial cells A549 cells or human kidney epithelial cell line 293T cells), but the effect in pigs is unknown; on the other hand, there are at least thousands of known translation initiation elements, and it is very difficult to select the suitable elements from them. This study designed a combinatorial library, a nucleotide site-directed mutagenesis modification library and other methods to analyze and compare the IRES sequence, so that a better translation initiation element was matched to the optimized VP1 protein nucleotide sequence.

[0207] 5.1IRES optimization design and circular RNA preparation

[0208] Three candidate translation initiation elements (numbered PPV, PSV and LTE) were obtained through preliminary screening, and the translation initiation elements in the preferred circular RNA molecule (numbered EVE-VP1-5147, nucleotide sequence SEQ ID NO.23) obtained by screening in Example 4 were replaced with candidate translation initiation elements (numbered PPV, PSV, LTE and CKV) and constructed into DNA vectors respectively, and the operation method was according to the method of step 1.1 of Example 1. Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning. The obtained gene fragment was connected to the pUC57 vector. The corresponding circular RNA was prepared according to the method of step 1.2 of Example 1, and finally the circular mRNA molecules as shown in Table 11 were obtained.

[0209] Table 11 Optimization of circular mRNA molecules and translation initiation elements

[0210]

[0211] 5.2 LNP-mRNA preparation

[0212] Each circular mRNA molecule prepared in step 5.1 of this example, the linear RNA molecule (numbered linear-VP1-1051) prepared in Example 4, and the control circular RNA molecule (numbered HM-VP1-5147) were respectively precipitated with commercial LNP (Precision NanoSystems) was prepared into a lipid nanoparticle / RNA composition, and the specific steps are shown in Example 1, and LNP-encapsulated EVE-VP1-5147, LNP-encapsulated CKV-VP1-5147, LNP-encapsulated PPV-VP1-5147, LNP-encapsulated PSV-VP1-5147, LNP-encapsulated LTE-VP1-5147, LNP-encapsulated linear-VP1-1051 and LNP-encapsulated HM-VP1-5147 were obtained, and they were numbered LNP / EVE-VP1-5147, LNP / CKV-VP1-5147, LNP / PPV-VP1-5147, LNP / PSV-VP1-5147, LNP / LTE-VP1-5147, LNP / linear-VP1-1051 and LNP / HM-VP1-5147, respectively. After testing, it was found to meet the requirements: the particle size distribution of LNPs encapsulating mRNA in each group was uniform, the encapsulation effect was good, and the encapsulation rate was greater than 90%; the surface potential was electrically neutral or electronegative, avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and the biosafety was good.

[0213] 5.3 Pig immunization and O-type antibody determination

[0214] The FMD virus antibody was negative at 70-90 days of age. The screening criteria for experimental pigs are shown in Table 12 below. A total of 63 piglets were screened.

[0215] Table 12 Screening criteria for experimental pigs

[0216]

[0217] The experimental animals were divided into 9 groups, 7 in each group, and immunized in the neck muscle. After preliminary dose exploration in the early stage, the RNA vaccine dose was set at 100 μg / head in this experiment. At the same time, the control was set as follows:

[0218] Group 1: LNP / EVE-VP1-5147 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0219] Group 2: LNP / CKV-VP1-5147 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0220] Group 3: LNP / PPV-VP1-5147 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0221] Group 4: LNP / PSV-VP1-5147 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0222] Group 5: LNP / LTE-VP1-5147 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0223] Group 6: LNP / linear-VP1-1051 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0224] Group 7: LNP / HM-VP1-5147 prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0225] Group 8: A certain brand of commercially available O-type FMDV whole-virus inactivated vaccine, with an immunization dose of 2 ml.

[0226] Group 9: LNP immunization group only, immunization dose 1 ml / head.

[0227] Each group was boosted with the same dose on the 28th day after the first immunization. Serum was collected and prepared 7 days, 28 days, and 180 days after the second immunization, and antibody detection was performed using a liquid phase blocking ELISA detection kit for foot-and-mouth disease type O antibodies purchased from Lanzhou Veterinary Research Institute.

[0228] The results are shown in Tables 13 to 15. The change of the translation initiation element has a great influence on the effect of the vaccine in pigs: compared with the EVE-VP1-5147 group, the blocking antibody titer was significantly increased when the translation initiation element was replaced with PPV (number PPV-VP1-5147) or LTE (number LTE-VP1-5147), but the blocking antibody titer was significantly reduced when it was replaced with CKV (number PPV-VP1-5147) or PSV (PSV-VP1-5147). This result shows that it is effective and necessary to optimize the circular RNA backbone, especially the translation initiation element, for pig products.

[0229] Furthermore, the PPV-VP1-5147 group was superior to the linear RNA molecules (numbered linear-VP1-1051) and commercial circular RNA molecules (numbered HM-VP1-5147) in terms of antibody response speed, antibody titer, and antibody duration, reaching a level similar to that of the inactivated vaccine group. High levels of type O antibodies could be produced 7 days after the second immunization and last until 180 days after the second immunization. The design and optimization of circular RNA vaccines around foot-and-mouth disease virus successfully improved the protective effect of the vaccine, providing a basis for the preparation of foot-and-mouth disease RNA vaccines.

[0230] Table 13 Induced blocking antibody titer in pigs (7 days after the second immunization) / Log 10 (Potency)Log 10 (Titer) reaching 1.8 or above is considered as immune standard

[0231]

[0232] Table 14 Induced blocking antibody titer in pigs (28 days after the second immunization) / Log 10 (Potency)Log 10 (Titer) reaching 1.8 or above is considered as immune standard

[0233]

[0234]

[0235] Table 15 Induced blocking antibody titer in pigs (180 days after the second immunization) / Log 10 (Potency)

[0236] Log 10 (Titer) reaching 1.8 or above is considered as immune standard

[0237]

[0238] 5.4 Detection of background immunogenicity in porcine cells

[0239] In order to preliminarily explore the mechanism of the improved effect of the PPV-VP1-5147 group, the expression of the immune-related cytokine IFN-beta induced by each group of RNA molecules obtained in step 5.3 of this example in pig intestinal epithelial cells (IPEC-J2) was further detected to evaluate the background immunogenicity of each molecule. The operation method refers to patent CN 114574483 A, as follows:

[0240] The purified circular mRNA was transfected into IPEC-J2 cells using Lipofectamine Messenger Max (Invitrogen). The specific implementation process is as follows:

[0241] IPEC-J2 cells were inoculated in DMEM high-glucose medium containing 10% fetal bovine serum and 1% double antibody and cultured in a 37°C, 5% CO2 incubator. Cells were subcultured every 2-3 days.

[0242] (1) Cell transfection:

[0243] Before transfection, IPEC-J2 cells were cultured at 1×10 5Each well was inoculated in a 24-well plate and cultured in a 37°C, 5% CO2 incubator. When the cells reached 70-90% confluence, the IPEC-J2 cells were transfected with 500 ng / well of mRNA using Lipofectamine MessengerMax (Invitrogen) transfection reagent according to the reagent operating instructions. The cells expressing for 8 hours were harvested, lysed, and the expression level of immune response proteins was verified by fluorescence quantitative PCR.

[0244] (2) Fluorescence quantitative PCR

[0245] The primer sequences used are as follows:

[0246] IFNb-F: TGGGAGGATTCTGCATTACC (SEQ ID NO.38)

[0247] IFNb-R: CAGCATCGCTGGTTGAGA (SEQ ID NO.39)

[0248] The results are shown in Table 16. Although the background immunogenicity of circular RNA molecules is generally lower than that of linear RNA molecules, unexpectedly, the difference in the circular elements of circular RNA molecules has a greater impact on the results: although the corresponding circular elements of EVE-VP1-5147 and CKV-VP1-5147 have low background immunity in human cell lines, they show high background immunogenicity in pig intestinal epithelial cells, indicating that the reaction mechanisms of the two cells are different and cannot be simply applied. The LTE-VP1-5147 group was improved, and the optimized PPV-VP1-5147 molecule greatly reduced the induction of immunogenicity in pig intestinal epithelial cells, which is conducive to improving the stability and expression efficiency of RNA molecules in pig cells, which may be an important mechanism to improve the immune effect of vaccines in pigs.

[0249] Table 16 Induction of expression of immune-related cytokine IFN-beta in pig cells

[0250] Grouping Mean SD value EVE-VP1-5147 159.7 56.4 CKV-VP1-5147 158.2 38.9 PPV-VP1-5147 76.4 65.2 PSV-VP1-5147 254.3 90.7 LTE-VP1-5147 102.4 59.8 linear-VP1-1051 325.7 93.1 HM-VP1-5147 124.3 82.1 Negative control group 15.7 2.8

[0251] Example 6 Cellular Immune Response Detection

[0252] The cellular immune response stimulated by each group of RNA vaccines in pigs was further detected. Blood PBMC cells were collected from each immunization group (PPV-VP1-5147 group, EVE-VP1-5147 group, linear-VP1-1051, inactivated vaccine group, LNP group) in step 5.3 of Example 5, and the corresponding lymphocyte subtypes were detected by flow cytometry. The specific operation is as follows:

[0253] (1) 14 days after the second immunization, anticoagulated blood was collected from each group and single cell suspensions were prepared;

[0254] (2) Cell density adjustment and density counting: After filtering the above single cell suspension through a 100 μm cell sieve, take 18 μL and add it to a 200 μL EP tube, add 2 μL of trypan blue and mix well, then take 10 μL and add it to a counting plate for cell counting, and dilute it with an appropriate amount of PBS solution until the density of the single cell suspension is 1×10 6 / mL; observe the number of dead cells and living cells under a microscope. Antibody incubation can be carried out only after the cell density and cell viability of the single cell suspension meet the requirements.

[0255] (3) Antibody incubation:

[0256] Prepare single-stained tubes: take 0.5 mL of each group of single-cell suspensions into 3 1.5 mL EP tubes, add 1 μL of fluorescein isothiocyanate FITC-labeled mouse anti-swine CD3 antibody (BD Company), 1 μL of phycoerythrin PE-labeled mouse anti-swine CD4 antibody (BD Company), and 1 μL of allophycocyanin fluorescein APC-labeled mouse anti-swine CD8 antibody (BD Company), incubate at 4°C in the dark for 30 min, then centrifuge at 1000 r / min for 5 min, remove the supernatant, resuspend with 0.5 mL PBS, and place on ice. Add 2.5 μL 7-aminoactinomycin D (eBioscience Company) to each tube before loading.

[0257] Prepare sample tubes: take 1 mL of each group of single cell suspensions into 1.5 mL EP tubes, and add 2 μL of fluorescein isothiocyanate FITC-labeled mouse anti-swine CD3 antibody (BD Company), 5 μL of phycoerythrin fluorescein PE-labeled mouse anti-swine CD4 antibody (BD Company), and 5 μL of allophycocyanin fluorescein APC-labeled mouse anti-swine CD8 antibody (BD Company). Incubate at 4°C in the dark for 30 min, then centrifuge at 1000 r / min for 5 min, remove the supernatant, resuspend with 1 mL PBS, and place on ice. Add 5 μL of 7-aminoactinomycin D (eBioscience Company) to each tube before loading.

[0258] (4) Sorting on the flow cytometer: Sorting was performed on the flow cytometer (BD Aria SORP, BD). The above tubes were filtered into the flow tubes with a 100 μm cell sieve and marked. First, the blank tube was used to determine the location of lymphocytes, and then the single-stained tube was used to determine whether the antibody labeling was good. If the labeling was good (i.e., the antibody fluorescence signal value was 10 3The samples were placed in the sample tubes, and CD4-CD8- double negative cells, CD4+CD8+ double positive cells, CD4+CD8- single positive cells, and CD4-CD8+ single positive cells were circled and sorted. Unpaired t-test was used for statistical significance analysis, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0259] The results are as follows Figure 2 As shown, the linear-VP1-1051 group and the inactivated vaccine can induce an increase in CD4+ cells in pigs, but fail to effectively stimulate CD8+T cell immune response (the increase ratio is less than 5% compared with the LNP group). The EVE-VP1-5147 group has a slight improvement, and the proportion of CD8+T cells in the optimized PPV-VP1-5147 group is significantly higher than that of the other groups, and the increase of 13% compared with the LNP group indicates that the cellular immune response, especially the CD8+T cell immune response, is successfully activated. According to the literature (Chinese Veterinary Science 2012, 42 (10): 1024-1030), the immune protection rate of the vaccine is well correlated with the CD8+T cell immune response. Enhancing the CD8+T lymphocyte response can improve the immune protection rate of the vaccine. An increase of ~5% in the proportion of CD8+T cells can achieve an immune protection rate increase of more than 60%.

[0260] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A circular RNA, characterized in that The circular RNA comprises a coding element, and the coding element encodes a polypeptide comprising a foot-and-mouth disease virus capsid protein.

2. The circular RNA according to claim 1, characterized in that The coding element code includes any one of (a) to (b): (a) the amino acid sequence of the VP1 protein of foot-and-mouth disease virus comprises the sequence shown in SEQ ID NO.3, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.3 and having or partially having the VP1 protein activity; (b) The amino acid sequence of the VP3 protein of foot-and-mouth disease virus comprises the sequence shown in SEQ ID NO.7, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.7 and having or partially having VP3 protein activity.

3. The circular RNA according to claim 1 or 2, characterized in that The coding element encodes any one of the following: an amino acid sequence of foot-and-mouth disease virus VP1 protein with 27 amino acids truncated at the N-terminus, 29 amino acids truncated at the N-terminus, 30 amino acids truncated at the N-terminus, 10 amino acids truncated at the C-terminus, comprising mutation L61P, comprising mutation L61A, comprising mutation K202Q, comprising mutation K202T, comprising mutation I48S, comprising mutation C187Y, comprising mutation K210R, comprising mutation V209R, comprising mutation L61P / K202Q, comprising mutation L61P / K210R, comprising mutation L61P / K202Q / K210R, N-terminal truncation of 27 amino acids / comprising mutation L61P / K202Q, N-terminal truncation of 29 amino acids / comprising mutation L61P / K202Q, N-terminal truncation of 30 amino acids / comprising mutation L61P / K202Q, and wild-type VP1 protein.

4. The circular RNA according to claim 1, characterized in that The coding element code includes any one of the following (a) to (b): (a) the nucleotide sequence of the foot-and-mouth disease VP1 protein comprises the sequence shown in SEQ ID NO.4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.4, and encodes a sequence having or partially having the activity of a polypeptide having the activity of the foot-and-mouth disease VP1 protein; (b) The nucleotide sequence of the foot-and-mouth disease VP3 protein comprises the sequence shown in SEQ ID NO.8, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.8, and encodes a sequence that has or partially has a polypeptide having foot-and-mouth disease VP3 protein activity.

5. The circular RNA according to claim 1 or 4, characterized in that The coding element comprises a nucleotide sequence encoding any one of the following: a nucleotide sequence encoding any one of the following: a nucleotide sequence encoding 27 amino acids at the N-terminus of the foot-and-mouth disease virus VP1 protein, a nucleotide sequence encoding 29 amino acids at the N-terminus, a nucleotide sequence encoding 30 amino acids at the N-terminus, a nucleotide sequence encoding 10 amino acids at the C-terminus, a nucleotide sequence encoding L61P mutation, a nucleotide sequence encoding L61A mutation, a nucleotide sequence encoding K202Q mutation, a nucleotide sequence encoding K202T mutation, a nucleotide sequence encoding I48S mutation, a nucleotide sequence encoding C187Y mutation, a nucleotide sequence encoding K210R mutation, a nucleotide sequence encoding V209R mutation, a nucleotide sequence encoding L61P / K202Q mutation, a nucleotide sequence encoding L61P / K210R mutation, a nucleotide sequence encoding L61P / K202Q mutation / K210R mutation, a nucleotide sequence encoding 27 amino acids at the N-terminus, a nucleotide sequence encoding L61P / K202Q mutation, a nucleotide sequence encoding L61P / K202Q mutation, and a wild-type VP1 protein.

6. The circular RNA according to claim 1, characterized in that The coding element comprises any one of the following nucleotide sequences encoding the foot-and-mouth disease VP1 protein N-terminally truncated with 29 amino acids / containing the mutation L61P / K202Q: Nucleotide sequence 1 as shown in SEQ ID NO.18, nucleotide sequence 2 as shown in SEQ ID NO.19, nucleotide sequence 3 as shown in SEQ ID NO.20, nucleotide sequence 4 as shown in SEQ ID NO.21, nucleotide sequence 5 as shown in SEQ ID NO.22, and nucleotide sequence 6 as shown in SEQ ID NO.

17.

7. The circular RNA according to claim 1, characterized in that The circular RNA comprises the elements arranged in the order shown in any one of the following (a) to (d): (a) the first exon, the second exon, the 5' spacer, the translation initiation element, the coding element and the 3' spacer; (b) first exon, second exon, translation initiation element and coding element; (c) translation initiation elements and coding elements; (d) Translation initiation elements, coding elements and insertion elements.

8. The circular RNA according to claim 7, characterized in that The translation initiation element comprises one or more of the following sequences with translation initiation activity: an IRES sequence, a 5'UTR sequence, a Kozak sequence, a sequence comprising m 6 A modified sequence, a complementary sequence of ribosomal 18S rRNA; the insertion element comprises one or more of the following sequences: an untranslated region sequence, a polyN sequence, an adaptor sequence, a ribosomal switch sequence, and a sequence binding to a transcriptional regulatory factor; wherein the untranslated region sequence includes a stop codon, and in the polyN sequence, N is selected from at least one of A, T, G, and C.

9. The circular RNA according to claim 7 or 8, characterized in that A nucleotide sequence comprising any one of the following: a nucleotide sequence as shown in SEQ ID NO.14, a nucleotide sequence as shown in SEQ ID NO.15, a nucleotide sequence as shown in SEQ ID NO.23, a nucleotide sequence as shown in SEQ ID NO.30, a nucleotide sequence as shown in SEQ ID NO.31, a nucleotide sequence as shown in SEQ ID NO.32, a nucleotide sequence as shown in SEQ ID NO.33, a nucleotide sequence as shown in SEQ ID NO.34, a nucleotide sequence as shown in SEQ ID NO.35, a nucleotide sequence as shown in SEQ ID NO.36, and a nucleotide sequence as shown in SEQ ID NO.

37.

10. A linear RNA, characterized in that The linear RNA undergoes self-cleavage reaction and then circularizes to form the circular RNA according to any one of claims 1 to 9.

11. A recombinant nucleic acid molecule, characterized in that The recombinant nucleic acid molecule forms a linear RNA after transcription; the linear RNA is as shown in claim 10, or the linear RNA undergoes a self-cleavage reaction and then cyclizes to form a circular RNA as described in any one of claims 1-9.

12. A recombinant Escherichia coli engineered bacterium, characterized in that: The engineered bacteria are obtained by transforming E. coli with the recombinant nucleic acid molecule as claimed in claim 11.

13. Use of the circular RNA according to any one of claims 1 to 9, or the linear RNA according to claim 10, or the recombinant nucleic acid molecule according to claim 11, or the recombinant Escherichia coli engineered bacteria according to claim 12 in the preparation of a medicament for preventing and / or treating foot-and-mouth disease.

Images